Skip to main content
Erschienen in: BMC Musculoskeletal Disorders 1/2019

Open Access 01.12.2019 | Research article

Elevated leptin levels induce inflammation through IL-6 in skeletal muscle of aged female rats

verfasst von: Ryo Tazawa, Kentaro Uchida, Hisako Fujimaki, Masayuki Miyagi, Gen Inoue, Hiroyuki Sekiguchi, Kosuke Murata, Ken Takata, Ayumu Kawakubo, Masashi Takaso

Erschienen in: BMC Musculoskeletal Disorders | Ausgabe 1/2019

Abstract

Background

Chronic inflammation with aging contributes to sarcopenia. Previous studies have suggested that the accumulation of adipose tissue in skeletal muscle, referred to as intermuscular adipose tissue (IMAT), increases with age and is associated with inflammation. However, the mechanism governing ectopic inflammation in skeletal muscle due to aging is not fully understood. Leptin, an adipocytokine derived from adipose tissue, is an important mediator of inflammatory processes. We examined changes in leptin levels with age and whether leptin contributes to ectopic inflammation.

Methods

To evaluate ectopic inflammation in skeletal muscle, we measured alterations to the expression of inflammatory cytokine genes (Il1b, Il6, and Tnfa) and muscle break down-related gene (MuRF1 and Atrogin1) in the quadricep muscles of young (10 weeks) and aged (48 weeks) female rats using quantitative reverse-transcription polymerase chain reaction (Q-RT-PCR). Histological examination was performed to identify the extent of IMAT. Leptin mRNA and leptin protein expression were examined using Q-RT-PCR and enzyme-linked immunosorbent assay, respectively. The effect of leptin on the mRNA expression of Il1b, Il6, and Tnfa in quadricep muscle-derived cells was also examined by stimulating the cells with 0 (control), 1, or 10 μg/mL rat recombinant leptin using Q-RT-PCR.

Results

Aged rats had significantly higher Il6, MuRF1, and Atrogin1 but not Il1b and Tnfa, expression and greater levels of IMAT in their quadricep muscles than young rats. Aged rats also had significantly higher leptin expression and leptin protein concentration in their quadricep muscles than young rats. The addition of exogenous leptin to quadricep muscle-derived cells significantly increased the gene expression of Il1b and Il6 but not Tnfa.

Conclusions

Our results suggest that elevated leptin levels due to aging cause ectopic inflammation through IL-6 in the skeletal muscle of aged rats.
Hinweise

Electronic supplementary material

The online version of this article (https://​doi.​org/​10.​1186/​s12891-019-2581-5) contains supplementary material, which is available to authorized users.
Abkürzungen
ELISA
Enzyme-linked Immunosorbent assay
HE
Hematoxylin-eosin
IL-1β
Interleukin-1β
IL-6
Interleukin-6
IMAT
Intermuscular adipose tissue
Q-RT-PCR
Quantitative reverse-transcription polymerase chain reaction
SD
Sprague dawley
SE
Standard error

Background

Sarcopenia is the reduction in skeletal muscle mass and function with age, and is a major public health concern. The sarcopenia-related morbidity rate is 5–13% in 60- to 70-year-old individuals, and 11–50% in those above 80 years old [1]. Sarcopenia can lead to a rise in the incidence of falls and the risk of fractures in the elderly, and is therefore linked to physical disability, and increased mortality, morbidity, and health care costs [2, 3]. Although a number of factors are implicated in the pathophysiology of sarcopenia, its pathophysiology remains elusive.
Proinflammatory cytokines associated with skeletal muscle metabolism contribute to sarcopenia [49]. A previous study reported that older individuals with sarcopenia had higher levels of serum interleukin (IL)-6 than those without sarcopenia [7]. IL-1β concentrations increase in inflammatory conditions, and elevated levels of IL-1β inhibit myoblast differentiation [8, 9]. However, the mechanisms governing the abnormal levels of IL-1β and IL-6 expression in skeletal muscle due to aging is not fully understood.
The accumulation of adipose tissue in skeletal muscle, referred to as intermuscular adipose tissue (IMAT), increases with age. Adipose tissue produces several adipocytokines and regulates inflammatory conditions [10]. Leptin, one such adipocytokine derived from adipose tissue, is an important mediator of inflammatory processes [11]. Previous studies have shown that leptin has pro-inflammatory properties and upregulates Il-6 expression in human synovial fibroblasts [12] and rat microglia [13]. Leptin also stimulates Il1b expression in human chondrocytes [14] and rat microglia [15]. We hypothesized that IMAT-derived leptin may be differentially expressed in the muscle with age and may regulate the expression of inflammatory cytokines.
Here, we investigated the expression of leptin and inflammatory cytokines with age and the relationship between leptin and inflammatory cytokines in rat muscle.

