Skip to main content
Erschienen in: Chinese Medicine 1/2011

Open Access 01.12.2011 | Review

Forensically informative nucleotide sequencing (FINS) for the authentication of Chinese medicinal materials

verfasst von: Ming Li, Kalin Yan-Bo Zhang, Paul Pui-Hay But, Pang-Chui Shaw

Erschienen in: Chinese Medicine | Ausgabe 1/2011

Abstract

Chinese medicinal materials may be authenticated by molecular identification. As a definitive approach to molecular identification of medicinal materials, forensically informative nucleotide sequencing (FINS) comprises four steps, namely (1) DNA extraction from biological samples, (2) selection and amplification of a specific DNA fragment, (3) determination of the sequence of the amplified DNA fragment and (4) cladistic analysis of the sample DNA sequence against a DNA database. Success of the FINS identification depends on the selection of DNA region and reference species. This article describes the techniques and applications of FINS for authenticating Chinese medicinal materials.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1749-8546-6-42) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

ML drafted the manuscript. PCS, KYPZ and PPHB critically revised the manuscript. All authors read and approved the final version of the manuscript.
Abkürzungen
COI
cytochrome c oxidase subunit 1
CTAB
cetyl trimethylammonium bromide
cyt b
cytochrome b gene
EF-1α
elongation factor 1α: FINS: forensically informative nucleotide sequencing
ITS
internal transcribed spacer
matK
maturase K
ML
maximum likelihood
MP
maximum parsimony
NJ
neighbor-joining
nrLSU
nuclear ribosomal large subunit
PCR
polymerase chain reaction
rbcL
large subunit of ribulose-bisphosphate carboxylase
rpb1
largest subunit of RNA polymerase II
trnH-psbA trnH-psbA
intergenic spacer
trnL-trnF trnL-trnF
intergenic spacer
UPGMA
unweighed pair-group mean analysis.

Background

World Health Organization estimates that 70-80% of the population in the developed countries have used some forms of alternative or complementary medicine [1]. Adulteration and misuse of Chinese medicinal products may be due to (a) accidental substitution due to the similarity of organoleptic characters, (b) inconsistent naming in local areas, (c) intentional substitution of expensive materials by less expensive items and (d) different use of substitutes in local areas. Conventional authentication methods based on organoleptic features and chemical constituents are influenced by various factors such as growing stages, environmental factors and post-harvest processing.
Molecular techniques have been employed to authenticate medicinal materials since the mid 1990s [2]. Molecular techniques, such as DNA fingerprinting, DNA sequencing and DNA microarray, have been applied extensively to authenticate Chinese medicinal materials with a number of these applications having been patented and commercialized [3]. DNA sequencing can retrieve the maximum molecular information from a particular DNA region. Polymorphism of nucleotide sequences provides information to distinguish closely related species from distantly related species and between genuine medicinal materials and adulterants.
Forensically informative nucleotide sequencing (FINS), a technique that combines DNA sequencing and phylogenetic analysis, is used to identify samples based on informative nucleotide sequences. The concept of FINS was first proposed by Bartlett and Davidson in 1992 to identify the origin of animal food products and has since been extensively applied in forensic investigations [4, 5]. In the past decade, FINS has been applied to identify and authenticate the Chinese medicinal materials with species-specific DNA regions [68].
This article describes the techniques and applications of FINS in authenticating Chinese medicinal materials.

Performing FINS

A defined DNA sequence from examined specimen is obtained and compared with suitable reference sequences from a reliable database using a phylogenetic analysis to identify the tested material [4]. Four basic steps are involved in FINS, namely (1) DNA extraction from biological samples, (2) selection and amplification of a specific DNA fragment, (3) determination of nucleotide sequences and (4) identification using a phylogenetic analysis against a sequence database. Materials used to construct the reference database should be properly identified fresh materials or authentic preserved specimens. The total DNA can be isolated by either DNA extraction or DNA release [9]. A general workflow of FINS is given in Figure 1.

DNA extraction from biological samples

DNA extraction refers to an invasive method that extracts DNA from tissues and cells via physical disruption and/or chemical fractionation. Cetyl trimethylammonium bromide (CTAB) and phenol/chloroform extraction [10] was employed by a number of commercial kits for DNA extraction. For example, DNA from highly processed Chinese medicinal materials, such as the mule skin extract Asini Corii Colla (Ejiao) [11].
DNA release, a non-invasive method that allows DNA to release from a sample into a solution without destruction, is particularly useful for obtaining DNA from important voucher specimens. DNA release is also used to investigate samples by analyzing the environmental DNA or the preservative, as demonstrated by recent studies of DNA detection from the water in which frogs (Rana catesbeiana) live and from worms (Hypopta agavis) preserved in 95% ethanol [12, 13]. The quantity and quality of the obtained DNA is a major concern with this method. While purification may be achieved by commercially available kits, the yield of DNA is quite minute and should be stored in safe conditions (freezing, cyanide and ethanol), certain chemicals that can damage DNA, such as ethyl acetate or formaldehyde, should be avoided [14].

