Background
Transitional cell carcinoma (TCC) of the bladder is the second most common malignancy of the genitourinary tract and the third most common cause of death among people with genitourinary tumors [
1]. TCC responds well to local resection and subsequent adjuvant intravesical treatment [
2]. Nevertheless, the recurrence rate of TCC is 50–70%. While 10% of pTa and 30% of pT1 tumors progress to muscle-invasive disease, a majority (80%) of the cases present with non-muscle-invasive papillary tumors (stages pTa or pT1), which have a much more satisfactory prognosis [
3].
The heterogeneous characteristics, diverse genetic architecture coupled with different clinical manifestations put unresolvable obstacles in the way of successful diagnosis of bladder cancer [
4]. From the first description of bladder cancer, the silent clinical manifestation of the disease, especially in low-grade stages, was one of the main challenges that physicians confronted [
5]. Of note, the longer the diagnosis is delayed, the greater the risk of metastasis, which in turn would alter non-lethal cancer to a life-threatening malignancy [
6,
7]. This unique feature highlights the importance of applying accurate as well as effective strategies to diagnose bladder cancer, not only rapidly but also with acceptable sensitivity. As the list of the proposed techniques for the detection of this malignancy is continually growing, interest in applying more accurate and affordable methods has increased overwhelmingly. Apart from cystoscopy and urine cytology, which are the gold standard techniques for the diagnosis of this cancer [
8], recent molecular investigations have declared the rewarding impact of mRNA expression analysis not only in the detection but also in the follow-up of patients with bladder cancer [
9‐
11]. Attention in recruiting this method has emerged from recent disclosures indicating the remarkable results in both its sensitivity and specificity, which matters especially in low-grade patients [
12]. Besides its accuracy, an appealing advantage to this technique is the possibility of examination of the urine specimen, which categorizes it as a non-invasive approach [
12]. By opening a valuable avenue for bladder cancer detection, identifying a group of genes that can be exploited for better diagnosis is still a debatable issue. Wide varieties of genes with different functions have been suggested to evaluate urine samples of bladder cancer patients [
13‐
15]. However, some of these genes lost their importance in clinical investigations due to their lack of sensitivity or correlation with the stage of the disease.
There is a pressing need for a non-invasive method to diagnose carcinoma of the urinary bladder. Invasive cystoscopy examination remains the gold standard; nonetheless, it is required not only for the diagnosis but also for the repeated 3-month follow-up intervals. This is due to the fact that no currently available method is adequately sensitive and specific [
16]. A method that could replace cystoscopies or at least reduce their number in given situations as well as adhering to greater accuracy than cytology would be highly commended by both patients and clinicians. Therefore, identification of urinary biomarkers for the detection of bladder cancer recurrence would be beneficial to minimize the frequency of cystoscopy.
In the present study, we aim to establish a noninvasive sensitive molecular approach for the detection of bladder cancer. We sought to evaluate the diagnostic potential of measuring three molecular markers (hTERT, SVV, and Keratin7 mRNAs) in the voided urine samples from patients with primary bladder carcinomas.
Methods
Patients and samples collection
Eighty patients diagnosed with bladder cancer, who were admitted to the Urology Department, of Shariati Hospital, were included in this study after giving informed consent. The diagnoses were made via cystoscopy and histopathology. The standard evaluations included urine analyses, blood chemistries, and radiological assessments. Any patients who had undergone any previous treatments were excluded from this study. A group of 30 patients suffering from hematuria due to non-neoplastic causes was used as a control (urinary tract infections, stones, benign prostate hyperplasia, and combined disorders). A group of 10 healthy volunteers was also included in this study. All subjects except 10 healthy volunteers, underwent cystoscopy as a reference standard for the detection of bladder cancer, and all tumors or suspicious lesions were resected for histopathological examination. The final diagnosis of bladder cancer was based on a histological examination. Tumor staging and grading were determined according to the TNM and World Health Organization classification [
17]. Voided urine was obtained from the patients before they received any treatment and before they underwent surgery. Approximately 40 ml of morning voided urine samples were collected from the patients and the samples were tested for urine cytology in addition to the detection of mRNA for the biomarker genes via quantitative Real-time RT-PCR (qRT-PCR).
RNA isolation and cDNA synthesis
The urine samples were centrifuged and the pellet cells were washed twice with PBS. Next, RNA extraction was carried out using the FastPure RNA kit (Takara Bio, Inc., Otsu, Japan). About 1 µg of total RNA was subjected to reverse transcription using the PrimeScript RT reagent kit (Takara Bio) according to the manufacturer’s instructions.