Methods

Animals

This study used female Sprague-Dawley (SD) rats obtained from Charles River Laboratories Japan, Inc. (Yokohama, Japan). Rats were fed a commercial pelleted diet (CRF-1, Oriental Yeast Industry, Tokyo). All experimental protocols were in accordance with the guidelines of the Animal Ethics Committee of Kitasato University (Permission number: 2018–085).

Quantitative reverse-transcription polymerase chain reaction (Q-RT-PCR) analysis

Preliminary experiments using rats aged 10, 24, 48, and 96 weeks indicated that leptin mRNA expression in 48- and 96-week-old rats was significantly higher than that in 10-week-old rats (Additional file 1: Figure S1). However, a previous study reported that SD rats developed a tumor early or late in life, over the age range of 494 to 798 days (approximately 71 to 114 weeks) at the time of first tumor observation [16]. Therefore, to evaluate changes in cytokine expression due to aging, SD rats were divided into two age groups: the young group (10 weeks) and aged group (48 weeks) (n = 10 each). Animals were anaesthetized first with isoflurane following by an intramuscular injection of a mixture comprising medetomidine, midazolam, and butorphanol tartrate into the upper limb. Blood was removed to prevent contamination with blood components before sacrificing the rats by cervical dislocation. Bilateral quadricep muscles were removed without the fascia and washed with phosphate buffered saline solution (PBS). TRIzol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from the quadricep muscles, based on the manufacturer’s protocol. The RNA formed the template for first-strand cDNA synthesis, which was performed with SuperScript III RT (Invitrogen) in a reaction (final volume, 25 μL) comprising 2 μL cDNA, a specific primer set (0.2 μM final concentration), and 12.5 μL SYBR Premix Ex Taq (Takara, Shiga, Japan). Primers for Il1b, Il6, Tnfa, MuRF1, Atrogin1, and leptin were designed using Primer Blast and made by Hokkaido System Science Co., Ltd. (Sapporo, Japan). The primer sequences are listed in Table 1. The primer-amplified products were confirmed for specificity using melt curve analysis. Q-RT-PCR was conducted on a CFX-96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The Q-RT-PCR protocol was as follows: initial denaturation at 95 °C for 1 min, and 40 cycles of 95 °C for 5 s and 60 °C for 30 s. mRNA expression levels of inflammatory cytokine (Il1b, Il6, Tnfa), muscle breakdown-related marker (MuRF1, Atrogin1) and leptin in the quadricep muscles were determined by normalizing to that of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) using the delta-delta Ct method. Relative expression was calculated using the mean of all control samples (samples from quadriceps muscles from the young group or vehicle-treated quadriceps muscle-derived cells in vitro).
Table 1
Sequences of the primers used in this study
Gene
Direction
Primer Sequence (5′–3′)
Product Size (bp)
Il6
F
CCAGTTGCCTTCTTGGGACT
224
R
TCTGACAGTGCATCATCGCT
Il1b
F
CCTCGTCCTAAGTCACTCGC
156
R
GCAGAGTCTTTTTGACCCTCCT
Tnfa
F
CTCTTCTCATTCCCGCTCGT
104
R
GGGAGCCCATTTGGGAACTT
MuRF1
F
TGCAAGGAACACGAAGACGA
170
R
ACAAGGAGCAAGTAGGCACC
Atrogin1
F
GGTCTCACGATCACCGACCT
136
R
TCCACAGTAGCCGGTCTTCA
Gapdh
F
TGC CAC TCA GAA GAC TGT GG
129
R
TTCAGCTCTGGGATGACCTT

Histological evaluation

To investigate the accumulation of adipose tissue in skeletal muscle due to aging, SD rats were again separated into two age groups: the young group (10 weeks) and aged group (48 weeks). After anesthetization with isoflurane following by an intramuscular injection of a mixture comprising medetomidine, midazolam, and butorphanol tartrate, rats were sacrificed by cervical dislocation. Quadricep muscles were removed without the fascia and fixed in paraformaldehyde before embedding in paraffin. The tissue was cut into 3-μm-thick sections and stained with hematoxylin-eosin (HE).

