Background
Ayurved Siriraj Wattana recipe (AVS073) [
1] has been used in Thai traditional medicine for decades. The recipe was prescribed for health promotion, strength supplement, appetite induction and attenuation of degeneration (anti-aging). It has recently been tested for immunomodulatory activity (NK cells activity), osteoarthritis and gastric emptying rate [
2‐
4]. It conveyed protection against UVA-induced melanogenesis through an antioxidant/redox mechanism [
1]. The 18 medicinal plant components of the recipe are
Aegle marmelos (L.) Corrêa.,
Boesenbergia rotunda (L.) Mansf.,
Caesalpinia sappan L.,
Carthamus tinctorius L.,
Cinnamomum siamense Craib,
Citrus sinensis L.Osbeck,
Cladogynos orientalis Zipp. ex Span.,
Cryptolepis buchanani Roem. & Schult., Cyperus rotundus L.,
Derris scandens (Roxb.) Benth.,
Drypetes roxburghii Wall.,
Ferula assa-foetida L.,
Ligusticum sinense Oliv.,
Mallotus repandus (Willd.) Müll.Arg.,
Piper nigrum L.,
Saussurea lappa (Decne.) Sch.Bip.,
Terminalia chebula Retz.,
Tinospora crispa (L.) Hook. f. & Thomson.
Aegle marmelos (L.) Corrêa has been used in the treatment of chronic diarrhea, peptic ulcers and dysentery, as a laxative and to recuperate from respiratory affections in various traditional medicines [
5,
6].
Boesenbergia rotunda (L.) Mansf has been commonly used in Southeast Asia as a food ingredient. Traditional healers throughout Thailand have been using this plant against inflammation, aphthous ulcer, dry mouth, stomach discomfort, dysentery, oral disease and cancers [
7‐
9]. The heartwood of
Caesalpinia sappan L. has been used as a hemostatic, analgesic and anti-inflammatory for traumatic disease and blood flow promoting agent [
10‐
13].
Carthamus tinctorius L. has various pharmacological effects, e.g., anticoagulant and antithrombotic activities, anti-fibrotic effect, immunomodulatory activity [
14‐
16]. The stem of
Cryptolepis buchanani Roem. & Schult. has been used for the treatment of inflammation, including muscle and joint pain [
17‐
19].
Cyperus rotundus L. has antidepressant [
20] and anti-melanogenesis activities [
21].
Tinospora crispa (L.) Hook. f. & Thomson has immunostimulatory effect [
22,
23]. The other plant components in AVS073 also have anti-inflammatory effect and analgesic activity [
24‐
30]. Some components of AVS073 showed direct anti-cancer properties through inhibiting cell growth or inducing cellular apoptosis, and indirect pathway via the immunological action of immune cells [
31,
32]. Several in vitro and in vivo studies demonstrated that the extracts of AVS073′s components carried antioxidant, anti-inflammatory, immunomodulating and anti-cancer actions [
33‐
40].
Differentiation of Th1 cells are driven by STAT1 and STAT4 while STAT6 and GATA3 induces Th2 cells, forkhead transcription factor (Foxp3) induces regulatory T (Treg) cells, and retinoic acid-related orphan receptor (Rorc) induces Th17 cells [
41]. Differentiation of Th1 cell and regulatory T (Treg) cells may be actually linked to the differentiation of Th2 and Th17, respectively, depending on the overall cytokine milieu. The differentiation of both Treg and Th17 cells requires TGF-β. The differentiation of Th17 cells requires low concentrations of TGF-β in combination with the pro-inflammatory cytokines IL-6 and IL-23 [
42], while in the absence of pro-inflammatory cytokines, high concentrations of TGF-β is optimal for Foxp3 expression and thus tips the balance towards Treg cell differentiation [
43,
44]. In addition to cytokine environment, Treg cell development could be enhanced by kynurenine [
45], a breakdown product of indoleamine 2, 3-dioxygenase (IDO) in dendritic cells (DCs).
