Collection of the cohort and case reports
The hyperlysinemia patients described here (Table
1) were collected over the years and material was sent to a laboratory for metabolic screening and confirmatory testing. In most cases, patients displayed neurological symptoms for which a metabolic cause was suspected or had to be excluded. The studies described in this report have been performed as part of patient care and according to Dutch law do not need additional approval of a medical ethical committee if used for retrospective anonymous evaluation.
Table 1
Biochemical and molecular findings in 8 cases diagnosed with hyperlysinemia
1 | 992 – 1688 | Undetectable | c.194G>A (p.R65Q) | c.1256T>G (p.L419R) |
2 | 787 – 1253 | ND | c.194G>A (p.R65Q) | c.1256T>G (p.L419R) |
3 | 1090 – 1326 | Undetectable | c.194G>A (p.R65Q) | c.194G>A (p.R65Q) |
4 | 868 – 1461 | Undetectable | Deletion of exon 1 (no mRNA) | Deletion of exon 1 (no mRNA) |
5 | 1554 | Decreased | c.460G>A (p.A154T) | c.2076dup (p.P693SfsX10) |
6 | 1054 – 1303 | ND | c.2155A>G (p.T719A) | c.2155A>G (p.T719A) |
7 | 2029 | Undetectable | Deletion of exon 20-24 | Deletion of exon 20-24 |
8 | 602 | Undetectable | Deletion of exon 20-24 | Deletion of exon 20-24 |
Case 1 is the first child of non-consanguineous parents. He presented at age 6 months with psychomotor retardation and failure to thrive with vomiting due to severe gastro oesophageal reflux. In addition, there were craniosynostosis, microcephaly, a slightly dysmorphic face, and early development of spastic diplegia rapidly progressing to tetraparesis. Diagnosis of hyperlysinemia was established following the detection of elevated pipecolic acid. At age 4 years, motor development was severely retarded with inability to sit or stand. At this age, treatment with botulinum toxin was started and continued since then. Under this treatment, the patient learned to stand up and walk single steps with support. His expressive speech development is also largely retarded and he communicates with sign language. The EEG in this patient was normal as was the brain MR imaging at an age of 4 years. He is now 8 years old and severely affected by global retardation, spastic tetraparesis and microcephaly.
Case 2 is the younger brother of case 1 and showed a similar but less severe clinical course. At age 2 years, he walked on tiptoes as the first sign of a cerebral movement disorder. Treatment with botulinum toxin injections was started at the age of 4 years supporting the motor development. Currently at 7 years of age, the patient is able to walk and he can speak in full sentences. As in his older brother, the patient was affected by failure to thrive. Both brothers were treated with a lysine restricted diet, however, without any obvious benefit.
Case 3 is a boy of consanguineous parents (first degree cousins). He had an epileptic event during fever at the age of 6 months and was treated with anti-epileptic drugs for 2 months. From the age of 3 years developmental delay with spastic diplegia and behavioral disturbances became apparent. Magnetic resonance imaging (MRI) of the brain was normal. At the age of 4.5 years there was one single epileptic event without fever. A healthy sister did not have hyperlysinemia.
Case 4 is the third child of healthy consanguineous parents (first degree cousins). In two older healthy siblings hyperlysinemia was excluded. He came to clinical attention at the age of 10 months because of mild psychomotor retardation. Screening for urinary amino acids showed highly elevated lysine (7307 mmol/mol creatinine) in the absence of saccharopinuria. On physical examination, he displayed muscular hypotonia with brisk tendon reflexes. An EEG was normal. The patient was treated for three years with a strict low protein diet but this was relaxed and eventually stopped at age 5 years without obvious disadvantage to the neurological status. Currently at an age of 10 years, cognition is borderline normal with a debatable need for special education such as speech therapy and occupational and physiotherapy. The neurological examination including the muscle tone is normal.
Case 5 is the younger sister of a previously reported affected boy [
11]. Both were diagnosed with epilepsy, intellectual disability and behavioral problems. The third child in this sibship was healthy and had normal lysine levels. The patient came to the attention of a child neurologist at the age of two years because of seizures. Her EEG was abnormal with epileptic changes. A CT at the age of 18 showed widened ventricles. Several seizures were observed during childhood which responded well to standard anti-epileptic medication (valproate, carbamazepine). Her intelligence was low normal (IQ 86), but she was referred to an institution because of behavioral problems.