Enzyme-linked immunosorbent assay (ELISA) for leptin

To investigate changes in leptin protein expression due to aging, ELISA was performed on tissue obtained from rats separated into the same two age groups as the above experiments: the young group (10 weeks) and aged group (48 weeks) (n = 10 each).
Quadricep muscles harvested from rats as described above were homogenized in radioimmune precipitation (RIPA) buffer (Wako Pure Chemical Co., Inc., Osaka, Japan) containing an added protease inhibitor cocktail (Roche, Madison WI, USA). Total protein concentration in the solution was ascertained by the bicinchoninic acid (BCA) assay (Thermo Fisher Scientific, Rockford IL, USA) and leptin protein concentration by a rat leptin ELISA kit (R&D Systems, Inc., Minneapolis MN, USA).

Effect of leptin on Il1b, Il6 and Tnfa expression in quadriceps muscle-derived cells

Our preliminary experiments showed that there was no difference between young and aged rats in response to leptin. Dose of leptin was determined based on previous studies [13, 17]. Ten-week-old SD rats were used for this experiment. Quadricep muscles were removed bilaterally as described above and digested with type I collagenase overnight at 37 °C to extract muscle cells. The cells were cultured in α-MEM supplemented with 10% fetal bovine serum in six-well plates for 1 week at 37 °C in a 5% CO2 incubator. After 1 week of incubation, cells were confluent on the wells. Subsequently, recombinant rat leptin (0, 1 and 10 μg/mL) (Biolegend, San Diego, CA, USA) was added, and the cells were stimulated for 24 h. Total RNA was extracted from treated (1 and 10 μg/mL leptin) and control (0 μg/mL leptin) cells, and Il1b, Il6 and Tnfa expression was ascertained using Q-RT-PCR.

Statistical analysis

Differences between the two age groups were compared using the Mann-Whitney U test. Differences among treated and control muscle-derived cells were compared using the one-way ANOVA and Tukey multiple comparison’s test. SPSS was used as the statistical software (Version 19.0; SPSS, Inc., Chicago, IL, USA), and p < 0.05 was used to indicate statistical significance.

Results

Expression of inflammatory cytokines and muscle breakdown-related gene expression in quadriceps muscles

To evaluate ectopic inflammation and muscle breakdown in skeletal muscle, we performed Q-RT-PCR to examine changes in the gene expression of inflammatory cytokines, Il1b, Il6 and Tnfa, in quadricep muscle. The aged group had significantly higher Il6 mRNA expression than the young group (p = 0.001; Fig. 1a). In contrast, there was no significant difference in Il1b and Tnfa mRNA expression (p = 0.096 and p = 0.327, respectively; Fig. 1b, c). MuRF1 and Atrogin1 mRNA expression were higher in the quadriceps muscles of aged rats than young rats (p = 0.002 and p < 0.001, respectively; Fig. 1d, e).

IMAT

To investigate changes in the accumulation of adipose tissue due to aging, we examined the extent of IMAT in histologically-stained sections. Quadricep muscles of aged rats (48 weeks) had greater levels of IMAT than that of young rats (10 weeks) (Fig. 2a–d).

Leptin expression and leptin protein concentration in quadricep muscles

To investigate whether increased IMAT due to aging results in leptin production, we examined leptin mRNA expression and leptin protein expression in the quadricep muscles of aged and young rats. Leptin mRNA expression and leptin protein concentration were significantly higher in the aged group than in the young group (p = 0.049 and p < 0.001, respectively; Fig. 3a, b).

Effect of leptin on Il1b, Il6 and Tnfa expression in quadricep muscle-derived cells

In vitro experiments were performed to elucidate the relationship between IL-6, IL-1β, TNF-α and leptin. Q-RT-PCR analysis showed that the additional of exogenous leptin at 1 and 10 μg/ml significantly elevated Il6 mRNA expression compared to control (p = 0.001 and p < 0.001, respectively; Fig. 4a). Il1b mRNA expression was also significantly elevated in the presence 10 μg/ml leptin (p = 0.025; Fig. 4b). There was no difference between the leptin-stimulated and control groups in Tnfa expression (p = 0.279; Fig. 4c).