Quantitative real‐time PCR
Quantitative real-time RT-PCR was performed on a light cycler instrument (Roche, Germany) using SYBR Premix Ex Taq technology (Takara Bio). PCR was conducted in a 20 µl reaction mixture including; 10 µl of SYBR Green master mix, 2 µl of cDNA samples, 0.5 µl of forward and reverse primers (10 pmol) in water plus 7 µl of nuclease-free water (Qiagen, Hilden, Germany). Thermal cycling conditions involved an initial activation step for the 30 s at 95 °C, followed by 45 cycles including a denaturation step for 5 s at 95 °C and a combined annealing/extension step for 20 s at 60 ºC. Melting curve analysis was applied to validate whether all the primers yielded a single PCR product.
The target gene expression levels were normalized to the hypoxanthine phosphoribosyl transferase1 (HPRT1) levels in the same reaction. Relative expression levels of the target genes within a sample was calculated using the 2
−ΔΔCq formula, ΔΔC
q = (C
q Target − C
q HPRT1) experimental sample − (C
q Target– C
q HPRT1) control samples, where Cq is the quantification cycle. The fold expression relative to the average calibrator ΔC
q value (20 samples from healthy individuals and 20 samples from patients with urological disorders other than bladder cancer) was normalized to a reference gene (
HPRT1). Samples were classified as positive for a particular gene if the 2
− ΔΔCq was above the cut-off point. The validity of qPCR products was confirmed by gel electrophoresis and sequencing of the representative qPCR reactions (data not shown). The sequences of the gene-specific primers are summarized in Table
1.
Table 1
Nucleotide sequences of primers used for real-time RT-PCR
hTERT | TGACACCTCACCTCACCCAC | CACTGTCTTCCGCAAGTTCAC |
SVV | CCAGATGACGACCCCATAGAG | TTGTTGGTTTCCTTTGCAATTTT |
KRT7 | TGTGGATGCTGCCTACATGAGC | CAATCTCCTGCTTGGTGTTGCG |
HPRT1 | TGGACAGGACTGAACGTCTTG | CCAGCAGGTCAGCAAAGAATTTA |
Statistical analysis
Nonparametric receiver operating characteristic analysis (ROC), an area under the curve (AUC), sensitivity, specificity, as well as likelihood ratios were calculated to determine the levels of hTERT, SVV, and KRT7 biomarkers that best differentiate the bladder cancer cases from the control subjects. The optimal cut-off values were calculated as the marker level that maximized the sensitivity and specificity. The likelihood ratio was calculated based on the following formula: LR+ = sensitivity/1 − specificity. To evaluate the performance of the biomarkers in the voided urine samples from bladder cancer patients, we computed the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and the accuracy for cytology, hTERT, KRT7, and SVV when tested independently or in combinations in the urine samples. The comparison of the clinicopathological factors was analyzed using the Student’s t test, chi-square tests, and ANOVA. All the performed statistical tests were two-sided and the P-values of < 0.05 were considered to be of statistical significance. The statistical analyses were performed using the Statistical Package for the Social Sciences (SPSS 21, Chicago, IL).
Discussion
For a long time, the combination of cystoscopy with urine cytology has constructed the gold standard method for the detection and surveillance of bladder cancer. However, the application of these methods in the clinical platform has been restricted due to some inextricable limitations [
8]. Concerning cystoscopy, the invasiveness and cost of the whole process are prime reasons for the decline in its preference for diagnosis. [
18]. On the other hand, urine cytology, which is an important noninvasive technique with high specificity, has a restricted application due to its interpreter-dependent low sensitivity for low-grade tumors [
19]. While this technique usually performs well with high-stage tumors (T2–T3), the sensitivity of urine cytology for the detection of early-stage tumors is relatively low with a range of 20–40%. This is probably because the Ta–T1 tumors shed fewer cancer cells into the urine [
20,
21]. Hence, these challenges highlight the importance of the identification of new urine-based markers for the early as well as appropriate detection of bladder cancer, which is a well-known malignancy with a complicated molecular nature.
