Frequent detection of Merkel cell polyomavirus DNA in sera of HIV-1-positive patients

MCPyV was detected in 9 of 23 HIV-1-positive sera (39.1%) and 6 of 110 HIV-1-negative sera (5.5%) by real-time PCR (Table 1). The positivity of MCPyV among HIV-positive patients was significantly higher than that among HIV-1-negative patients (P < 0.01, Chi-square test). In MCPyV-positive sera, there was no significant difference in MCPyV copy number between HIV-1-positive (mean = 26.5 copies per μL) and HIV-1-negative patients (mean = 45.1 copies per μL, P = 0.09, Mann-Whitney U-test) (Figure 1). Six MCPyV-positive sera in HIV-1-negative patients were two from congenital immunodeficiency patients, one from a sudden death patient with unknown etiology, and three from myocarditis patients. Dot blots on CD4 and MCPyV copy revealed that CD4 counts in the HIV-1-positive patients were not correlated with MCPyV copy numbers in the serum (R² = 0.034, Figure 2). HPyV6 ST DNA was also detected by real-time PCR in 0 and 2 cases of HIV-1-positive and HIV-1-negative sera, respectively. The two HPyV6 positive HIV-1-negative sera which were taken from autopsy cases of elder patients with respiratory failure were negative for MCPyV. HPyV7 was not detected in any serum sample by real-time PCR.

MCPyV was detected in 22/30 (73%) tissue samples of MCC, 4/19 (21%) of encephalitis, 3/17 (18%) of pneumonia, 8/14 (57%) of myocarditis, and 0/10 (0%) of hepatitis by real-time PCR (Table 2). There was no specific histological difference between MCPyV-positive and negative cases in each group. Eleven MCPyV-positive samples of other group in Table 2 were composed of 6 AIDS-associated Kaposi’s sarcoma, 4 AIDS-associated lymphoma, and one AIDS-associated progressive multifocal leukoencephalopathy cases. Among MCPyV-positive tissues, the mean MCPyV copy number was significantly higher in the MCC tissues (3.219 copy per cell) than in the other tissues (0.075 copy per cell, P = 0.0014, Mann-Whitney U-test, Figure 3). The MCPyV large T antigen was detectable by immunohistochemistry only in the MCC samples (Figure 4). One MCPyV-positive MCC tissue was also positive for HPyV6 ST DNA, but HPyV6 and HPyV7 were not detected in any MCPyV-negative MCC tissues, suggesting no association between MCPyV-negative MCC and HPyV6 or HPyV7 infection. One MCC sample and a tissue sample from a Kaposi’s sarcoma patient were positive for HPyV6 ST DNA by real-time PCR (Table 2). HPyV7 was not detected in any tissue sample.

We carried out nested PCR analysis on two serum and two tissue samples which were positive for HPyV6 by real-time PCR detecting HPyV6 ST DNA. The nested PCR were able to amplify their targets from ten genome copies constantly, and did not cross-react with JCV, BKV, and MCPyV genomes (Figure 5A). Nested PCR analysis revealed that HPyV6 VP2/3 DNA were failed to detect in all these cases, whereas a positive control of HPyV6, a DNA sample extracted from a skin biopsy which was confirmed to be HPyV6-positive, was positive for VP2/3 (Figure 5B). HPyV6 LT DNA was negative in the one serum and one tissue samples, and VP1 was positive only in one MCPyV-positive MCC case by nested PCR.

This study was approved by the institutional review board at the National Institute of Infectious Diseases (Approval No. 273). We used 23 HIV-1-positive and 111 HIV-1-negative sera stored at the National Institute of Infectious Disease. All the HIV-1-positive patients had not received anti-retrovirus therapy at the time of blood collection. Their CD4 counts at the time of blood collection were recorded for analysis. The HIV-1-negative sera were obtained from patients with various diseases including influenza virus infection, myocarditis, encephalitis, hepatitis, malignancies, etc. No MCC patient was included. In addition, formalin-fixed paraffin-embedded (FFPE) or frozen tissue samples from 150 patients with various diseases such as encephalitis, pneumonia, myocarditis, and hepatitis were collected. DNA samples extracted from JCV-positive progressive multifocal leukoencephalopathy and BKV-associated nephropathy were used as JCV and BKV-positive controls, respectively.