Selection and amplification of a specific DNA fragment

Usually, only a small amount of DNA can be extracted or released from highly processed or improperly stored Chinese medicinal materials. Polymerase chain reaction (PCR) can produce a sufficient amount of a specific DNA fragment obtained from a tiny amount of DNA extract. The selection of a DNA region for amplification is one of the crucial factors for FINS because the resolution of FINS depends heavily on the variability and the number of informative sites of the DNA sequences of the tested samples and reference materials. As the evolutionary rates of different DNA regions vary, DNA regions with sufficient variability are essential for providing a high resolution result. Rapidly evolving regions among taxonomic groups can be used for the identification at the genus or species level. Slowly evolving regions among groups can be used to differentiate at the section or family level. An ideal DNA region for identifying Chinese medicinal materials should have high inter-specific variation but low intra-specific variation and have sufficient informative polymorphic sites to allow differential sequence alignment among the samples and the reference species. The evolutionary rate of the same DNA region may vary among animals, plants and fungi. For example, mitochondrial cytochrome c oxidase subunit 1 (COI) is suitable for the identification of specific animal species [15]; however, it is not suitable for most plants as few polymorphic sites are found across the 1.4 kb COI sequences [16], probably due to the slow mutation rate [17]. Thus, prior knowledge of the evolutionary rates of various DNA regions facilitates the selection of an appropriate DNA region. In the past few years, short DNA sequences for global barcoding of species have been proposed [15]. For example, the DNA barcodes for animals is COI and for fungi is ITS; the core DNA barcodes for plants are chloroplast large subunit of ribulose-bisphosphate carboxylase gene (rbcL) and chloroplast maturase K coding region (matK), while chloroplast trnH-psbA intergenic spacer (trnH-psbA) and nuclear internal transcribed spacer (ITS) are supplementary DNA barcodes for plants [15, 18, 19]. Recent studies suggested that ITS should be incorporated into the core DNA barcode for seed plants [2022]. These DNA barcodes have also been commonly applied to identify medicinal materials and should be considered as the primary DNA target region for FINS [23]. Chinese medicinal materials are often dried or processed, which may affect the quality and quantity of the extractable DNA. A shorter DNA region should be considered for samples with degraded DNA. The universal primers for PCR amplification of some commonly used regions in FINS are listed in Table 1.
Table 1
Universal primers for PCR amplification of commonly used DNA regions
Region
Primer (5' > 3')
Reference
5S rDNA spacer
S-1
GGATTCGTGCTTGGGCGAGAGTAGTA
[34]
 
AS-1
TGCGATCATACCAGCACTAAGGATCC
 
12S rDNA
Fwd
CAAACTGGGATTAGATACCCCACTAT
[35]
 
Rev
GAGGGTGACGGGCGGTGTGT
 
16S rDNA
Fwd
CGCCTGTTTATCAAAAACAT
[36]
 
Rev
CTCCGGTTTGAACTCAGATC
 
18S rDNA
18SF
CAACCTGGTTGATCCTGCCAGT
[37]
 
18SR
CTGATCCTTCTGCACCTTCACCTAC
 
COI
LCO1490
GGTCAACAAATCATAAAGATATTGG
[15]
 
HCO2198
TAAACTTCAGGGTGACCAAAAAATCA
 
Cyt b
mcb398
TACCATGAGGACAAATATCATTCTG
[38]
 
Rev
CCTCCTAGTTTGTTAGGGATTGATCG
 
ITS
ITS4
TCCTCCGCTTATTGATATGC
[18]
 
ITS5a
CCTTATCATTTAGAGGAAGGAG
 
ITS-1
18d
CACACCGCCCGTCGCTCCTACCGA
[39]
 
5.8c
TTGCGTTCAAAGACTCGATG
 
ITS-2
5.8d
AACCATCGAGTCTTTGAACGCA
[39]
 
28cc
ACTCGCCGTTACTAGGGGAA
 
MatK
3F_KIM f
CGTACAGTACTTTTGTGTTTACGAG
[19]
 
1R_KIM r
ACCCAGTCCATCTGGAAATCTTGGTTC
 
Mitochondrial control region
L15998
TACCCCAAACTCCCAAAGCTA
[40]
 
CSBDH
TGAATTAGGAACCAGATGCCAG
 
TrnH-psbA
psbA3'f
GTTATGCATGAACGTAATGCTC
[18]
 
trnHf
CGCGCATGGTGGATTCACAATCC
 
TrnL-trnF
Tab C
CGAAATCGGTAGACGCTACG
[41]
 
Tab F
ATTTGAACTGGTGACACGAG
 
RbcL
rbcLa_F
ATGTCACCACAAACAGAGACTAAAGC
[19]
 
rbcLa_R
GTAAAATCAAGTCCACCRCG
 

Determination of nucleotide sequences

DNA sequencing is the most direct approach to obtaining maximum genetic information of the amplified DNA regions. With significantly lowered costs and time, DNA sequencing is now routinely used to identify medicinal materials. The amplified and purified DNA fragments may be sequenced directly; however, molecular cloning may be applied in some cases. Cloning is required if (1) some DNA regions (e.g. ITS and 5S rRNA gene spacer) have non-homogenous multiple copies or secondary structures [24, 25]; (2) non-specific PCR amplification generates multiple amplicons of similar size; (3) there is simultaneous amplification of DNA from samples and fungal contaminants (e.g. due to improper storage) and (4) there is poly-A/T structure (e.g. in trnH-psbA) interfering with the DNA sequencing [26].