Discussion

This study aimed to examine changes to the expression of leptin and inflammatory cytokines due to aging and to determine the relationship between these factors in the rat quadricep muscle. We showed that IMAT, leptin gene and protein expression, Il6, and MuRF1 and Atrogin1 mRNA expression were higher in the quadricep muscles of aged rats than young rats. In addition, stimulation of muscle-derived cells with exogenous leptin significantly and dose-dependently increased Il1b and Il6 gene expression. To our knowledge, this study is the first to examine leptin and inflammatory cytokine expression due to aging in ectopic muscle.
Previous studies have reported that higher IL-6 concentrations in plasma are associated with lower muscle mass and lower muscle strength in elderly people [6], and that aging is linked to elevated IMAT in the thigh muscle in humans [18, 19]. Additionally, IMAT within the fascia is correlated with Il6 expression in subcutaneous adipose tissue in elderly men [20]. However, these studies analyzed subcutaneous or serum levels of inflammatory cytokines. Here, we showed that IMAT, Il6, and muscle breakdown-related gene (MuRF1, Atrogin1) expression were increased in the quadricep muscles of aged rats compared to young rats. An experimental study showed that IL-6 administration caused muscles to break down in rats [21]. IL-6 stimulate Atrogin1 mRNA and Atrogin1 protein expression in mice gastrocnemius muscle [22]. Inhibition of Il-6 suppresses MuRF1 expression and ameliorates tail suspension-induced skeletal muscle atrophy [23]. Taken together, these findings suggest that changes in Il6 expression with age are associated with the formation of micro inflammation environments in ectopic muscle and a reduction in muscle mass.
Serum leptin is positively associated with IMAT in humans [20]. In our study, an increase in IMAT corresponded with elevated leptin expression and leptin protein concentrations in the quadriceps of aged rats. In addition, leptin stimulated Il6 and Il1b expression in quadricep-derived cells. Plasma leptin levels are increased in individuals with sarcopenia and visceral obesity compared to those with sarcopenia or visceral obesity alone [24]. The development of sarcopenia is correlated with raised serum levels of IL-6, an inflammatory factor [7]. Further, IL-1β impaired myoblast differentiation in the murine myoblast cell line C2C12 [25]. Taken together, our findings and those of previous reports suggest that IMAT-derived leptin induces ectopic inflammation through IL-6 and IL-1β and may contribute sarcopenic pathology.
Several studies showed that TNF-α level increases with aging [26, 27]. In our study, there was no difference between 10- and 48-week-old rats in Tnfa expression level. We excluded 96-week-old rats from evaluation to eliminate the possible effect of tumor. However, our preliminary experiment showed that Tnfa expression in 96-week-old rats was 2.0-hold higher than that in 10-week-old rats. Further investigation using older rats may reveal whether the elevation of Tnfa in skeletal muscle contributes to sarcopenic pathology.
Two limitations of this study warrant mention. First, we performed in vitro experiments using cells derived from young rats in standard culture conditions. Leptin resistance was introduced by negative regulators of leptin signaling such as inflammatory signals, including IKKβ/NFκB and ER stress [28, 29]. However, to mimic leptin resistance in vivo, a specific condition was needed in vitro [30]. Further investigation under specific conditions using aged rat-derived cells is needed to reveal leptin resistance in aged rats. Second, we investigated only two time points. A better understanding of the development of sarcopenia requires analysis of multiple time points.

Conclusions

In conclusion, IMAT and leptin and Il6 expression increase with age in rat quadriceps. Our results suggest that IMAT-derived leptin regulates Il6 expression and creates a micro inflammatory environment in ectopic muscle due to aging.

Acknowledgements

We thank Ms. Yuko Onuki for her help with Q-RT-PCR analysis.

Funding

This investigation was supported in part by research grants from the Parents’ Association of Kitasato University School of Medicine. The role of the funding included English editing.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article. The raw data can be requested from the corresponding author.
All experimental protocols were approved by the Kitasato University School of Medicine Animal Care Committee (Permission number: 2018–085).
Not applicable