DCs are professional antigen presenting cells that present antigens to naïve T cells, inducing their differentiation towards either Th1 or Th2 phenotype. DCs that generate Th1 responses would handle infections or malignant disorders via the induction of Th1-polarizing cytokine interleukin-12 (IL-12) and interferon-gamma (IFN-γ) [
31]. In addition, Th17 cells also play a role in anti-tumor immunity [
46]. In contrast, induction of Th2 responses by DCs may provide clinical benefits when Th1 responses are excessive, e.g., transplantation, contract allergy, or autoimmune disorders, by producing Th2 cytokines in particular IL-4, to induce B cells to secrete protective antibodies [
47]. Immature DCs can be differentiated from monocytes and bone marrow progenitor cells by treatment with granulocyte macrophage colony-stimulating factor (GM-CSF) and IL-4. Immature DCs are stimulated with maturation signals, such as tumor necrosis factor α (TNF-α), to express a strong immune response against foreign antigens. The exposure of cytokine-induced killer (CIK) cells to mature DCs led to the enhancement of anti-tumor cytolytic activity of the former [
48‐
50].
A number of studies showed the possible immunological action of AVS073′s components in DCs.
Carthamus tinctorius L. extract has been reported to stimulate the production of IFN-γ and IL-10 in mouse splenic T lymphocytes and promote the expression of maturation markers in mouse bone-marrow-derived DCs. Furthermore,
Carthamus tinctorius L. treated DCs maintained the high profile of maturation markers in tumor antigen pulsed-DCs [
31]. In contrast,
Piper nigrum L. significantly inhibited the phenotypic maturation, cytokine production (TNF-α and IL-12), phosphorylation of ERK and JNK, but enhanced the endocytosis activity of LPS-induced bone-marrow-derived DCs [
32]. DCs, which can subsequently interact with CIK cells [
49,
51], might be potential targets of this recipe.
CIK cells have been used as non-major histocompatibility complex (MHC)-restricted effector cells with high cytotoxicity against a variety of tumor targets [
52]. CIK could be driven toward Th1 phenotype away from Th2 phenotype, but no data for Treg and Th17 polarization [
49]. However, there was no data available for the effect of AVS073 components on CIK cells. We investigated the alteration to Th-polarizing cytokine profiles in DCs and Th polarization in CIK cells after AVS073 treatment.
Methods
Preparation of Ayurved Siriraj Watana Recipe powder
The Ayurved Siriraj Watana Recipe was manufactured as powder under GMP Guidelines by the Center of Applied Thai Traditional Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University. The sources of all herbal components came from the wild stretching from the Central and the Northeastern parts of Thailand. They were authenticated by experts, including certified pharmacognosists of the Center of applied Thai traditional medicine. Herbal raw materials were washed and dried in a hot air oven in accordance with the Ayurved Siriraj Watana Recipe Master Formula. It was validated with chemical fingerprint using ultra-performance liquid chromatography as previously described [
1]. The crude powder was preserved at 25 °C in a desiccator. To prepare the extract, the crude powder was dissolved in 80% ethanol at a final concentration 100 mg/mL. The extract was filtered with cotton wool and subsequently centrifuged at 10,000 × g for 10 min. The supernatant was evaporated and lyophilized to dry powder.
Generation of CIK cells and DCs from peripheral blood mononuclear cells
CIK cells and DCs were generated from peripheral blood mononuclear cells (PBMCs) of healthy donors and characterized as described previously [
49‐
51]. All healthy donor volunteers understood and signed the informed consent document before the participation. The protocol was approved by the Institutional Review Board of the Faculty of Medicine Siriraj Hospital, Mahidol University. PBMCs were isolated from whole blood by Ficoll gradient centrifugation (IsoPrep®, Robbins Scientific, CA). The cell suspension was allowed to adhere over the container at a density of 5 × 10
6 cells/mL for 1 h at 37 °C in RPMI 1640, 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. The non-adherent cells (PBLs) were processed into CIK cells. The adherent cells were processed into mature DCs (mDCs) (Additional file
1).
To generate CIK cells, PBLs were maintained in RPMI 1640 (Invitrogen, Carlsbad, CA), 10% FBS (Biochrom, Berlin, Germany), 100 U/mL penicillin and 100 μg/mL streptomycin. IFN-γ (1000 U/mL, Amoytop Biotech, Xiamen, China) was added and incubated at 37 °C, 5% CO2 for 24 h. After 24-h incubation, 50 ng/mL monoclonal antibody against CD3 (eBioscience, CA), and 300 IU/mL IL-2 (Amoytop Biotech, Xiamen, China) were added. Recombinant IL-2 and fresh growth medium were added every 3 d. After 14 d, AVS073 were added to the culture for 7 d or left with medium alone.
