Background
The incidence of renal cell carcinoma (RCC) varies substantially worldwide. The rates are generally high in Europe and North America while low in Asia and South America [
1]. RCC is a pathologically heterogeneous disease and can be subdivided into clear, papillary, granular, spindle, and mixed cell subtypes based on cytoplasmic features. Clear cell RCC (ccRCC) is the most common type (70%-80%) and accounts for most cases of metastatic disease. Metastatic RCC is a highly fatal disease, which accounts for about a third of the patients at initial presentation. Approximately 10% to 28% of RCC develop a local recurrence or distant metastasis after curative nephrectomy [
2]. Metastatic RCC is resistant to chemotherapy and radiotherapy but responds to tyrosine kinase inhibitors and interleukin-2-based immunotherapy [
3,
4].
Asian and non-Asian populations exhibit big differences in the incidence of RCC, environmental and genetic risk factors, and even adverse effects of the treatment with sorafenib and sunitinib [
1,
5,
6]. Genetic background should be important in exploring the mechanism of renal carcinogenesis and developing therapeutic option. RCC cell lines with diverse metastatic potential are essential in understanding RCC biology and the mechanism of metastasis and also beneficial for identification of therapeutic approaches to improve the prognosis. Several RCC cell lines have been isolated and characterized [
7,
8]. However, ccRCC cell lines with characterized metastatic potential are very rare and none of them were from Chinese.
In this study, we characterized the two ccRCC cell lines with different metastatic potential. One was derived from primary ccRCC and the other was from a metastatic ccRCC. The comparable cell lines can be used for exploration of metastasis mechanism, selection of therapeutic compounds, and development of ccRCC vaccines. To our knowledge, this is the first report of the establishment of ccRCC cell lines from Chinese patients.
Discussion
In this study, we successfully established two ccRCC cell lines from two Chinese patients with ccRCC. Up to now, the two cell lines have been maintained in our laboratory for 6 years and cultured for more than 100 passages. The two patients were comparable on the aspects of race, sex, and age at onset of primary ccRCC. Although the microenvironment plays an important role in evolutionary process of the metastatic cells from their primary tumors, the selected metastatic cancer cells maintain their characteristics following long-term
in vitro cultures.
In vivo study demonstrated that MRCC cells exhibited more malignant and metastatic potential than NRCC (Table
2). Therefore, the differences in cellular and subcellular morphology, cell growth/invasion ability, cytogenetics, cell markers, and expression pattern of metastasis-associated molecules between the two cell lines can designate, at least partially, some important cellular and molecular events related to ccRCC metastasis.
The current study characterized the cell lines of 50–60 generations. It was found that MRCC grew a little slower but exhibited stronger anchorage-independent growth potential than NRCC
in vitro. The invasion study indicated MRCC had higher invasion potential than NRCC. Analysis of cell cycle at the same pace of proliferation suggested that MRCC were more frequent in S phase whereas NRCC displayed a typical sub-G1 peak. Thus, compared to NRCC, MRCC exhibited “low proliferation-high invasion-low apoptosis” cell kinetic profile. This is probably related to a large number of glycogen particles stored in the cytoplasm. The “glassy” cytoplasm appearance of ccRCC might be due to glycogen and sterol storage caused by abnormalities in carbohydrate and lipid metabolism [
9,
11]. GSK3 is a protein kinase that phosphorylates and inactivates glycogen synthase, the final enzyme of glycogen biosynthesis [
12]. In this study, we found that GSK3β, an important member of GSK3 family, was higher expressed in NRCC than in MRCC (Figure
6). The level of GSK3β may be reversely related to glycogen storage in RCC cells. Glycogen-rich carcinomas of clear cell subtype are usually characterized by a peculiar “low proliferation-low apoptosis” cell kinetic profile and associated with cancer aggressiveness [
11,
13]. Thus, the level of GSK3β might be reversely related to ccRCC metastasis.
Loss of chromosomal materials on 3p, 8p, 9p, and 14q has been documented in 96%, 22%, 33%, and 41% of ccRCC cases, respectively [
14]. The von Hippel Lindau (
VHL) tumor suppressor gene on chromosome 3p and stabilization of HIF1α due to loss of VHL function has been shown to be central to development of ccRCC [
15]. However, the cytogenetic abnormalities on chromosomes 3p and the difference in HIF1α levels were not found in this study. With the use of single-cell exome sequencing,
AHNAK, LRRK2, SRGAP3, and USP6 have been found to be the key mutated genes in the ccRCC patient without
VHL mutations [
16]. In this study, although we found some differences in their expression patterns (Figure
6), it is hard to interpret the role of the 4 genes in ccRCC in terms of the expression patterns. We found that gains of chromosomes and some abnormal structures were the major chromosomal abnormalities in the two cell strains. Thus, our findings add novel information to the cytogenetic abnormality of ccRCC with different metastatic potentials and make the cell lines good tools to study RCC without
VHL mutations.