Phylogenetic analysis with reference to a sequence database

A sequence database is necessary because a successful application of FINS relies on the comparison of DNA sequences among the samples and reference species. Phylogenetic analyses of many taxa using various DNA regions have been performed, providing useful reference for FINS. Our group has recently constructed an online Medicinal Materials DNA Barcoding Database http://​www.​cuhk.​edu.​hk/​icm/​mmdbd.​htm, which contains over 20,000 DNA sequences of 1,300 medicinal species found in the Pharmacopoeia of the People's Republic of China and the United States Pharmacopoeia [27]. DNA sequences can also be found in the open access NCBI GenBank http://​www.​ncbi.​nlm.​nih.​gov/​genbank, EMBL Nucleotide Sequence Database http://​www.​ebi.​ac.​uk/​embl as well as the Chloroplast Genome Database http://​chloroplast.​cbio.​psu.​edu. With the vast amount of sequence data, it is possible to roughly identify any unknown sample even if the sequence of its source species is not yet available. However, the quality of publicly available DNA sequences could sometimes be incorrect or derived from wrongly identified species [6, 28, 29]. Generation of tailor-made reference sequences is essential if the concerned reference sequences do not exist and high resolution identification is required.
The original idea of FINS is to perform phylogenetic analysis of unknown samples together with the reference species to trace their source origin [4], which is different from molecular identification based solely on multiple sequence alignment and comparison of polymorphic sites. FINS emphasizes the use of phylogenetic analysis to identify species via phylograms [4]. In general, phylogenetic analysis carefully selects sequence alignment to find the informative homologous sites for subsequent analysis. Phylogenetic trees are then constructed using tree construction methods, such as maximum parsimony (MP), maximum likelihood (ML) and Bayesian analysis, to reflect the evolutionary history of the concerned taxa. Available computer programs for constructing multiple sequence alignment and phylogenetic analysis are Align-M, ClustalW, BioEdit, PAUP and MEGA [30].
To identify medicinal materials, FINS users would rather identify a sample than its phylogenetic relationship with the reference species. The topology of the phylogram is the major concern and the phylogenetic relationship among the reference species is less focused in FINS identification. It was suggested that DNA distance-based methods are preferred to phylogeny-based methods in the application of FINS for identification [31]. The DNA distance-based method provides similarities between the reference and the unknown species whereas the phylogeny-based method explores the evolutionary history of the species. The major difference between these two methods lies in the way that the DNA sequences are analyzed. Phylogenetic relationship analysis, such as maximum parsimony and maximum likelihood, uses a matrix of discrete phylogenetic informative characters or statistical models to infer the optimal phylogenetic trees of selected taxa. Distance-matrix methods, such as unweighed pair-group mean analysis (UPGMA) and neighbor-joining (NJ), calculate the genetic distance from multiple sequence alignments to determine the similarities among reference sequences. A cladogram is then constructed based on the pair-wise distance values to build up the relationship of similarity. The distance-matrix methods are simple to implement and do not invoke any evolutionary indications because similar looking species may not necessarily be phylogenetically related (i.e. convergent evolution).

Applications of FINS in Chinese medicinal materials

Over 800 medicinal species are officially recorded in the Pharmacopoeia of the People's Republic of China [32]. Some of these Chinese medicinal materials are economically important and ecologically valuable, such as Dendrobii Caulis (Shihu), while some others are highly toxic, such as Aristolochiae Fructus (Madouling) and Radix Tripterygii Wilfordii (Leigongteng). FINS is one of the most definitive methods to ensure they are used safely and to protect consumers from adulteration. Over the years, FINS has been used to identify economically important materials and ecologically valuable species, as well as toxic and commonly used Chinese medicinal materials. Examples of the identification of these Chinese medicinal materials using FINS are given in Table 2.
Table 2
Representative examples of FINS identification of Chinese medicinal materials
Year
Test material
DNA locus
Major finding
Reference
2002
Shihu samples and Dendrobium species
ITS
4 inspected samples of 'Fengdou' were identified
[7]
2003
Rhinoceros horns, Rhinoceros species and other mammals
Cyt b
2 samples were white rhinoceros and 4 samples were dark rhinoceros
[8]
2004
Snake blood and meat, and 90 snake species
Cyt b
6 unknown samples were identified as Python molurus and P. reticulates
[42]
2005
Chinese sika deer and Cervus Nippon subspecies
Mitochondrial control region
2 suspected samples were derived from wild population of C. Nippon kopschi
[43]
2007
Fresh and herbal samples of Dangshen
5S rDNA spacer
2 samples of Hong Dangshen were identified as Codonopsis pilosula var. modesta
[44]
2008
Snake venom
16S rDNA
1 snake venom was identified as derived from Naja atra
[45]
2009
Shihu samples and Dendrobium species
ITS
Identification of 10 Shihu samples: 6 were D. officinale, 1 was D. nobile and 3 were D. denneanum
[46]
 
Shihu samples and Dendrobium species
MatK
Identification of 4 Shihu samples: 3 were D. officinale and 1 were D. nobile
[47]
 
Shihu samples and Dendrobium species
TrnH-psbA
Identification of various 'Fengdou' Dendrobium species 20 shihu samples
[48]
 
Snake venom
16S rDNA
4 snake venom samples were all genuine
[49]
2010
Baihuasheshecao samples and Hedyotis species
ITS
4 out of 7 samples were adulterated by H. corymbosa
[50]
 
Madouling samples, Aristolochia, Cardiocrinum and Lilium species
TrnH-psbA, trnL-trnF
2 out of 4 Madouling samples from Taiwan and Yunnan were substituted by C. giganteum var. yunnanense
[51]
2011
Cordyceps samples and related Cordyceps species
EF-1α, ITS, nrLSU, rpb1
3 Cordyceps samples were genuine derived from C. sinensis, 5 samples were C. gunni from China and 1 sample was C. gunni from Tasmania
[6]
 
Leigongteng samples, Tripterygium and Celastrus species
5S rDNA spacer, ITS
3 samples of Leigongteng were genuine herb derived from T. wilfordii, 2 samples were adulterants derived from Celastrus species
[52]