The adherent PBMCs was maintained in growth medium without cytokine to be remain as monocytes. To generate immature DCs (iDCs), the adherent cells were cultured in RPMI 1640, 10% FBS, 400 U/mL GM-CSF and 500 U/mL IL-4 for 14 d. The differentiation into mDCs could be achieved by adding 1000 U/mL TNF-α (Amoytop Biotech, Xiamen, China) for 48 h. The mDCs were incubated with AVS073 for 7 d either before or after maturation induction with TNF-α to generate pre-treated mDCs or treated mDCs respectively.
Preparation of CD3+CD56+ subsetof
An aliquot of 108 cells of day 14 CIK cells were harvested. CD3+CD56+cells were isolated from CIK cells using CD3 microbead followed by CD56 Multisort Kit (Miltenyi Biotec, Germany) according to the manufacturer’s instruction. The CD3+CD56+ cell pellet was washed by adequate volume of the buffer, counted, and determined for viability by trypan blue exclusion. CD3+CD56+ cells were resuspended in appropriated volume of growth medium (RPMI-1640, 10% FBS, and 300 IU/mL IL-2) to achieve a density of less than 1 × 106 cells/mL.
Determination of cell proliferation
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl) tetrazolium bromide was dissolved in the culture medium (200 μg/mL). The solution was added to each well. The plates were incubated at 37 °C in 5% CO
2 for 1 h. After which time, the medium was discarded and 100 μL of dimethyl sulfoxide was added. The plates were left at room temperature for 10 min with occasionally gently shaking. The absorbance in each well was measured at 595 nm and calculated as the percentage of the control as follows:
$$ \%\mathrm{proliferation}=\frac{\mathrm{OD}\left(\mathrm{sample}\right) - \mathrm{O}\mathrm{D}\left(\mathrm{background}\right)}{\mathrm{OD}\left(\mathrm{control}\right) - \mathrm{O}\mathrm{D}\left(\mathrm{background}\right)}\times 100 $$
OD (sample) represents the OD of the well containing the treated cells. OD (control) represents the OD of the well containing untreated cells. OD (background) represents the OD of the blank well.
Fluorescence-activated cell sorting (FACS) analysis
PBLs were analyzed with fluorochrome-conjugated antibodies against CD3, CD8-, CD11a-, CD16-, CD28, CD56, CD69, CD152, CD154, CD278 (ICOS), CD279 (PD-1) (eBioscience, CA) and antibodies against regulatory T (Treg) cells (Biolegend). CIK phenotypes were analyzed with fluorochrome-conjugated antibodies against CD3, CD8, CD28, and CD56. DC phenotypes were analyzed with the following monoclonal markers: CD1a, CD11c, CD14, CD40, CD80, CD83, CD86 and HLA-DR (eBioscience). Cells were incubated with the corresponding fluorochrome-conjugated primary monoclonal antibodies at 4 °C for 30 min in the dark in 5 mL polystyrene round-bottom tube. The cells were washed by adding 2 mL of FACS buffer and pelleted by centrifugation at 400 × g at 4 °C for 5 min. The cells were resuspended in 200 μL FACS buffer. Regulatory T (Treg) cells were detected in PBLs and CIK cells by Human Treg Flow™ kit included Foxp3 Alexa Fluor® 488 and CD4 PE-Cy5/CD25 PE cocktail, according to the manufacturer’s protocol. Flow cytometry analysis on 30,000 cells was performed using a FACSCalibur (Becton Dickinson, CA). Data were analyzed using FlowJo version 10.0.7.
RNA preparation and quantitative real-time PCR analysis
After AVS073 treatment, DCs or CD3
+CD56
+ cells were separately extracted for total mRNA by RNAspin mini RNA isolation kit (GE Healthcare, UK) according to the manufacturer’s instruction. Total mRNA was converted to cDNA using Improm-II™ reverse transcription system (Promega, Madison, WI). The cDNA samples were tested for quality and quantity by NanoVue™ Spectrophotometer (GE Healthcare, UK). The specific primers for DCs and CD3
+CD56
+ cells (Table
1) were designed by Vector NTI version 10 and Primer Express 3.0 (Applied Biosystems, CA) and purchased from 1
st BASE (Singapore). The specific genes were amplified with Brilliant® II SYBR® Green QPCR master mix (Agilent Technologies, Waldbronn, Germany) in a StepOnePlus real-time PCR system (Applied Biosystems). Quantitative real-time PCR was performed using 300 ng of cDNA in a 7.5 μL of SYBR master mix containing 20 μM primers and constituted to 15 μL with water and amplified for 40 cycles of 95 °C for 15 s, 56–60 °C for 40 s, and 72 °C for 40 s. The obtained Ct’s were subtracted with the Ct of GAPDH of the same condition to obtain ΔCt. The ΔCt’s of the treated cells were subtracted with ΔCt’s of the untreated cells of the same period to obtain ΔΔCt’s. The fold-changes could be obtained from the expression of 2
-ΔΔCt.