Our cytometry assay revealed that the two cell lines were positive for CD44 but negative for CD133, CD105, and CD74. CD44 is a hyaluronic acid receptor whose mRNA levels in tumors can distinguish between RCC subtypes and RCC subtypes from oncocytoma and predict RCC metastasis [
17]. Unexpectedly, the two cell lines were negative for CD105, a possible marker of ccRCC-initiation cells [
10]. Recent studies have confirmed that CD133 is not detectable in RCC cells and tissues [
10,
18]. Here we found CD24 positivity was more frequent in MRCC than in NRCC and the same was true for CD56 (Figure
4). CD24 is a cancer stem-like cell biomarker whose expression in tumors is associated with malignant phenotype and poor prognosis of ccRCC and other cancers [
19,
20]. CD56 has been found to be expressed in 15%-18% of ccRCC and associated with poor outcome [
21]. Although no markers, single or combined, could be defined unequivocally to specifically identify cancer stem cells in a given solid tumor so far [
22], our data indicate that CD24-positive subpopulation might be the most likely stem-like cells that are related to ccRCC metastasis. NRCC and MRCC are epithelial-origin, but MRCC tends to be more mesenchymal-like (Figure
4). Acquisition of mesenchymal properties by epithelial cells, a process called epithelial-mesenchymal transition (EMT), can partially explain the metastatic potential of MRCC.
Although TNFα, VEGF, IL-6 and other cytokine/chemokine from lymphocytes, endothelial cells and mesenchymal cells within the microenvironment are necessary to maintain cancer “stemness” [
23], the expression of these factors in cancer cells is important in maintaining their invasive and metastatic potential. In this study, we found that the transcriptional levels of
IL-6,
VEGF,
HIF2α,
TNFα,
MMP2, and
RhoC were higher in MRCC than in NRCC. Expression of
VEGF,
MMP2, and
RhoC in ccRCC is associated with metastasis and poor prognosis or used to evaluate the effectiveness of therapies on metastatic RCC [
24‐
26]. The expression of
IL-6 and
TNFα is significantly elevated in high malignant RCC cells compared to low malignant RCC cells [
27]. Furthermore, plasma levels of TNFα and IL-6 are associated with poor survival of RCC patients [
28]. Interestingly, the expression of HIF2α, rather than HIF1α, was significantly elevated in MRCC than in NRCC (Figure
6). The HIFα subunits increase target gene transcription in hypoxic cells. However, HIF1α uniquely activates glycolytic enzyme genes, while HIF2α preferentially activates VEGF and cyclin D1. HIF2α promotes while HIF1α inhibits
c-Myc transcriptional activity and cell cycle progression in RCC [
29]. HIF1α negatively regulates Wnt/β-catenin signaling, while HIF2α is required for β-catenin activation in RCC cells and for RCC proliferation [
30]. HIF1α/HIF2α imbalance in cancer cells might be important for RCC growth and metastasis.
The expression patterns of
IL-6 and
TNFα indicate that NF-κB signaling pathway is more active in MRCC than in NRCC. This result was later confirmed by the western blot findings that IκBα was more degraded in MRCC than in NRCC following the treatment with TNFα (Figure
7). Thus, NF-κB is not only critical in regulating RCC biology that pose challenge to conventional therapy [
31], but also important in promoting ccRCC metastasis.
Methods
Clinical specimens and primary culture
A 62-year-old male patient (No.375771) underwent surgical resection for a growing lesion in the spine at the 2nd affiliated hospital on February 6, 2006. This patient had received nephrectomy to excise ccRCC 10 years ago. He was pathologically diagnosed as ccRCC metastasized to bone and tumor nuclear grade was Fuhrman III. A 49-year-old male patient (No.378570) underwent nephrectomy at the same hospital on April 3, 2006. This patient was histopathologically diagnosed as ccRCC. The tumor nuclear grade was Fuhrman II. The fresh surgical specimens were immediately transported to our laboratory in ice-cold PBS, and processed for cell culture within 60 min after surgery. Primary cell culture was performed as previously described [
32]. The experimental protocol was approved by the Institutional Ethical Review Board of Second Minitary Medical University conformed to the ethical guidlines of the 1975 Declaration of Helsinki. An informed consent was obtained from each patient. The two patients were followed since receiving the surgery in our hospital. The patient with metastatic ccRCC died of ccRCC six months after the last surgery. The patient with primary ccRCC was radiographically diagnosed as having a tumor in pancreas in 2008 and died in 2009. However, we were not sure if the tumor was pancreas-originated cancer or metastasis from original ccRCC because this patient didn’t receive further surgery or biopsy.