Requirements for FINS used to authenticate Chinese medicinal materials

FINS has four major requirements on its application in identifying Chinese medicinal materials. Firstly, the success of FINS identification is highly dependent on the quality and amount of the reference sequences [6, 28, 29]. Confirmation of the authenticity of the reference sequences or generation of tailor-made sequences may be costly and time-consuming. Secondly, FINS requires a reference database to identify any single Chinese medicinal material. Therefore, it is important to select and/or construct various databases with different reference species and different DNA regions to identify a mixture of Chinese medicinal materials. Thirdly, similar to other molecular identification techniques, FINS requires sufficient amount of good quality DNA. Some Chinese medicinal materials are derived from various plant parts with low DNA content and that were highly processed (e.g. by heat, boil or sun-dry). As a result, DNA can be damaged to the point where only very short fragments (< 200 base pair) are left [11, 33]. These short DNA fragments may not possess sufficient informative characters for high resolution FINS identification. ITS2 may be a good region for FINS because of its small size (200-300 base pair) and its high variability in plants and animals [20], although molecular cloning is needed to overcome the problem of multiple copies and secondary structure [24, 25]. Fourthly, contamination of fungal species is common in Chinese medicinal materials. Specific primers are required for the materials without the amplification of the contaminants when nuclear DNA regions, such as ITS and 5S rRNA gene spacer, are used.

Conclusion

Using to authenticate genuine medicinal materials, FINS actually traces the identifies of DNA samples at different taxonomic levels. High resolution FINS is expected to be useful in the authentication and quality control of Chinese medicinal materials.

Acknowledgements

We are indebted to Dr. David Wilmshurst of the Research Administration Office of The Chinese University of Hong Kong for his editing of the manuscript. Our research projects in FINS were partially supported by a sub-grant for the Large-scale Scientific Facilities of the Chinese Academy of Sciences (2009-LSF-GBOWS-01).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

ML drafted the manuscript. PCS, KYPZ and PPHB critically revised the manuscript. All authors read and approved the final version of the manuscript.
Anhänge

