Introduction
Evidences in literature suggest that prostatic inflammation is involved in the pathogenesis and progression of prostatic diseases, such as benign prostatic hyperplasia (BPH) and prostate cancer (PC). Epidemiologic, histopathologic and molecular pathologic studies support the association between prostate inflammation and prostate diseases, suggesting a possible mechanism of action [
1‐
7].
The lipidosterolic extract of the fruits of the American dwarf palm tree
Serenoa repens (LSESr) (Permixon) is probably the most studied phytotherapeutic drug, widely used for lower urinary tract symptoms (LUTS) treatment. A large number of pharmacodynamic effects, observed in vitro and in vivo, suggest multiple mechanisms of action on the human prostatic tissue, such as the anti-androgen effect [
8,
9], and the interference with mediators of inflammation [
10‐
12] and with proliferative-apoptosis pathways [
13]. Different studies [
10‐
12], which tested the pharmacological properties of this drug on the inflammatory status of the prostatic tissue, concluded that the LSESr might have a potential anti-inflammatory effect.
The aim of our study is to analyze and to compare the expression of the inflammatory pathways in human PC cell lines, such as androgen-dependent LNCap and androgen-independent PC3 cell lines and in primary cultures of human prostate adenocarcinoma cells. On these different settings, we also evaluated the effect of LSESr (Permixon) on different inflammatory factors, analyzing whether its potential anti-inflammatory activity affects proliferation and apoptosis.
Materials and methods
Cell lines
LNCaP and PC3 cell lines were obtained from Interlab Cell Line Collection (ICLC) (Istituto Nazionale per la Ricerca sul Cancro, Genoa, Italy).
Human cancer epithelial cell line PC3 was grown in DMEM (Euroclone, Life Science Division, GB, Pero, Italy) supplemented with 10% fetal bovine serum (Euroclone) and LNCaP in RPMI 1640 (Euroclone). Cells were maintained in a tissue culture incubator at 37°C, 5% CO2. Cells were treated with LSESr (44–88 μg/ml) at different incubation times (24, 48 and 72 hours) and after RNA extraction, RT-PCR assay was performed at the same intervals of time.
Ex vivo primary cultures
This experimental study was conducted after approval of the protocol from our Institutional Board Committee and informed consent was obtained from all patients. Exclusion criteria for the study were: previous hormonal, surgical or radiation therapies for prostate diseases; acute inflammatory diseases. Table
1 summarizes the characteristics of donors.
Table 1
Clinical characteristics of the 40 cases included for the analysis on primary cultures (number of cases and mean ± SD)
Age (years) | 65.0 ± 3.3 |
Prostate volume (ml) | 43.4 ± 6.8 |
PSA (ng/ml) | 6.8 ± 2.4 |
Pathological stage | 36 pT2 |
4 pT3a |
Pathological Gleason score | 27 ≤ 7 (3 + 4) |
13 ≥ 7 (4 + 3) |
We derived human epithelial cultures from tissue explanted from 40 patients undergoing radical prostatectomy for prostate adenocarcinoma. At surgery, after prostate removal, tissue samples were put on ice in Falcon tube containing 5 ml of minimum essential medium (Euroclone) and transferred in laboratory where they were immediately processed. From these cases (40 cases), we processed tissue fragments either from PC nodules (named Tumor “T”) or from normal tissue (named control “Ct”). The histological status of the tissue was checked by an independent pathologist.
In brief, the fresh tumor and normal tissue specimens were cut in small pieces and digested with trypsin under stirring 2 hours at 37°C. After filtration through 70 μm nylon cell strainer, epithelial cells were grown in PrEGM (Prostate Epithelial Growth Medium), containing the standard prostatic epithelial cell media additives (PrEGM Bullet Kit), including bovine pituitary extract, insulin, transferrin, epidermal growth factor, hydrocortisone, retinoic acid, epinephrine, and tri-iodothyronine, from Lonza.
After two weeks, when the different cells showed an exponential growth rate, they were treated with LSESr (Permixon®, Pierre Fabre Médicament, Castres, France).
Preparation of LSESr (Permixon®) and stimulation settings
LSESr (Permixon) was obtained as a hexane extract from Pierre Fabre Medicament (Castres, France). The hexane was evaporated to leave the solid extract. The solid was dissolved in 10 ml of ethanol, to give a concentration of 10 mg/ml. This stock solution was further diluted in appropriate media to provide a working solution of 1 mg/ml.
Cell counting
To determine the cell counting, LNCaP, PC3 and primary prostate cells were plated and subconfluent cells were treated with LSESr (Permixon) at a concentration of 44 and 88 μg/ml at different incubation times (6, 9, 24, 48 and 72 hours). After treatment cells were trypsinized, washed in-Phosphate buffered saline (PBS) and after centrifugation (5 min at 500 g) were resuspended in PSB (50-100 μl). An aliquot of each cell line was diluted 1:1 with 0.4% of trypsan blue. Cells were then loaded into a Neubauer chamber and living cells (unstained) were counted under a light microscope. Each assay was carried out in triplicate and the mean value was determined.