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat von HS, Morley JE, Anker SD. An overview of sarcopenia: facts and numbers on prevalence and clinical impact. J Cachexia Sarcopenia Muscle. 2010;1(2):129–33.CrossRef von HS, Morley JE, Anker SD. An overview of sarcopenia: facts and numbers on prevalence and clinical impact. J Cachexia Sarcopenia Muscle. 2010;1(2):129–33.CrossRef
2.
Zurück zum Zitat Filippin LI, Teixeira VN, da Silva MP, Miraglia F, da Silva FS. Sarcopenia: a predictor of mortality and the need for early diagnosis and intervention. Aging Clin Exp Res. 2015;27(3):249–54.PubMedCrossRef Filippin LI, Teixeira VN, da Silva MP, Miraglia F, da Silva FS. Sarcopenia: a predictor of mortality and the need for early diagnosis and intervention. Aging Clin Exp Res. 2015;27(3):249–54.PubMedCrossRef
3.
Zurück zum Zitat Murphy RA, Ip EH, Zhang Q, Boudreau RM, Cawthon PM, Newman AB, Tylavsky FA, Visser M, Goodpaster BH, Harris TB. Transition to sarcopenia and determinants of transitions in older adults: a population-based study. J Gerontol A Biol Sci Med Sci. 2014;69(6):751–8.PubMedCrossRef Murphy RA, Ip EH, Zhang Q, Boudreau RM, Cawthon PM, Newman AB, Tylavsky FA, Visser M, Goodpaster BH, Harris TB. Transition to sarcopenia and determinants of transitions in older adults: a population-based study. J Gerontol A Biol Sci Med Sci. 2014;69(6):751–8.PubMedCrossRef
4.
Zurück zum Zitat Cesari M, Kritchevsky SB, Baumgartner RN, Atkinson HH, Penninx BW, Lenchik L, Palla SL, Ambrosius WT, Tracy RP, Pahor M. Sarcopenia, obesity, and inflammation--results from the trial of angiotensin converting enzyme inhibition and novel cardiovascular risk factors study. Am J Clin Nutr. 2005;82(2):428–34.PubMedCrossRef Cesari M, Kritchevsky SB, Baumgartner RN, Atkinson HH, Penninx BW, Lenchik L, Palla SL, Ambrosius WT, Tracy RP, Pahor M. Sarcopenia, obesity, and inflammation--results from the trial of angiotensin converting enzyme inhibition and novel cardiovascular risk factors study. Am J Clin Nutr. 2005;82(2):428–34.PubMedCrossRef
5.
Zurück zum Zitat Schrager MA, Metter EJ, Simonsick E, Ble A, Bandinelli S, Lauretani F, Ferrucci L. Sarcopenic obesity and inflammation in the InCHIANTI study. J Appl Physiol (1985). 2007;102(3):919–25.CrossRef Schrager MA, Metter EJ, Simonsick E, Ble A, Bandinelli S, Lauretani F, Ferrucci L. Sarcopenic obesity and inflammation in the InCHIANTI study. J Appl Physiol (1985). 2007;102(3):919–25.CrossRef
6.
Zurück zum Zitat Visser M, Pahor M, Taaffe DR, Goodpaster BH, Simonsick EM, Newman AB, Nevitt M, Harris TB. Relationship of interleukin-6 and tumor necrosis factor-alpha with muscle mass and muscle strength in elderly men and women: the health ABC study. J Gerontol A Biol Sci Med Sci. 2002;57(5):M326–32.PubMedCrossRef Visser M, Pahor M, Taaffe DR, Goodpaster BH, Simonsick EM, Newman AB, Nevitt M, Harris TB. Relationship of interleukin-6 and tumor necrosis factor-alpha with muscle mass and muscle strength in elderly men and women: the health ABC study. J Gerontol A Biol Sci Med Sci. 2002;57(5):M326–32.PubMedCrossRef
7.
Zurück zum Zitat Bian AL, Hu HY, Rong YD, Wang J, Wang JX, Zhou XZ. A study on relationship between elderly sarcopenia and inflammatory factors IL-6 and TNF-alpha. Eur J Med Res. 2017;22(1):25.PubMedPubMedCentralCrossRef Bian AL, Hu HY, Rong YD, Wang J, Wang JX, Zhou XZ. A study on relationship between elderly sarcopenia and inflammatory factors IL-6 and TNF-alpha. Eur J Med Res. 2017;22(1):25.PubMedPubMedCentralCrossRef
8.
Zurück zum Zitat Cohen TV, Many GM, Fleming BD, Gnocchi VF, Ghimbovschi S, Mosser DM, Hoffman EP, Partridge TA. Upregulated IL-1beta in dysferlin-deficient muscle attenuates regeneration by blunting the response to pro-inflammatory macrophages. Skelet Muscle. 2015;5:24.PubMedPubMedCentralCrossRef Cohen TV, Many GM, Fleming BD, Gnocchi VF, Ghimbovschi S, Mosser DM, Hoffman EP, Partridge TA. Upregulated IL-1beta in dysferlin-deficient muscle attenuates regeneration by blunting the response to pro-inflammatory macrophages. Skelet Muscle. 2015;5:24.PubMedPubMedCentralCrossRef