Morphology and electron microscopy (EM)
Morphology of the cells and their parental tissues was observed using inverted phase-contrast microscope (Leica DMI 3000B, Germany) following routine H&E staining as previously described [
32]. Cells (5 × 10
6) were processed as previously described [
9] and examined using an electron microscope (Hitachi H-7650, Tokyo, Japan).
Cell growth and invasion assay
A total number of 3 × 104 cells for each cell line suspended in 12 ml DMEM (GIBCO, Grand Island, NY) with 10% FCS (GIBCO) were plated in 24-well plates. Cells in every three wells were counted once a day. The average numbers were used to generate the growth curve. Anchorage independent growth potential was evaluated by double-layered soft agarose culture system. After cultured for 15d, the cells were stained with crystal violet and colony formation was counted under a light microscope (Leica). Cell invasion assay was performed using 24-well tissue culture plates (8-μm pore size, Transwell, Corning, NY). The bottom of the culture inserts was coated with 20 μg of Matrigel (BD Biosciences, Bedford, MA). The cells (5 × 104) in 0.1 ml medium with 1% FCS were placed in the upper chamber and the lower chamber was loaded with 0.2 ml medium containing 10% FCS. After cultured for 24 h in 37°C, 5% CO2, the cells that migrated to the lower surface of filters was quantified by counting 10 independent symmetrical visual fields under the microscope to determine the invasion rate. Each assay was performed in triplicate.
Karyotype analysis
Chromosomal preparation and R-banding were performed as previously described [
33]. A total of 100 metaphase spreads were observed under a microscope (Leica, DM6000B) and 30 complete karyotypes were prepared to determine the chromosome number of each cell line using CW4000 software (Leica).
Flow cytometry
Cell markers were determined using the following monoclonal antibodies: anti-CD44-Phycoerythrin (PE), anti-CD74-PE, anti-CD105-FITC, anti-CD56-FITC, anti-CD24-FITC, and anti-CD99-FITC (Biolegend, UK); anti-CD133-PE (Miltenyi, Germany); anti-vimentin (Santa Cruz, CA); anti-N-Cadherin (BD Biosciences); anti-E-cadherin, anti-EpCAM (Cell Signaling, MA). Briefly, both cell lines were cultured at the same condition. Then 5 × 105 cells were washed twice and resuspended in PBS with 1% FCS, and incubated either in the primary antibody (anti-CD133, CD44, CD74, CD105, CD56, CD24, and CD99) conjugated with FITC or PE for 30 min on ice, or incubated in primary antibodies to vimentin, E-cadherin, N-cadherin, or EpCAM and then washed and incubated with secondary antibody conjugated with FITC. Cells were then washed twice with PBS containing 1% FCS. Cell fluorescence was analyzed within 1 h using a flow cytometer (FACSCalibur, BD Biosciences). Cell debris and fixation artifacts were excluded by appropriate gating. The acquisition process was stopped when 10,000 events were collected in the population gate. CellQuest software (BD Biosciences) was used for data acquisition and analysis.
The cells for cell cycle analysis were grown at the same pace and fixed with 70% ethanol at 4°C for more than 2 h and then washed twice. Fixed cells were stained with 100 mg/ml propidium iodide containing 100 mg/ml RNase. Samples on ice were immediately analyzed on the flow cytometer with CellQuest software to separate G0/G1, S, and G2/M phases.
Quantitative RT-PCR
The cells were cultured under the same condition in 6-well plates. Total RNA was isolated and reverse transcribed to cDNA, and subjected for quantitative PCR as previously described [
34]. The assay for each gene was repeated for 4–5 times. The primers for the amplification of
IL-6,
TNFα,
VEGF,
MMP2,
HIF1α,
HIF2α,
GSK3β,
RhoC, USP6, AHNAK, LRRK2, and
SRGAP3 as well as their corresponding amplified conditions are summarized in Table
3,
GAPDH, and
β
2
-microglobulin were used as internal control.