Cyototoxic assay
LNCaP and PC3 cells were seeded in triplicate in 96-well plates at 5.0 × 104 cells per well. After 24 hours, Serenoa Repens (44 μg/ml) was added in a red phenol free DMEM medium for 48 and 72 hours, then cells were incubated with 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt (XTT; Cell Proliferation kit Sigma-Aldrich) following the manufacturer’s instruction.
Absorbance was measured at 450 nm using a microplate reader (Labsystem Multiskan MS), the absorbance at 690 nm was subtracted from the 450 nm value and cytotoxicity was calculated by comparing absorbance of treated cultures with the absorbance of the untreated cultures at 48 and 72 hours.
Caspase detection
In PC3 cell line and in primary cultures, anti-activated Caspase-3 antibody (Cell Signalling Technology) was used to carry out immunofluorescence assay and to investigate apoptosis induced in different cells by LSESr (Permixon). Cells were grown on Labteck chamber slides (Nunc, Naperville, Illinois, USA) for 24 hours, then treated with LSESr (Permixon) 44 μg/ml for 16 hours and analysed with immunocytochemistry using anti-cleaved caspase-3 and rhodamine indirect labelling. Cells treated and controls were fixed and permeabilized in methanol at −20°C for 10 min, rinsed in PBS, incubated for 1 hour at room temperature with TRITC-conjugated anti-rabbit IgG (1:500, Molecular Probes) and then examined under fluorescence microscope (Olympus BX-52).
Reverse transcriptase polymerase chain reaction (RT-PCR) assay
Total RNA from LNCaP, PC3 and human prostate primary cells were extracted using Trizol reagent (Invitrogene, Carlsband, CA) according to the manufacturer’s instructions. High quality RNA preparations have been re-suspended in nuclease-free water and subjected to semi-quantitative polymerase chain reaction (RT-PCR). Moloney murine leukemia virus (M-MLV) reverse transcriptase (Biolab) was used to convert 1 μg of total RNA into cDNA at 42°C. 5 μg of each cDNA was then subjected to RT-PCR in a buffer containing 25 pmol of upstream and downstream and 1.25U of Platinum Taq polymerase (Euroclone). The amount of amplified products, expressed in arbitrary optical density units, was normalized with glyceraldehyde-3-phosphate dehydrogenase (GADPH) as housekeeping gene. The sequences of human gene-specific primers and the conditions of amplification as well as the amplified products size are listed in Table
1, with order of forward and reverse. The amplification reaction was carried out in PCR-expressed cyclers (TECHNE USI Instrument). The resulting PCR products were separated in 2% agarose gel and visualized with ethidium bromide. The primer sequences, amplification sizes and amplification conditions for each gene are listed in Table
2.
Table 2
Primers sequences and amplification conditions
GADPH | ACATGTTCCAATATGATTCC | 30 | 60°×30” | 180 |
TGGACTCCACGACGTACTCAG |
Il-6 | CCTCCAGAACAGTTTGAGA | 30 | 56°×1’ | 280 |
CCTTAAAGCTGCGCAGAATG |
CCL-5 | CTCGCTGTCATCCTCATTGCT | 30 | 62°×30” | 394 |
TACTCCCGAACCCATTTCTTCTC |
CCL-2 | ATG AAA GTC TCT GCC GCC CTT CTG T | 36 | 60°×30” | 286 |
AGT CTT CGG AGT TTG GGT TTG CTT G |
COX-1 | TGC CCA GCT CCT GGC CCG CCG CTT | 30 | 60°×1’ | 304 |
GTG CAT CAA CAC AGG CGC CTC TTC |
COX-2 | TTC AAA TGA GAT TGT GGG AAA AT | 30 | 60°×1’ | 305 |
AGA TCA TCT CTG CCT GAG TAT CTT |
iNOS | TGG TGC TGT ATT TCC TTA CGA GGC GAA GAA GG | 35 | 60°×45” | 259 |
GGT GCT TCT TGT TAG GAG GTC AAG TAA AGG GC |
Immunofluorescence
The protocol was performed only in LNCaP and PC3 culture cell lines. Cells were grown on Labteck chamber slides (Nunc, Naperville, Illinois, USA) and treated with LSESr (Permixon). After treatment, cells were washed with phosphate-buffered saline (PBS) and fixed with absolute methanol for 5 minutes at −20°C. Cells were then incubated for 1 hour with rabbit polyclonal antibody to p65 (Santa Cruz Biotechnology), rinsed three times with PBS and then incubated with fluorescein isothiocyanate-conjugated anti-rabbit IgG (Sigma, Milano, Italy) for 1 hour. Cells were then rinsed three times with PBS and mounted with Prolong anti-fade reagent, and the fluorescence was analyzed by an Olympus BX52 (Hamburg, Germany) fluorescence microscope. The images were acquired and elaborated with IAS 2000 software (Delta Sistemi, Rome, Italy).
Statistical analysis
Statistical significance was determined using a one tailed Student’s t test (PRISM statistical analysis software) and data were expressed as means ± standard deviation (SD) of independent samplings from different experiments. A cut-off of p < 0.05 was used to demonstrate significance.