9.
Zurück zum Zitat de AP, Tomazoni SS, Frigo L, de Carvalho PT, Vanin AA, Santos LA, buquerque-Pontes GM, De MT, Tairova O, Marcos RL, Lopes-Martins RA, Leal-Junior EC. What is the best treatment to decrease pro-inflammatory cytokine release in acute skeletal muscle injury induced by trauma in rats: low-level laser therapy, diclofenac, or cryotherapy? Lasers Med Sci. 2014;29(2):653–8.CrossRef de AP, Tomazoni SS, Frigo L, de Carvalho PT, Vanin AA, Santos LA, buquerque-Pontes GM, De MT, Tairova O, Marcos RL, Lopes-Martins RA, Leal-Junior EC. What is the best treatment to decrease pro-inflammatory cytokine release in acute skeletal muscle injury induced by trauma in rats: low-level laser therapy, diclofenac, or cryotherapy? Lasers Med Sci. 2014;29(2):653–8.CrossRef
10.
Zurück zum Zitat Tilg H, Moschen AR. Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nat.Rev.Immunol. 2006;6(10):772–83.PubMedCrossRef Tilg H, Moschen AR. Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nat.Rev.Immunol. 2006;6(10):772–83.PubMedCrossRef
11.
Zurück zum Zitat La CA, Matarese G. The weight of leptin in immunity. Nat Rev Immunol. 2004;4(5):371–9.CrossRef La CA, Matarese G. The weight of leptin in immunity. Nat Rev Immunol. 2004;4(5):371–9.CrossRef
12.
Zurück zum Zitat Yang WH, Liu SC, Tsai CH, Fong YC, Wang SJ, Chang YS, Tang CH. Leptin induces IL-6 expression through OBRl receptor signaling pathway in human synovial fibroblasts. PLoS One. 2013;8(9):e75551.PubMedPubMedCentralCrossRef Yang WH, Liu SC, Tsai CH, Fong YC, Wang SJ, Chang YS, Tang CH. Leptin induces IL-6 expression through OBRl receptor signaling pathway in human synovial fibroblasts. PLoS One. 2013;8(9):e75551.PubMedPubMedCentralCrossRef
13.
Zurück zum Zitat Tang CH, Lu DY, Yang RS, Tsai HY, Kao MC, Fu WM, Chen YF. Leptin-induced IL-6 production is mediated by leptin receptor, insulin receptor substrate-1, phosphatidylinositol 3-kinase, Akt, NF-kappaB, and p300 pathway in microglia. J Immunol. 2007;179(2):1292–302.PubMedCrossRef Tang CH, Lu DY, Yang RS, Tsai HY, Kao MC, Fu WM, Chen YF. Leptin-induced IL-6 production is mediated by leptin receptor, insulin receptor substrate-1, phosphatidylinositol 3-kinase, Akt, NF-kappaB, and p300 pathway in microglia. J Immunol. 2007;179(2):1292–302.PubMedCrossRef
14.
Zurück zum Zitat Simopoulou T, Malizos KN, Iliopoulos D, Stefanou N, Papatheodorou L, Ioannou M, Tsezou A. Differential expression of leptin and leptin's receptor isoform (Ob-Rb) mRNA between advanced and minimally affected osteoarthritic cartilage; effect on cartilage metabolism. Osteoarthritis Cartilage. 2007;15(8):872–83.PubMedCrossRef Simopoulou T, Malizos KN, Iliopoulos D, Stefanou N, Papatheodorou L, Ioannou M, Tsezou A. Differential expression of leptin and leptin's receptor isoform (Ob-Rb) mRNA between advanced and minimally affected osteoarthritic cartilage; effect on cartilage metabolism. Osteoarthritis Cartilage. 2007;15(8):872–83.PubMedCrossRef
15.
Zurück zum Zitat Pinteaux E, Inoue W, Schmidt L, Molina-Holgado F, Rothwell NJ, Luheshi GN. Leptin induces interleukin-1beta release from rat microglial cells through a caspase 1 independent mechanism. J Neurochem. 2007;102(3):826–33.PubMedCrossRef Pinteaux E, Inoue W, Schmidt L, Molina-Holgado F, Rothwell NJ, Luheshi GN. Leptin induces interleukin-1beta release from rat microglial cells through a caspase 1 independent mechanism. J Neurochem. 2007;102(3):826–33.PubMedCrossRef
16.
Zurück zum Zitat RK D, GT S, KA B. Tumor incidence in normal Sprague-Dawley female rats. Cancer Res. 1956;16(3):194–7. RK D, GT S, KA B. Tumor incidence in normal Sprague-Dawley female rats. Cancer Res. 1956;16(3):194–7.
17.