Table 1
Primer pair and their information for quantitative real-time PCR
GAPDH | Forward: GAAATCCCATCACCATCTTCC | 124 | 60 |
Reverse: AAATGAGCCCCAGCCTTCTC |
IDO | Forward: AGTCCGTGAGTTTGTCCTTTCAA | 68 | 60 |
Reverse: TTTCACACAGGCGTCATAAGCT |
IFNγ | Forward: GTGTGGAGACCATCAAGGAAGAC | 80 | 60 |
Reverse: CAGCTTTTCGAAGTCATCTCGTTT |
IL-4 | Forward: AACAGCCTCACAGAGCAGAAGAC | 101 | 60 |
Reverse: GCCCTGCAGAAGGTTTCCTT |
IL-6 | Forward: GCTGCAGGCACAGAACCA | 68 | 60 |
Reverse: ACTCCTTAAAGCTGCGCAGAA |
IL-10 | Forward: CTGGGTTGCCAAGCCTTGT | 100 | 60 |
Reverse: AGTTCACATGCGCCTTGATG |
IL-12 | Forward: GCAAAACCCTGACCATCCAA | 100 | 60 |
Reverse: TGAAGCAGCAGGAGCGAAT |
IL-17 | Forward: ACCTGTGTCACCCCGATTGT | 90 | 58 |
Reverse: GGGTCGGCTCTCCATAGTCTAA |
GATA3 | Forward: ACTACGGAAACTCGGTCAGG | 100 | 60 |
Reverse: CAGGGTAGGGATCCATGAAG |
STAT1 | Forward: GTGGCGGAACCCAGGAAT | 97 | 60 |
Reverse: TGACAGAAGAAAACTGCCAACTCA |
STAT3 | Forward: ACCAAGCGAGGACTGAGCAT | 90 | 58 |
Reverse: TGTGATCTGACACCCTGAATAATTC |
STAT4 | Forward: TTCCTTCTGTTTTTATCCCCATCT | 128 | 60 |
Reverse: TGTTGTGGGACTCAGGTTTTCTC |
STAT5A | Forward: CACGCAGGACACAGAGAATGA | 80 | 58 |
Reverse: TCAGGCTCTCCTGGTACTGGAT |
STAT5B | Forward: GGTCACGCAGGACACAGAGAA | 110 | 58 |
Reverse: CCAGCGGGCCAAACTG |
STAT6 | Forward: CTTTTGGCAGTGGTTTGATGGT | 96 | 60 |
Reverse: TGTTTGCTGATGAAGCCAATG |
T-bet | Forward: AGGATTCCGGGAGAACTTTGA | 123 | 60 |
Reverse: TACTGGTTGGGTAGGAGAGGAGAGTA |
RORC | Forward: CCACAGAGACATCACCGAGCC | 114 | 60 |
Reverse: GTGGATCCCAGATGACTTGTCC |
Statistical analysis
The results are shown as mean ± standard error of the mean (SEM). Data were plotted and analyzed using GraphPad Prism Software version 5.03. Student’s t-test was used for flow cytometry and real-time PCR analysis. One-way ANOVA with Dunnett’s test was used to determine the significance of difference between the controls and treatments. Two-way ANOVA with Bonferoni test was used to analyze statistical significance of the difference between means of cytotoxic experiments. A p-value < 0.05 was considered significant.
Discussion
The phenotypic changes to PBLs
AVS073 did not alter the phenotypic characterization of PBLs: T-cell markers (CD3, CD4 and CD8), NK-cell markers (CD16 and CD56), activation markers (CD25, CD69), co-stimulatory molecules (CD28, CD40L, and ICOS), co-inhibitory molecule (CD152 or CTLA-4) or negative regulatory molecule (CD279 or PD-1). Moreover, AVS073 did not alter the proportion of Treg cells subset.