Table 3
Primers and PCR amplification condition
IL-6
| GCTTTAAGGAGTTCCTGC | GGTAAGCCTACACTTTCCA | 95°C for 10 min. 45 cycles of 95°C for 10 s, 60°C for 10s, and 72°C for 25 s |
TNFα
| GTAGCCCATGTTGTAGCA | CTCGGCAAAGTCGAGATA |
VEGF
| ACTGCTGTGGACTTGAG | CAGGTGAGAGTAAGCGA |
MMP2
| GCAAGTTTCCATTCCGC | GTCGTCATCGTAGTTGGC |
GAPDH
| GACCCCTTCATTGACCTCAAC | CTTCTCCATGGTGGTGAAGA |
HIF1α
| GTTTACTAAAGGACAAGTCACC | TTCTGTTTGTTGAAGGGAG | 95°C for 15 min, 40 cycles of 95°C for 10s, 60°C for 45 s |
HIF2α
| GTCACCAGAACTTGTGC | CAAAGATGCTGTTCATGG |
GSK3β
| CTAAGGATTCGTCAGGAACAG | TTGAGTGGTGAAGTTGAAGAG | 94°C for 3 min, 40 cycles of 94°C for 15 s, 60°C for 30s, 72°C for 30s |
RhoC
| TCCTCATCGTCTTCAGCAAG | GAGGATGACATCAGTGTCCG | 30 cycles of 94°C for 30s, 58°C for 1 min,72°C for 1 min |
β
2
-microglobulin
| ACCCCCACTGAAAAAGATGA | ATCTTCAAACCTCCATGATG |
USP6
| TCAGAAGAGTGTTGCCCCAT | GGCTTTTCATGGACTCGGTT | 95°C for 3 min, 30 cycles of 94°C for 30s, 58°C for 1 min, 72°C for 1 min |
SRGAP
| GGATTCCCGAAGTGACAAGC | GACTGCAGCTGGTGATAACG |
LRRK2
| TGGGTTGGTCACTTCTGTGC | CATTGGCTGGAAATGAGTGC |
AHNAK
| GTGCCACCATCTACTTTGACA | GCTGGCTTCCTTCTGTTTGT | |
Western blot
The cells were
in vitro treated with 10 ng/mL TNFα (R & D Systems, MN) at different time points and then harvested. Cytosolic protein extracts were prepared as previously described [
35]. Cytosolic IκBα was determined by immunoblotting with an anti-IκBα antibody (Cell Signaling). β-actin was detected by immunoblotting with antibody against β-actin (Cell Signaling). Genetools software (version 4.02, Synoptics, Cambridge, England) was used to quantify the signal strength of the bands.
Subcutaneous and orthotopic transplantation
Six-week-old male BALB/c nude mice were purchased from Shanghai Experimental Animal Centre, Chinese Academy of Science (Shanghai, China) and treated in accordance with the American Association for the Accreditation of Laboratory Animal Care guidelines. The cells were washed and re-suspended in 200 μl PBS, and subcutaneously injected into the flanks of the mice (2 × 10
6/mouse). The mice were sacrificed when tumors grown up to 10 mm in diameter. The tumors were excised and mechanically minced with scissors in a sterile manner. Half of the minced tissues were subjected for primary culture, another half of the minced tumors of 1-2 mm in diameter were transplanted into renal subcapsules of anaesthetized mice to establish SOI model as previously described [
36]. The mice were sacrificed before dying. The tumor tissues were transplanted for the next round of SOI. All visceral organs were fixed in 10% formalin. Metastasis was confirmed using gross and histological examination.
Statistical analysis
Student’s t test was used to determine the differences in the colony-formation rates, invasion rates, and gene expression levels of the two cell lines. All statistical tests were two-sided and performed using the Statistical Program for Social Sciences (SPSS16.0 for Windows, Chicago, IL). A p value of <0.05 was considered as statistically significant.
Competing interests
The authors of this paper have no potential conflict of interest to disclose.
Authors’ contributions
XT analyzed whole data and drafted the manuscript. YH carried out chromosome analysis. SH was responsible for setting up animal model. ST was responsible for cell culture. YY was responsible for pathological analysis. JH, JR and DX were involved in the diagnosis and the recruitment of the patients in our affiliated hospitals. GW was responsible for statistical analysis. YD and JY revised it critically for important intellectual content; GC designed and organized the study and revised the manuscript. All authors have read and approved the final manuscript.