Zurück zum Zitat Miao D, Zhang L. Leptin modulates the expression of catabolic genes in rat nucleus pulposus cells through the mitogen-activated protein kinase and Janus kinase 2/signal transducer and activator of transcription 3 pathways. Mol Med Rep. 2015;12(2):1761–8.PubMedPubMedCentralCrossRef Miao D, Zhang L. Leptin modulates the expression of catabolic genes in rat nucleus pulposus cells through the mitogen-activated protein kinase and Janus kinase 2/signal transducer and activator of transcription 3 pathways. Mol Med Rep. 2015;12(2):1761–8.PubMedPubMedCentralCrossRef
18.
Zurück zum Zitat Buford TW, Lott DJ, Marzetti E, Wohlgemuth SE, Vandenborne K, Pahor M, Leeuwenburgh C, Manini TM. Age-related differences in lower extremity tissue compartments and associations with physical function in older adults. Exp Gerontol. 2012;47(1):38–44.PubMedCrossRef Buford TW, Lott DJ, Marzetti E, Wohlgemuth SE, Vandenborne K, Pahor M, Leeuwenburgh C, Manini TM. Age-related differences in lower extremity tissue compartments and associations with physical function in older adults. Exp Gerontol. 2012;47(1):38–44.PubMedCrossRef
19.
Zurück zum Zitat Marcus RL, Addison O, Kidde JP, Dibble LE, Lastayo PC. Skeletal muscle fat infiltration: impact of age, inactivity, and exercise. J Nutr Health Aging. 2010;14(5):362–6.PubMedPubMedCentralCrossRef Marcus RL, Addison O, Kidde JP, Dibble LE, Lastayo PC. Skeletal muscle fat infiltration: impact of age, inactivity, and exercise. J Nutr Health Aging. 2010;14(5):362–6.PubMedPubMedCentralCrossRef
20.
Zurück zum Zitat Zoico E, Rossi A, Di FV, Sepe A, Olioso D, Pizzini F, Fantin F, Bosello O, Cominacini L, Harris TB, Zamboni M. Adipose tissue infiltration in skeletal muscle of healthy elderly men: relationships with body composition, insulin resistance, and inflammation at the systemic and tissue level. J Gerontol A Biol Sci Med Sci. 2010;65(3):295–9.PubMedCrossRef Zoico E, Rossi A, Di FV, Sepe A, Olioso D, Pizzini F, Fantin F, Bosello O, Cominacini L, Harris TB, Zamboni M. Adipose tissue infiltration in skeletal muscle of healthy elderly men: relationships with body composition, insulin resistance, and inflammation at the systemic and tissue level. J Gerontol A Biol Sci Med Sci. 2010;65(3):295–9.PubMedCrossRef
21.
Zurück zum Zitat Goodman MN. Interleukin-6 induces skeletal muscle protein breakdown in rats. Proc Soc Exp Biol Med. 1994;205(2):182–5.PubMedCrossRef Goodman MN. Interleukin-6 induces skeletal muscle protein breakdown in rats. Proc Soc Exp Biol Med. 1994;205(2):182–5.PubMedCrossRef
22.
Zurück zum Zitat Baltgalvis KA, Berger FG, Pena MM, Davis JM, White JP, Carson JA. Muscle wasting and interleukin-6-induced atrogin-I expression in the cachectic Apc ( min/+ ) mouse. Pflugers Arch. 2009;457(5):989–1001.PubMedCrossRef Baltgalvis KA, Berger FG, Pena MM, Davis JM, White JP, Carson JA. Muscle wasting and interleukin-6-induced atrogin-I expression in the cachectic Apc ( min/+ ) mouse. Pflugers Arch. 2009;457(5):989–1001.PubMedCrossRef
23.
Zurück zum Zitat Yakabe M, Ogawa S, Ota H, Iijima K, Eto M, Ouchi Y, Akishita M. Inhibition of interleukin-6 decreases atrogene expression and ameliorates tail suspension-induced skeletal muscle atrophy. PLoS One. 2018;13(1):e0191318.PubMedPubMedCentralCrossRef Yakabe M, Ogawa S, Ota H, Iijima K, Eto M, Ouchi Y, Akishita M. Inhibition of interleukin-6 decreases atrogene expression and ameliorates tail suspension-induced skeletal muscle atrophy. PLoS One. 2018;13(1):e0191318.PubMedPubMedCentralCrossRef
24.
Zurück zum Zitat Kohara K, Ochi M, Tabara Y, Nagai T, Igase M, Miki T. Leptin in sarcopenic visceral obesity: possible link between adipocytes and myocytes. PLoS One. 2011;6(9):e24633.PubMedPubMedCentralCrossRef Kohara K, Ochi M, Tabara Y, Nagai T, Igase M, Miki T. Leptin in sarcopenic visceral obesity: possible link between adipocytes and myocytes. PLoS One. 2011;6(9):e24633.PubMedPubMedCentralCrossRef
25.