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.
Literatur
1.
Zurück zum Zitat World Health Organization: Traditional Medicine. Fact Sheet. 2008, N134- World Health Organization: Traditional Medicine. Fact Sheet. 2008, N134-
2.
Zurück zum Zitat Shaw PC, But PPH: Authentication of Panax species and their adulterants by random-primed polymerase chain reaction. Planta Med. 1995, 61: 466-469. 10.1055/s-2006-958138.CrossRefPubMed Shaw PC, But PPH: Authentication of Panax species and their adulterants by random-primed polymerase chain reaction. Planta Med. 1995, 61: 466-469. 10.1055/s-2006-958138.CrossRefPubMed
3.
Zurück zum Zitat Shaw PC, Wong KL, Chan AW, Wong WC, But PPH: Patent applications for using DNA technologies to authenticate medicinal herbal material. Chin Med. 2009, 4: 21-10.1186/1749-8546-4-21.PubMedCentralCrossRefPubMed Shaw PC, Wong KL, Chan AW, Wong WC, But PPH: Patent applications for using DNA technologies to authenticate medicinal herbal material. Chin Med. 2009, 4: 21-10.1186/1749-8546-4-21.PubMedCentralCrossRefPubMed
4.
Zurück zum Zitat Bartlett SE, Davidson WS: FINS (forensically informative nucleotide sequencing): a procedure for identifying the animal origin of biological specimens. Biotechniques. 1992, 12: 408-411.PubMed Bartlett SE, Davidson WS: FINS (forensically informative nucleotide sequencing): a procedure for identifying the animal origin of biological specimens. Biotechniques. 1992, 12: 408-411.PubMed
5.
Zurück zum Zitat Sahajpal V, Goyal SP: Identification of a forensic case using microscopy and forensically informative nucleotide sequencing (FINS): A case study of small Indian civet (Viverricula indica). Sci Justice. 2009, 50: 94-97.CrossRefPubMed Sahajpal V, Goyal SP: Identification of a forensic case using microscopy and forensically informative nucleotide sequencing (FINS): A case study of small Indian civet (Viverricula indica). Sci Justice. 2009, 50: 94-97.CrossRefPubMed
6.
Zurück zum Zitat Chan WH, Ling KH, Chiu SW, Shaw PC, But PPH: Molecular Analyses of Cordyceps gunnii in China. J Food Drug Anal. 2011, 19: 18-25. Chan WH, Ling KH, Chiu SW, Shaw PC, But PPH: Molecular Analyses of Cordyceps gunnii in China. J Food Drug Anal. 2011, 19: 18-25.
7.
Zurück zum Zitat Ding XY, Wang ZT, Xu H, Xu LS, Zhou KY: Database establishment of the whole rDNA ITS region of Dendrobium species of "fengdou" and authentication by analysis of their sequences. YaoXueXueBao. 2002, 37: 567-573. Ding XY, Wang ZT, Xu H, Xu LS, Zhou KY: Database establishment of the whole rDNA ITS region of Dendrobium species of "fengdou" and authentication by analysis of their sequences. YaoXueXueBao. 2002, 37: 567-573.
8.
Zurück zum Zitat Hsieh HM, Huang LH, Tsai LC, Kuo YC, Meng HH, Linacre A, Lee JC: Species identification of rhinoceros horns using the cytochrome b gene. Forensic Sci Int. 2003, 136: 1-11.CrossRefPubMed Hsieh HM, Huang LH, Tsai LC, Kuo YC, Meng HH, Linacre A, Lee JC: Species identification of rhinoceros horns using the cytochrome b gene. Forensic Sci Int. 2003, 136: 1-11.CrossRefPubMed
9.
Zurück zum Zitat Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh RT, Kirk SL, Mackie PM, Hebert PD: Critical factors for assembling a high volume of DNA barcodes. Phil Trans R Soc B. 2005, 360: 1959-1967. 10.1098/rstb.2005.1727.PubMedCentralCrossRefPubMed Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh RT, Kirk SL, Mackie PM, Hebert PD: Critical factors for assembling a high volume of DNA barcodes. Phil Trans R Soc B. 2005, 360: 1959-1967. 10.1098/rstb.2005.1727.PubMedCentralCrossRefPubMed
10.
Zurück zum Zitat Kang HW, Cho YG, Yoon UH, Eun MY: A rapid DNA extraction method for RFLP and PCR analysis from a single dry seed. Plant Mol Bio Rep. 1998, 16: 1-9.CrossRef Kang HW, Cho YG, Yoon UH, Eun MY: A rapid DNA extraction method for RFLP and PCR analysis from a single dry seed. Plant Mol Bio Rep. 1998, 16: 1-9.CrossRef
11.
Zurück zum Zitat Lv P, Zhou X, You J, Ye BC, Zhang Y: Extraction of trace amount of severely degraded DNA. Z Naturforsch C. 2009, 64: 581-589.CrossRefPubMed Lv P, Zhou X, You J, Ye BC, Zhang Y: Extraction of trace amount of severely degraded DNA. Z Naturforsch C. 2009, 64: 581-589.CrossRefPubMed
12.
Zurück zum Zitat Ficetola GF, Miaud C, Pompanon F, Taberlet P: Species detection using environmental DNA from water samples. Bio Letters. 2008, 4: 423-425. 10.1098/rsbl.2008.0118.CrossRef Ficetola GF, Miaud C, Pompanon F, Taberlet P: Species detection using environmental DNA from water samples. Bio Letters. 2008, 4: 423-425. 10.1098/rsbl.2008.0118.CrossRef
13.
Zurück zum Zitat Shokralla S, Singer GAC, Hajibabaei M: Direct PCR amplification and sequencing of specimen's DNA from preservative ethanol. Biotechniques. 2010, 44: 305-306. Shokralla S, Singer GAC, Hajibabaei M: Direct PCR amplification and sequencing of specimen's DNA from preservative ethanol. Biotechniques. 2010, 44: 305-306.
14.
Zurück zum Zitat Prendini L, Hanner R, DeSalle R: Obtaining, storing and archiving specimens and tissue samples for use in molecular studies. Techniques in Molecular Evolution and Systematics. Edited by: DeSalle R, Giribet G, Wheeler WC. 2002, Basel: Birkhaeuser Verlag AG, 176-248.CrossRef Prendini L, Hanner R, DeSalle R: Obtaining, storing and archiving specimens and tissue samples for use in molecular studies. Techniques in Molecular Evolution and Systematics. Edited by: DeSalle R, Giribet G, Wheeler WC. 2002, Basel: Birkhaeuser Verlag AG, 176-248.CrossRef