The alteration to the CIK cell subsets
The absolute number of CD3
+CD56
+ subset at 21-d CIK cell increased up to 10 folds over that in the initial PBLs. AVS073 had not altered the proportion of CD3
+CD56
+ nor other subsets in both PBLs and CIK cells. The CD3
+CD56
+ subset was isolated from the CIK cells to monitor the alteration in Th1/Th2/Th17/Treg phenotypes after AVS073 treatment. The AVS073-treated CD3
+CD56
+ subset expressed more STAT4, that indicated the polarization toward Th1 phenotype. The Th2 and Treg phenotypes in AVS073-treated CD3
+CD56
+ subset was suppressed as evidenced by the decrease in STAT6 and STAT5A expressions, respectively. The Th17 phenotype was enhanced after AVS073 treatment as evidenced by increasing STAT3, RORC and IL-17 expression. Therefore, AVS073 tended to promote the Th1 and Th17 phenotypes in the CD3
+CD56
+ subset at the expense of Th2 and Treg phenotypes. The promotion of Th1 and Th17 phenotypes by the AVS073-treated CD3
+CD56
+ subset would make this preparation a candidate for anti-cancer treatment. Th17 cells exhibited pivotal roles in anti-tumor activity depending on the cytokines, costimulatory molecules and cell-cell interactions in the tumor microenvironment. The presence of IFN-γ together with IL-17 would promote tumor regression [
53].
Phenotype and maturation of DCs
The phenotypic changes induced by AVS073 might be attributed by its components. The
Carthamus tinctorius L., one of AVS073′s components, was reported to promote the expression of maturation markers (CD80, MHC class I and II) in mouse bone-marrow-derived DCs and maintained the high profile of maturation markers (CD80, CD86, MHC class I and II) in tumor antigen pulsed-DCs [
31]. In contrast,
Piper nigrum Linn. extract, piperine, significantly inhibited the maturation (MHC class II, CD40 and CD86), cytokine production (TNF-α and IL-12), phosphorylation of ERK and JNK, but enhanced the endocytosis activity of LPS-induced bone-marrow-derived DCs [
32]. However, we did not observe significant alteration in the maturation markers of both conditions of treated mDCs.
Alteration to Th-polarizing profiles in DCs
The AVS073-treated mDCs carried more IL-12, the Th1-prone cytokine. AVS073 did not alter the IL-10 level, and therefore did not shift mDCs toward Treg-promoting activity. The cytokine levels of both IL-6 and IL-23 in AVS073-treated mDCs were increased, and therefore induced the Th17 polarization. IL-6 and TGF-β are necessary for the initial induction of Th17 differentiation whereas IL-23 is essential for the later stage of Th17 polarization [
54]. IL-6 activates, while together with IL-21 further sustains STAT3 signaling required for ROR-α expression, and restrain Foxp3 mediated repression of ROR-α. TGF-β induces ROR-α expression through SMAD phosphorylation and provokes IL-23 receptor expression in naïve T cells, rendering them receptive to IL-23. IL-23 cements Th17 lineage commitment such that Th17 cells induced with TGF-β1 and IL-6 are insufficiently committed to the lineage and therefore plays a vital role in promoting Th17-mediated tissue inflammation [
55].
The alteration to Th profiles would affect, in particular, immunocompromised patients. The Th1 and Th17 enhancing effects of AVS073 may boost protective adaptive immunity against infection and cancer while Th2-supppressing activity may also provide clinical benefit in allergic diseases including asthma. However, all mentioned have to be optimized with its effect on Treg suppression to prevent overt immune reaction. The pathogenesis of tumor immune evasion relies on immunosuppressive cells (e.g., Tregs) to establish an immunosuppressive tumor microenvironment. If this is the case, AVS073 can inhibit Tregs, and therefore attenuate tumor immune evasion and dampen cancer progression. Similarly, the pathogenesis of Th2-associated asthma is perpetuated by Th2 cytokine microenvironment that may be suppressed by AVS073 through downregulation of Th2 cells. However, we further need to study how to direct AVS073-treated CIK cells towards decisive immune boosting for reversing each disease condition as mentioned.
Acknowledgements
AW, PA, TL and KM are recipients of Chalermphrakiat Grant of the Faculty of Medicine Siriraj Hospital, Mahidol University.