Zurück zum Zitat Broussard SR, McCusker RH, Novakofski JE, Strle K, Shen WH, Johnson RW, Dantzer R, Kelley KW. IL-1beta impairs insulin-like growth factor i-induced differentiation and downstream activation signals of the insulin-like growth factor i receptor in myoblasts. J Immunol. 2004;172(12):7713–20.PubMedCrossRef Broussard SR, McCusker RH, Novakofski JE, Strle K, Shen WH, Johnson RW, Dantzer R, Kelley KW. IL-1beta impairs insulin-like growth factor i-induced differentiation and downstream activation signals of the insulin-like growth factor i receptor in myoblasts. J Immunol. 2004;172(12):7713–20.PubMedCrossRef
26.
Zurück zum Zitat Greiwe JS, Cheng B, Rubin DC, Yarasheski KE, Semenkovich CF. Resistance exercise decreases skeletal muscle tumor necrosis factor alpha in frail elderly humans. FASEB J. 2001;15(2):475–82.PubMedCrossRef Greiwe JS, Cheng B, Rubin DC, Yarasheski KE, Semenkovich CF. Resistance exercise decreases skeletal muscle tumor necrosis factor alpha in frail elderly humans. FASEB J. 2001;15(2):475–82.PubMedCrossRef
27.
Zurück zum Zitat Phillips T, Leeuwenburgh C. Muscle fiber specific apoptosis and TNF-alpha signaling in sarcopenia are attenuated by life-long calorie restriction. FASEB J. 2005;19(6):668–70.PubMedCrossRef Phillips T, Leeuwenburgh C. Muscle fiber specific apoptosis and TNF-alpha signaling in sarcopenia are attenuated by life-long calorie restriction. FASEB J. 2005;19(6):668–70.PubMedCrossRef
28.
Zurück zum Zitat Ozcan L, Ergin AS, Lu A, Chung J, Sarkar S, Nie D, Myers MG Jr, Ozcan U. Endoplasmic reticulum stress plays a central role in development of leptin resistance. Cell Metab. 2009;9(1):35–51.PubMedCrossRef Ozcan L, Ergin AS, Lu A, Chung J, Sarkar S, Nie D, Myers MG Jr, Ozcan U. Endoplasmic reticulum stress plays a central role in development of leptin resistance. Cell Metab. 2009;9(1):35–51.PubMedCrossRef
29.
Zurück zum Zitat Zhang X, Zhang G, Zhang H, Karin M, Bai H, Cai D. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell. 2008;135(1):61–73.PubMedPubMedCentralCrossRef Zhang X, Zhang G, Zhang H, Karin M, Bai H, Cai D. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell. 2008;135(1):61–73.PubMedPubMedCentralCrossRef
30.
Zurück zum Zitat Fukuda M, Williams KW, Gautron L, Elmquist JK. Induction of leptin resistance by activation of cAMP-Epac signaling. Cell Metab. 2011;13(3):331–9.PubMedPubMedCentralCrossRef Fukuda M, Williams KW, Gautron L, Elmquist JK. Induction of leptin resistance by activation of cAMP-Epac signaling. Cell Metab. 2011;13(3):331–9.PubMedPubMedCentralCrossRef
Metadaten
Titel
Elevated leptin levels induce inflammation through IL-6 in skeletal muscle of aged female rats
verfasst von
Ryo Tazawa
Kentaro Uchida
Hisako Fujimaki
Masayuki Miyagi
Gen Inoue
Hiroyuki Sekiguchi
Kosuke Murata
Ken Takata
Ayumu Kawakubo
Masashi Takaso
Publikationsdatum
01.12.2019
Verlag
BioMed Central
Erschienen in
BMC Musculoskeletal Disorders / Ausgabe 1/2019
Elektronische ISSN: 1471-2474
DOI
https://doi.org/10.1186/s12891-019-2581-5

Weitere Artikel der Ausgabe 1/2019

BMC Musculoskeletal Disorders 1/2019 Zur Ausgabe

Arthropedia

Grundlagenwissen der Arthroskopie und Gelenkchirurgie. Erweitert durch Fallbeispiele, Videos und Abbildungen. 
» Jetzt entdecken

Proximale Humerusfraktur: Auch 100-Jährige operieren?

01.05.2024 DCK 2024 Kongressbericht

Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.

Sind Frauen die fähigeren Ärzte?

30.04.2024 Gendermedizin Nachrichten

Patienten, die von Ärztinnen behandelt werden, dürfen offenbar auf bessere Therapieergebnisse hoffen als Patienten von Ärzten. Besonders gilt das offenbar für weibliche Kranke, wie eine Studie zeigt.

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Arthroskopie kann Knieprothese nicht hinauszögern

25.04.2024 Gonarthrose Nachrichten

Ein arthroskopischer Eingriff bei Kniearthrose macht im Hinblick darauf, ob und wann ein Gelenkersatz fällig wird, offenbar keinen Unterschied.

Update Orthopädie und Unfallchirurgie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.