15.
Zurück zum Zitat Hebert PD, Cywinska A, Ball SL, deWaard JR: Biological identifications through DNA barcodes. Proc Biol Sci. 2003, 270: 313-321. 10.1098/rspb.2002.2218.PubMedCentralCrossRefPubMed Hebert PD, Cywinska A, Ball SL, deWaard JR: Biological identifications through DNA barcodes. Proc Biol Sci. 2003, 270: 313-321. 10.1098/rspb.2002.2218.PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Cho Y, Mower JP, Qiu YL, Palmer JD: Mitochondrial substitution rates are extraordinarily elevated and variable in a genus of flowering plants. P Natl Acad Sci USA. 2004, 101: 17741-17746. 10.1073/pnas.0408302101.CrossRef Cho Y, Mower JP, Qiu YL, Palmer JD: Mitochondrial substitution rates are extraordinarily elevated and variable in a genus of flowering plants. P Natl Acad Sci USA. 2004, 101: 17741-17746. 10.1073/pnas.0408302101.CrossRef
17.
Zurück zum Zitat Wolfe KH, Li WH, Sharp PM: Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. P Natl Acad Sci USA. 1987, 84: 9054-9058. 10.1073/pnas.84.24.9054.CrossRef Wolfe KH, Li WH, Sharp PM: Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. P Natl Acad Sci USA. 1987, 84: 9054-9058. 10.1073/pnas.84.24.9054.CrossRef
18.
Zurück zum Zitat Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH: Use of DNA barcodes to identify flowering plants. P Natl Acad Sci USA. 2005, 102: 8369-8374. 10.1073/pnas.0503123102.CrossRef Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH: Use of DNA barcodes to identify flowering plants. P Natl Acad Sci USA. 2005, 102: 8369-8374. 10.1073/pnas.0503123102.CrossRef
19.
Zurück zum Zitat CBOL Plant Working Group: A DNA barcode for land plants. P Natl Acad Sci USA. 2009, 106: 12794-12797.CrossRef CBOL Plant Working Group: A DNA barcode for land plants. P Natl Acad Sci USA. 2009, 106: 12794-12797.CrossRef
20.
Zurück zum Zitat Chen S, Yao H, Han J, Liu C, Song J, Shi L, Zhu Y, Ma X, Gao T, Pang X, Luo K, Li Y, Li X, Jia X, Lin Y, Leon C: Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PloS One. 2010, 5: e8613-10.1371/journal.pone.0008613.PubMedCentralCrossRefPubMed Chen S, Yao H, Han J, Liu C, Song J, Shi L, Zhu Y, Ma X, Gao T, Pang X, Luo K, Li Y, Li X, Jia X, Lin Y, Leon C: Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PloS One. 2010, 5: e8613-10.1371/journal.pone.0008613.PubMedCentralCrossRefPubMed
21.
Zurück zum Zitat China Plant BOL Group, Li DZ, Gao LM, Li HT, Wang H, Ge XJ, Liu JQ, Chen ZD, Zhou SL, Chen SL, Yang JB, Fu CX, Zeng CX, Yan HF, Zhu YJ, Sun YS, Chen SY, Zhao L, Wang K, Yang T, Duan GW: Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. P Natl Acad Sci USA. China Plant BOL Group, Li DZ, Gao LM, Li HT, Wang H, Ge XJ, Liu JQ, Chen ZD, Zhou SL, Chen SL, Yang JB, Fu CX, Zeng CX, Yan HF, Zhu YJ, Sun YS, Chen SY, Zhao L, Wang K, Yang T, Duan GW: Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. P Natl Acad Sci USA.
22.
Zurück zum Zitat Hollingsworth PM: Refining the DNA barcode for land plants. P Natl Acad Sci USA. Hollingsworth PM: Refining the DNA barcode for land plants. P Natl Acad Sci USA.
23.
Zurück zum Zitat Li M, Cao H, But PPH, Shaw PC: Identification of herbal medicinal materials using DNA barcodes. J Syst Evol. 2011, 49: 271-283. 10.1111/j.1759-6831.2011.00132.x.CrossRef Li M, Cao H, But PPH, Shaw PC: Identification of herbal medicinal materials using DNA barcodes. J Syst Evol. 2011, 49: 271-283. 10.1111/j.1759-6831.2011.00132.x.CrossRef
24.
Zurück zum Zitat Alvarez I, Wendel JF: Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 2003, 29: 417-434. 10.1016/S1055-7903(03)00208-2.CrossRefPubMed Alvarez I, Wendel JF: Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 2003, 29: 417-434. 10.1016/S1055-7903(03)00208-2.CrossRefPubMed
25.
Zurück zum Zitat Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF, Campbell CS, Donoghue MJ: The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann Mo Bot Gard. 1995, 82: 247-277. 10.2307/2399880.CrossRef Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF, Campbell CS, Donoghue MJ: The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann Mo Bot Gard. 1995, 82: 247-277. 10.2307/2399880.CrossRef
26.
Zurück zum Zitat Zhu YJ, Chen SL, Yao H, Tan R, Song JY, Luo K, Lu J: DNA barcoding the medicinal plants of the genus Paris. YaoXueXueBao. 2010, 45: 376-382. Zhu YJ, Chen SL, Yao H, Tan R, Song JY, Luo K, Lu J: DNA barcoding the medicinal plants of the genus Paris. YaoXueXueBao. 2010, 45: 376-382.
27.
Zurück zum Zitat Lou SK, Wong KL, Li M, But PPH, Tsui KW, Shaw PC: Construction of an integrated web medicinal herbal material DNA database. BMC Genomics. 2010, 11: 402-10.1186/1471-2164-11-402.PubMedCentralCrossRefPubMed Lou SK, Wong KL, Li M, But PPH, Tsui KW, Shaw PC: Construction of an integrated web medicinal herbal material DNA database. BMC Genomics. 2010, 11: 402-10.1186/1471-2164-11-402.PubMedCentralCrossRefPubMed
28.