The patient had recurrent pneumonias as a result of atelectasis of the left lung due to a congenital hypoplasia of the left pulmonary artery. The left lung was surgically removed at the age of five. The pulmonary problems never resolved completely; at the age of 19, following influenza vaccination, she again developed a severe pneumonia and as a consequence of this a chronic polyneuropathy became manifest. Her physical inabilities at this stage necessitated admission to a rehabilitation center. After this episode, she was lost for follow-up.
Case 6 is a boy diagnosed with intellectual and motor disability of unknown cause. His development was impaired in all areas; motor development, language, and behavior. He was hyperactive and restless, but with little regulation. Attention deficit disorder was not excluded. He had strabism, microcephaly, small stigmata, thin eyebrows, a flat philtrum and a flat nose, but no syndrome could be attributed. Prenatal exposure of the child to toxic compounds was suspected. The child has been under the care of the youth welfare service since birth and was placed with foster parents before he was ten months old. It was the intention to let the child attend a kindergarten with special support. Urine lysine values were 2386–3196 mmol/mol creatinine. Saccharopine was noted in urine (11.0 mmol/mol creatinine) and serum (3.5 μmol/L).
Case 7 is a boy of consanguineous parents (first degree relatives). The first child of the parents was a healthy male. The patient was born after an uneventful pregnancy and delivery at 38 weeks of gestation. Birth weight and length were normal, but head circumference was 34 cm (< 5 p). He had no spontaneous breathing after birth and was admitted to the neonatal intensive care unit with seizures, respiratory difficulties, hypotonia, and bradycardia at 2 days of life. Physical examination revealed a prominent hypotonia, mild dehydration, increased deep tendon reflexes, absence of sucking, Moro, and grasping reflexes. He had dysmorphic features such as microcephaly, an underdeveloped antihelix and helix, hypotelorism and a high arched palate. Cranial MRI showed a subacute haemorrhage in the 4th and lateral ventricles, a mild subdural haemorrhage in the occipital lobe and haemorrhages in sinus transversus and sagittalis superior. The patient was diagnosed with hyperlysinemia and started a special diet containing 50 mg/kg/day lysine including 2–25 g/kg/day protein and 140–150 kcal/kg/day energy and was given antiepileptic drugs including phenobarbital. He had feeding and swallowing dysfunction and was fed with a nasogastric tube. Severe spasticity and opisthotonic posturing developed in the follow up period. Unfortunately, the patient did not respond to treatment and no improvement in his signs and symptoms occurred and he died at 6 months of age.
Case 8 was born as the first child of consanguineous parents with a birth weight of 2800 g after an uneventful pregnancy at 38 weeks. His twin died at 3 days of life due to pulmonary hemorrhage. He was the cousin of case 7. Pneumonia and convulsions of generalized tonic type manifested on the second day of life. During the follow up in a local hospital for 2 months he was treated with phenobarbital. At 16 months of age, the patient was referred to the metabolic unit. Physical examination revealed microcephaly, an enlarged right ear, a high palate, psychomotor retardation, increased deep tendon reflexes, and decreased subcutaneous fat tissue. The patient did have head control but could not sit with or without support. A brain MRI was normal. His diet contained protein and calories appropriate for his age and weight. At 4.5 years the boy was spastic and could sit with support for a short time. He is 13 years old now and seizures were controlled with anticonvulsants.
AASS genome sequencing and cDNA analysis
All exons, plus flanking intronic sequences of the
AASS gene (NM_005763), were sequenced after amplification by PCR from genomic DNA. All forward and reverse primers (Sets A to Q, Table
2) were tagged with a –21M13 or M13rev sequence, respectively. PCR fragments were sequenced in two directions using –21M13 and M13rev primers by means of BigDye Terminator Cycle Sequencing (v1.1, Applied Biosystems, Foster City, CA) and analyzed on an Applied Biosystems 3130
xl or 3730
xl DNA analyzer.