DNA was extracted from 50 μL of serum by using the DNeasy Blood & Tissue Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol. DNA from sera was eluted in a final volume of 50 μL of elution buffer. For tissue samples, DNA was extracted from three pieces of 10 μm-thick FFPE sections and 10 mg of frozen tissue samples with the Qiaamp FFPE DNA extraction kit and the DNeasy Tissue Kit (Qiagen), respectively. DNA from FFPE and frozen tissues were eluted in a final volume of 30 μL and 100 μL of elution buffer, respectively.

Real-time PCR was performed using a standard TaqMan® PCR kit protocol (Applied Biosystems, Foster City, CA) on a MX3005P (Stratagene, La Jolla, CA). DNA samples were analyzed for the presence of MCPyV[22], HPyV6 VP1, HPyV6 small T (ST), HPyV7 VP1, and HPyV7 ST genes. The amount of human genomic DNA (as measured by the β-actin gene) in the DNA extracted from each specimen was also determined. Primers and probes for HPyV6 and HPyV7 were designed for the VP1 and ST regions by using Primer Express software (Applied Biosystems) based on the reference sequences of HPyV6 (GenBank accession no. HM011558) and HPyV7 (HM011569). HPyV6-VP1 forward (5^′-CCCTGGCTGTTGTTAATTTGC-3^′) and reverse (5^′-CTGAAGGCTTCCCAAACCAA-3^′) primers were used with the TaqMan probe 5^′-(FAM) TGAAATTCCTGAGGCCCTGTGTGATGAT (TAMRA)-3^′. HPyV6-ST forward (5^′-AAGCACCAGGTGGGTGATGA-3^′) and reverse (5^′-CAACGCCTGAATGTTTTAAAGGA-3^′) primers were used with the TaqMan probe 5^′-(FAM) TTGGTCCCTCAGGGTGGCATTCAA (BHQ1)-3^′. HPyV7-VP1 forward (5^′-AGAAGGTCCAGGCAATAGTGATG-3^′) and reverse (5^′-CTGGGAAATTTGCAGCATTTACT-3^′) primers were used with the TaqMan probe 5^′-(HEX) AGCTAGCCTGCAAGCCCTCAGAAAGC (BHQ1)-3^′. HPyV7-ST forward (5^′-CCAGCATTTGCCCCATAAAA-3^′) and reverse (5^′- AAAGCATAAGAAGAAGGCCAAAGA-3^′) primers were used with the TaqMan probe 5^′-(HEX) AGGCCCCCGGTGGTCTTTAG (BHQ1)-3^′. Primers and probes for MCPyV and β-actin were described previously[22]. PCR amplification was performed in a 20 μL reaction volume by using QuantiTect Multiplex PCR Master Mix (Qiagen), with 0.4 μM of each primer, 0.2 μM of TaqMan probe, and 1 μL of isolated DNA. PCR was carried out at 50°C for 2 min, 95°C for 15 min, and 40 cycles of 94°C for 1 min and 60°C for 1 min. Quantitative results were obtained by generating standard curves for sequence-validated PCR products or plasmids containing HPyV6-VP1, HPyV6-ST, HPyV7-VP1, HPyV7-ST, MCPyV-LT, or the cellular target (β-actin gene). Virus copy number per cell was calculated as previously described, by dividing the virus copy number by half of the β-actin copy number, because each cell contains 2 alleles of β-actin[43]. These real-time PCR amplified at least 10 copies of target gene constantly, and did not cross-react with JCV and BKV in JCV or BKV-positive control samples (data not shown). In addition, HPyV6 and HPyV7 real-time PCR did not amplify any fragment from a plasmid containing a full genome of MCPyV (data not shown).

Nested PCR was performed to detect HPyV6 LT, VP1, and VP2/3 gene. Sequences of outer and inner primers are listed in Table 3. The first round of amplification was performed with 100 ng of extracted DNA and high fidelity Taq DNA polymerase (Roche Diagnostics, Boehringer Mannheim, Germany) in a final volume of 25 μL. After an initial DNA denaturation for 2 min at 94°C, samples were amplified by 35 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec, followed by a final elongation phase of 7 min at 72°C. The second round was performed with 1 μL of first round PCR product in a final volume of 25 μL under the following parameters: 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec for 25 cycles, followed by a final elongation phase of 7 min at 72°C. Five μL of amplification products were loaded onto agarose gels, electrophoresed, stained with bromide and visualized under UV light.

Immunohistochemistry was performed on FFPE samples with the rabbit anti-MCPyV-LT polyclonal antibody as the primary antibody, as described previously[41].