Zurück zum Zitat Vilgalys R: Taxonomic misidentification in public DNA databases. New Phytol. 2003, 160: 4-5. 10.1046/j.1469-8137.2003.00894.x.CrossRef Vilgalys R: Taxonomic misidentification in public DNA databases. New Phytol. 2003, 160: 4-5. 10.1046/j.1469-8137.2003.00894.x.CrossRef
29.
Zurück zum Zitat Nilsson RH, Ryberg M, Kristiansson E, Abarenkov K, Larsson KH, Koljalg U: Taxonomic reliability of DNA sequences in public sequence databases: a fungal perspective. PloS One. 2006, 1: e59-10.1371/journal.pone.0000059.PubMedCentralCrossRefPubMed Nilsson RH, Ryberg M, Kristiansson E, Abarenkov K, Larsson KH, Koljalg U: Taxonomic reliability of DNA sequences in public sequence databases: a fungal perspective. PloS One. 2006, 1: e59-10.1371/journal.pone.0000059.PubMedCentralCrossRefPubMed
30.
Zurück zum Zitat Schmitt I, Barker FK: Phylogenetic methods in natural product research. Nat Prod Rep. 2009, 26: 1585-1602. 10.1039/b910458p.CrossRefPubMed Schmitt I, Barker FK: Phylogenetic methods in natural product research. Nat Prod Rep. 2009, 26: 1585-1602. 10.1039/b910458p.CrossRefPubMed
31.
Zurück zum Zitat Forrest AR, Carnegie PR: Identification of gourmet meat using FINS (forensically informative nucleotide sequencing). Biotechniques. 1994, 17: 24, 26-PubMed Forrest AR, Carnegie PR: Identification of gourmet meat using FINS (forensically informative nucleotide sequencing). Biotechniques. 1994, 17: 24, 26-PubMed
32.
Zurück zum Zitat State Pharmacopoeia Commission of People's Republic of China: Pharmacopoeia of the People's Republic of China. 2010, Beijing: Chemical Industry Press State Pharmacopoeia Commission of People's Republic of China: Pharmacopoeia of the People's Republic of China. 2010, Beijing: Chemical Industry Press
33.
Zurück zum Zitat Teletchea F, Maudet C, Hanni C: Food and forensic molecular identification: update and challenges. Trends Biotechnol. 2005, 23: 359-366. 10.1016/j.tibtech.2005.05.006.CrossRefPubMed Teletchea F, Maudet C, Hanni C: Food and forensic molecular identification: update and challenges. Trends Biotechnol. 2005, 23: 359-366. 10.1016/j.tibtech.2005.05.006.CrossRefPubMed
34.
Zurück zum Zitat Chen F, Chan HY, Wong KL, Wang J, Yu MT, But PPH, Shaw PC: Authentication of Saussurea lappa, an endangered medicinal material, by ITS DNA and 5S rRNA sequencing. Planta Med. 2008, 74: 889-892. 10.1055/s-2008-1074551.CrossRefPubMed Chen F, Chan HY, Wong KL, Wang J, Yu MT, But PPH, Shaw PC: Authentication of Saussurea lappa, an endangered medicinal material, by ITS DNA and 5S rRNA sequencing. Planta Med. 2008, 74: 889-892. 10.1055/s-2008-1074551.CrossRefPubMed
35.
Zurück zum Zitat Girish PS, Anjaneyulu ASR, Viswas KN, Anand M, Rajkumar Nb, Shivakumar BM, Bhaskar S: Sequence analysis of mitochondrial 12S rRNA gene can identify meat species. Meat Sci. 2004, 66: 551-556. 10.1016/S0309-1740(03)00158-X.CrossRefPubMed Girish PS, Anjaneyulu ASR, Viswas KN, Anand M, Rajkumar Nb, Shivakumar BM, Bhaskar S: Sequence analysis of mitochondrial 12S rRNA gene can identify meat species. Meat Sci. 2004, 66: 551-556. 10.1016/S0309-1740(03)00158-X.CrossRefPubMed
36.
Zurück zum Zitat Mitchell SE, Cockburn AF, Seawright JA: The mitochondrial genome of Anopheles quadrimaculatus species A: complete nucleotide sequence and gene organization. Genome. 1993, 36: 1058-1073. 10.1139/g93-141.CrossRefPubMed Mitchell SE, Cockburn AF, Seawright JA: The mitochondrial genome of Anopheles quadrimaculatus species A: complete nucleotide sequence and gene organization. Genome. 1993, 36: 1058-1073. 10.1139/g93-141.CrossRefPubMed
37.
Zurück zum Zitat Sogin ML: Amplification of ribosomal RNA genes for molecular evolution studies. PCR Protocols: a Guide to Methods and Application. Edited by: Innis M, Gelfand DH, Sninksky J. 1990, San Diego: Academic Press, 307- Sogin ML: Amplification of ribosomal RNA genes for molecular evolution studies. PCR Protocols: a Guide to Methods and Application. Edited by: Innis M, Gelfand DH, Sninksky J. 1990, San Diego: Academic Press, 307-
38.
Zurück zum Zitat Verma SK, Singh L: Novel universal primers establish identity of an enormous number of animal species for forensic application. Molecular Ecology Notes. 2003, 3: 28-31.CrossRef Verma SK, Singh L: Novel universal primers establish identity of an enormous number of animal species for forensic application. Molecular Ecology Notes. 2003, 3: 28-31.CrossRef
39.
Zurück zum Zitat White TJ, Burns T, Lee S, Taylor JW: Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: A guide to methods and applications. Edited by: Innis MA, Gelfand DH, Sninsky JJ, White TJ. 1990, New York: Academic Press, 315-322. White TJ, Burns T, Lee S, Taylor JW: Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: A guide to methods and applications. Edited by: Innis MA, Gelfand DH, Sninsky JJ, White TJ. 1990, New York: Academic Press, 315-322.
40.
Zurück zum Zitat Vinas J, Tudela S: A validated methodology for genetic identification of tuna species (genus Thunnus). PloS One. 2009, 4: e7606-10.1371/journal.pone.0007606.PubMedCentralCrossRefPubMed Vinas J, Tudela S: A validated methodology for genetic identification of tuna species (genus Thunnus). PloS One. 2009, 4: e7606-10.1371/journal.pone.0007606.PubMedCentralCrossRefPubMed
41.