Table 2
Primer sets used for AASS mutation analysis
A | [-21M13]-cgattggcagatgagaaggt | 1 | (c.–221-c.–16) |
[M13-Rev]-atctccaccgcatctcacag |
B | [-21M13]-cacttgacatcccagttttcc | 2 | (c.–15-c.210) |
[M13-Rev]-ttcctcagctggagtaagca |
C | [-21M13]-tgttgtgcctttgctacaca | 3 | (c.211-c.387) |
[M13-Rev]-tcccatctgaaaaacaaggtag |
D | [-21M13]-ttgctacctggcgttttctaa | 4 | (c.388-c.472) |
[M13-Rev]-cttgccgcagaaaagagaaa |
E | [-21M13]-catgcagattggagaacgag | 5 & 6 | (c.473-c.687) |
[M13-Rev]-atggctgcccacatcatt |
F | [-21M13]-ggaaggcaagtggagctatg | 7 & 8 | (c.688-c.894) |
[M13-Rev]-tgggcacatgtagacctgaa |
G | [-21M13]-tttcttcggcatgcaataca | 9 | (c.895-c.1043) |
[M13-Rev]-ctgccaagaggtcaagaaaga |
H | [-21M13]-gcagagtcctgaagaatgagc | 10 & 11 | (c.1044-c.1278) |
[M13-Rev]-ccccaagagacaagtaagcag |
Internal rev seq primer cagcaacccatctcacat |
I | [-21M13]-gggcagagttgattgcttgt | 12 & 13 | (c.1279-c.1406) |
[M13-Rev]-gccagccacttagtttggat |
J | [-21M13]-ttgtggaatgcaagattctg | 14 & 15 | (c.1407-c.1655) |
[M13-Rev]-tgatttgtgcaccttctgga |
Internal rev seq primer cagaaacaaagtagtcttc |
K | [-21M13]-gagtgcctgtgtctttttgg | 16 & 17 | (c.1656-c.1875) |
[M13-Rev]-gaacctgggagatggaggtt |
Internal forw seq primer ctgagtggatccatggcattg |
L | [-21M13]-tcaaatggtacatgctttgaaga | 18 | (c.1876-c.2016) |
[M13-Rev]-gggtttgggatcagggagta |
M | [-21M13]-ttctgttgctttctttgttcg | 19 | (c.2017-c.2184) |
[M13-Rev]-caatcaatcataagattcctgaaaaa |
N | [-21M13]-gacaggaaaacctgctaggc | 20 | (c.2185-c.2280) |
[M13-Rev]-gactcccatcactgggtcac |
O | [-21M13]-ttgaggtgtatttgaagttcagtg | 21 & 22 | (c.2281-c.2485) |
[M13-Rev]-acatcttcccattcctgctg |
Internal rev seq primer ctacccacattagagcaacg |
P | [-21M13]-ggcaggaggagatgacagac | 23 | (c.2486-c.2662) |
[M13-Rev]-actcagccaccttggaactg |
Q | [-21M13]-aaaatgcctaggcctccaag | 24 | (c.2663-c.*187) |
[M13-Rev]-gtggcttgcatctcctgttc |
R | 5′-tctccaagggtcttcaccac-3′ | | c.47-c.66 |
5′-agaatgccaccagctttgac-3′ | | c.236-c.217 |
S | 5′-agttcctcaggcagagtcca-3′ | | c.2421-c.2440 |
5′-ggctgaaaagccattgatgt-3′ | | c.2607-c.2588 |
T | 5′-gccttccatcccagtttctt-3′ | | c.–116-c.–97 |
5′-ctgcatctctcaccacagga-3′ | | c.1323-c.1342 |
Internal seq. primer 5′-tgcatttttctcccacacaa-3′ | | c.318-c.337 |
Internal seq. primer 5′-cccaaactggagacctcaga-3′ | | c.755-c.774 |
U | 5′-gaatgctttggagacatgctt-3′ | | c.1237-c.1257 |
5′-ggtgtattgcctgggaagaa-3′ | | c.*23-c.*42 |
Internal seq. primer 5′-ctgcaagctacatcacaccag-3′ | | c.1724-c.1744 |
| Internal seq. primer 5′-tggcatttcttctgctcaca-3′ | | c.2136-c.2155 |
RNA was isolated from fibroblast pellets using Trizol extraction. cDNA was synthesized by using the Superscript II Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR analysis of AASS expression in fibroblasts was performed using the LC480 Sybr Green I Master mix (Roche) and primer sets R and S to amplify the 5
′ and 3
′ part of the AASS cDNA, respectively. In patient 1, 2 and 5 the complete AASS cDNA was amplified and sequenced using primer sets T and U (Table
2).