Discussion
This study shows for first time that primary human PC cells are influenced in growth and apoptosis pathways by natural compounds such as LSESr (Permixon), which down-regulates the inflammation pattern.
The use of primary prostatic tissue represent a good model of study for these experiments compared to cells in continue culture (LNCaP and PC3) because it reflects a more realistic biological state of human prostate cells [
14,
15]. It is considered that primary cells retain many phenotypic characteristics of the original tissue, including physiological functions and therefore they can be an appropriate model also for drugs testing.
Doses of LSESr (Permixon) and incubation times were sourced from the literature in PC cell lines, also if a large variability exists [
16‐
19]. Regarding the dose of LSESr (Permixon), different studies suggested that 10 μg/ml well represents the calculated plasma concentration in patients receiving the recommended therapeutic dosage [
18]. Previous studies showed that in PC cell lines higher doses are needed to obtain significant results, which are also influenced by a dose dependent effect [
16‐
20].
The first result obtained in our study is that in every experiment (LNCaP, PC3 and primary cultures) we detected a significant reduction in PC cells counting caused by LSESr (Permixon) treatment. Comparable results were also observed in cells derived from normal prostate tissue. We stopped the analysis at 16 hours and used only 44 μg/ml of LSESr (Permixon) because the cells derived from primary cultures showed a more inhibited growth when incubated with LSESr (Permixon). These findings suggest that the sensibility to LSESr (Permixon) depends on the cell line, and the response is stronger in primary cultures.
Our results highlight that the inhibited growth observed after treatment with LSESr (Permixon) is determined by the activation of a cellular mechanism related to apoptosis. In the same condition, we also detected an induction of the apoptotic pathway, under LSESr treatment, caused by the caspase-3 activation [
21,
22].
However other studies detected apoptosis after
Serenoa repens treatment [
17,
23]; some authors demonstrated that Permixon can effect prostate cancer cell growth without inducing apoptosis [
24]. Different results are possibly due to: different preparation of the drug in various laboratories can contain a different active amount of
Serenoa repens or same cell line after a long time in culture can get some different biological activity for mutation in its genotype [
25].
The second result obtained from our study is that LSESr (Pemixon) produces a down-regulation of most of the inflammatory-related genes tested. We underline that this study analysed also COX and iNOS genes expression and we showed a down-regulation of both COX-1 and iNOS induced by LSESr (Permixon) in PC3 cell line as in several primary cell cultures.
In this study we had the possibility to evaluate in the same experiment and in primary cultures the major inflammatory-related genes, which might be responsible for influencing PC disease. All these inflammatory-related genes were expressed and all, except the COX-2 gene, were down-regulated by LSESr (Permixon) in primary cultures and in PC3 cell lines. However, in LNCap cell line, only CCL-2 and iNOS genes were expressed. The lack of expression for most of the inflammatory genes in LNCaP line may be related to the different origin of these cells, which are androgen-dependent and do not express IL-6 protein [
26]. A quantitative analysis of inflammatory markers and their modifications under treatment should be very important and should be added at our experiments; this represent a strong limit of this study and other results are still necessary.
Finally, we analysed NF-kB gene expression by immunofluorescence. NF-kB is anchorated in the cytoplasm in an inactive form by the association with a cell family inhibitor of kappa B (IkB). Different signals can induce IkB phpsphorilation and degradation by proteosomes, so that NF-kB is translocated in the nucleus, where it can induce the transcription of multiple genes. Such NF-kB activation can induce either pathways that promote cell survival or other pathways that promote cell death. The different effects mediated by NF-kB depend on the activated signals and the type of tissue or cell line [
27‐
31]. The antibody to NF-kB used in the present paper has been previously utilized by other authors to asses NF-kB activation by immunofluorescent staining of NF-kB nuclear translocation [
32,
33].
We showed that in LNCaP and PC3 line, LSESr (Permixon) induces activation of NF-kB through its translocation in the cell nucleus. A down-regulation of the different inflammatory-related genes and a significant reduction in PC cell counting related to an apoptotic process was found at the same time of incubation and concentration of LSESr (Permixon) in which NF-kB was activated.
Our findings support the hypothesis that LSESr (Permixon) might have an inhibitory effect on the expression of inflammation related genes. We can suppose that LSESr (Permixon) can stimulate NF-kB pathway leading to a pro-death response. However, we can expect that LSESr (Permixon) acts via different mechanisms to inhibit cell proliferation in LNCaP cell line. Nevertheless, the correlation of NF-kB with proliferation and apoptotic responses need further investigation caused by different androgen dependence and inflammation related gene expression.
Author’s contribution
IS carried out PCR analysis, organization of experimental evaluation on primary cultures. SC clinical evaluation of patients, surgical procedures, collecting data; manuscript writing. AMA carried out NFkB analysis by immunofluorescence. CN carried out cell count in primary cultures. SS carried out apoptosis experiments. SS clinical evalutation of patients, surgical procedures. LF final supervision and evaluation. VG supervisor; clinical management of patients. AS study ideation and management of patients; surgical procedure. All authors read and approved the final manuscript.
Competing interests
No potential conflict of interest was disclosed.