There are several FDA-approved immunochromatographic assays for bladder cancer detection. These tests include the measurement of soluble proteins such as bladder tumor-associated antigen (BTA), nuclear matrix protein 22 (NMP22), proteins detected on fixed urothelial cells (ImmunoCyt), and chromosomal aberrations detected by fluorescence in situ hybridization (UroVysion) [
22]. Several molecular markers have been recently proposed to improve the diagnostic sensitivity of the urine. Among a wide variety of genes participating in the pathogenesis of human cancers, survivin (SVV) is one of the most studied ones due to its unique characteristics that not only plays a crucial role in the tumor progression but also are profoundly involved in the development of drug resistance. SVV is a member of the inhibitor of apoptosis proteins (IAPs) gene family. Its overexpression inhibits extrinsic and intrinsic pathways of apoptosis. Overexpression of SVV has been reported in almost all human malignancies, including, bladder cancer, lung cancer, breast cancer as well as stomach, esophagus, liver, ovarian and hematological cancers [
23,
24]. Moreover, its use as a tumor biomarker has been well-established in some studies on different human cancers [
25‐
27]. However, when it comes to bladder cancer, there are some concerns regarding its efficacy for early as well accurate detection of this type of cancer. The high expression of urinary SVV has been reported in bladder cancer [
28]. Despite the positive correlation between the expression of SVV and the malignant degree of bladder cancer [
29], conflicting results are reflecting the sensitivity of this gene for the detection of low-grade tumors. In this present study, by measuring the sensitivity and specificity of SVV in the urine specimens of bladder cancer patients using qRT-PCR analysis, we found a performance of 72.5% sensitivity, 90% specificity, and 78.3% accuracy. Notably, this technique was successful in the detection of low-grade bladder cancer patients with a sensitivity of 68.3%; suggesting that the measurement of SVV mRNA in urine may be useful for the detection of bladder cancer in both low- and high-grade cases.
There has been an increasing amount of attention focusing on the role of telomerase in the detection of bladder cancer [
30]. Because of its expression in cancer and not in the normal tissues, urine telomerase is a suitable molecular marker for the detection of bladder cancer [
31]. The catalytic subunit (hTERT) of telomerase is correlated with the telomerase activity [
32]. In similarity with SVV, we found that hTERT, as a single biomarker, could provide an accuracy rate of 87.5% for the diagnosis of bladder cancer, thus, introducing this gene as another valuable prognostic biomarker for this malignancy. The well-established association between SVV and hTERT in the pathogenesis of a wide variety of human cancers proposes a possibility that the co-expression of these genes could serve as a novel biomarker for the early detection of this cancer. Notably, considering both the expression levels of SVV and hTERT in the patients resulted in an accuracy rate up to 92.5%. By combining these two biomarkers, suggests the successfulness of using these combinations in the diagnostics of bladder cancer.
KRT7, a member of the cytokeratin family, is highly expressed in a wide variety of human cancers such as ovarian cancer [
33]and squamous cell carcinomas [
34]. Recent studies using gene expression profiling of noninvasive primary urothelial tumors such as urothelial neoplasia (stage Ta) biopsies show that KRT7 is an early change in gene expression, which is found to be highly increased when compared to normal biopsies. Consequently, they suggested this expression could be detected in the urine sediments of bladder tumor patients [
35]. In another study, the expression level of this gene in the circulating cells of patients undergoing radical cystectomy for urothelial cancer was linked to an increased risk of cancer recurrence and death [
36]. Consistently, we found that the sensitivity of KRT7 detection for both low- and high-grade tumors was respectively 90 and 95%, as compared to the 15 and 80% obtained from cytology. Moreover, the sensitivity of KRT7 detection for the early stages of the tumor (Ta and T1) was as high as for the late-stage of tumors (T2 and T3). More interestingly, by combining the results of KRT7 expression and hTERT, a sensitivity of 100% was achieved for bladder cancer patients. Conclusively, our results also showed that combining the expression results of all three genes for bladder cancer patients, either alone or in combination with cytology, provided a sensitivity and NPV of 100%, which was not obtained from any other investigations. Given the significant role of SVV, hTERT, and KRT7 in bladder cancer detection, we suggest that the simultaneous expression analysis of the aforementioned genes could go hand in hand with cytology to provide a better outlook for both the early and accurate diagnosis of patients with bladder cancer in the clinical practice.
Conclusions
In the present study, we investigated the diagnostic potential of measuring the urinary levels of hTERT, SVV, and KRT7 mRNA for the detection of bladder cancer. The detection of these markers in voided urine samples demonstrates superior sensitivities over cytology. The combined use of these markers offers a powerful potential assay and promising tool for a sensitive, noninvasive, and highly specific method for diagnosis and follow-up of low-grade TCC of the bladder.
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.