Zurück zum Zitat Taberlet P, Gielly L, Pautou G, Bouvet J: Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol. 1991, 17: 1105-1109. 10.1007/BF00037152.CrossRefPubMed Taberlet P, Gielly L, Pautou G, Bouvet J: Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol. 1991, 17: 1105-1109. 10.1007/BF00037152.CrossRefPubMed
42.
Zurück zum Zitat Wong KL, Wang J, But PPH, Shaw PC: Application of cytochrome b DNA sequences for the authentication of endangered snake species. Forensic Sci Int. 2004, 139: 49-55. 10.1016/j.forsciint.2003.09.015.CrossRefPubMed Wong KL, Wang J, But PPH, Shaw PC: Application of cytochrome b DNA sequences for the authentication of endangered snake species. Forensic Sci Int. 2004, 139: 49-55. 10.1016/j.forsciint.2003.09.015.CrossRefPubMed
43.
Zurück zum Zitat Wu H, Wan QH, Fang SG, Zhang SY: Application of mitochondrial DNA sequence analysis in the forensic identification of Chinese sika deer subspecies. Forensic Sci Int. 2005, 148: 101-105. 10.1016/j.forsciint.2004.04.072.CrossRefPubMed Wu H, Wan QH, Fang SG, Zhang SY: Application of mitochondrial DNA sequence analysis in the forensic identification of Chinese sika deer subspecies. Forensic Sci Int. 2005, 148: 101-105. 10.1016/j.forsciint.2004.04.072.CrossRefPubMed
44.
Zurück zum Zitat Zhang YB, Jiang RW, Li SL, Qiao CF, Han QB, Xu HX, Wong KL, But PPH, Shaw PC: Chemical and molecular characterization of Hong Dangshen, a unique medicinal material for diarrhea in Hong Kong. J Chin Pharmaceut Sci. 2007, 16: 202-207. Zhang YB, Jiang RW, Li SL, Qiao CF, Han QB, Xu HX, Wong KL, But PPH, Shaw PC: Chemical and molecular characterization of Hong Dangshen, a unique medicinal material for diarrhea in Hong Kong. J Chin Pharmaceut Sci. 2007, 16: 202-207.
45.
Zurück zum Zitat Chen N, Zhao SJ, Han LP: DNA molecular identification of one snake crude venom used for production. ShiZhenGuoYiGuoYao. 2008, 19: 1578-1580. Chen N, Zhao SJ, Han LP: DNA molecular identification of one snake crude venom used for production. ShiZhenGuoYiGuoYao. 2008, 19: 1578-1580.
46.
Zurück zum Zitat Liu J, He T, Chun Z: DNA molecular identification of Herba Dendrobii and its adulterant species based on ITS sequence analysis. ZhongGuoZhongYaoZaZhi. 2009, 34: 2853-2856. Liu J, He T, Chun Z: DNA molecular identification of Herba Dendrobii and its adulterant species based on ITS sequence analysis. ZhongGuoZhongYaoZaZhi. 2009, 34: 2853-2856.
47.
Zurück zum Zitat Liu J, He T, Chun Z: Analysis and authentication of chloroplast matK gene sequences of Herba Dendrobii. YaoXueXueBao. 2009, 44: 1051-1055. Liu J, He T, Chun Z: Analysis and authentication of chloroplast matK gene sequences of Herba Dendrobii. YaoXueXueBao. 2009, 44: 1051-1055.
48.
Zurück zum Zitat Shao SG, Han L, Ma YH, Shen J, Zhang WC, Ding XY: Analysis and authentication of cpDNA psbA-trnH regions of Dendrobium species of fengdous. YaoXueXueBao. 2009, 44: 1173-1178. Shao SG, Han L, Ma YH, Shen J, Zhang WC, Ding XY: Analysis and authentication of cpDNA psbA-trnH regions of Dendrobium species of fengdous. YaoXueXueBao. 2009, 44: 1173-1178.
49.
Zurück zum Zitat Chen N, Zhao SJ: Forensic identification of snake crude venom by mtDNA analysis. ShiZhenGuoYiGuoYao. 2009, 20: 2001-2003. Chen N, Zhao SJ: Forensic identification of snake crude venom by mtDNA analysis. ShiZhenGuoYiGuoYao. 2009, 20: 2001-2003.
50.
Zurück zum Zitat Li M, Jiang RW, Hon PM, Cheng L, Li LL, Zhou JR, Shaw PC, But PPH: Authentication of the anti-tumor herb Baihuasheshecao with bioactive marker compounds and molecular sequences. Food Chem. 2010, 119: 1239-1245. 10.1016/j.foodchem.2009.09.013.CrossRef Li M, Jiang RW, Hon PM, Cheng L, Li LL, Zhou JR, Shaw PC, But PPH: Authentication of the anti-tumor herb Baihuasheshecao with bioactive marker compounds and molecular sequences. Food Chem. 2010, 119: 1239-1245. 10.1016/j.foodchem.2009.09.013.CrossRef
51.
Zurück zum Zitat Li M, Ling KH, Lam H, Shaw PC, Cheng L, Techen N, Khan IA, Chang YS, But PPH: Cardiocrinum seeds as a replacement for Aristolochia fruits in treating cough. J Ethnopharmacol. 2010, 130: 429-432. 10.1016/j.jep.2010.04.040.CrossRefPubMed Li M, Ling KH, Lam H, Shaw PC, Cheng L, Techen N, Khan IA, Chang YS, But PPH: Cardiocrinum seeds as a replacement for Aristolochia fruits in treating cough. J Ethnopharmacol. 2010, 130: 429-432. 10.1016/j.jep.2010.04.040.CrossRefPubMed
52.
Zurück zum Zitat Law SK, Simmons MP, Techen N, Khan IA, He MF, Shaw PC, But PPH: Molecular analyses of the Chinese herb Leigongteng (Tripterygium wilfordii Hook. f.). Phytochemistry. 2011, 72: 21-26. 10.1016/j.phytochem.2010.10.015.CrossRefPubMed Law SK, Simmons MP, Techen N, Khan IA, He MF, Shaw PC, But PPH: Molecular analyses of the Chinese herb Leigongteng (Tripterygium wilfordii Hook. f.). Phytochemistry. 2011, 72: 21-26. 10.1016/j.phytochem.2010.10.015.CrossRefPubMed
Metadaten
Titel
Forensically informative nucleotide sequencing (FINS) for the authentication of Chinese medicinal materials
verfasst von
Ming Li
Kalin Yan-Bo Zhang
Paul Pui-Hay But
Pang-Chui Shaw
Publikationsdatum
01.12.2011
Verlag
BioMed Central
Erschienen in
Chinese Medicine / Ausgabe 1/2011
Elektronische ISSN: 1749-8546
DOI
https://doi.org/10.1186/1749-8546-6-42

Weitere Artikel der Ausgabe 1/2011

Chinese Medicine 1/2011 Zur Ausgabe