Background
Obesity is one of the most prevalent metabolic diseases in the world and constitutes a serious threat in both industrialized and developing countries[
1]. It is connected with the genesis or development of various diseases, such as hypertension, cardiac arrhythmia, constipation, headache, steatorrhea, type 2 diabetes mellitus, and cancer[
2,
3]. The process of gaining fat involves increased adipogenesis accompanied by adipocyte differentiation. This differentiation is regulated by a highly organized cascade involving numerous transcription factors[
4]. Among them, peroxisome proliferator-activated receptor γ (PPARγ), CCAAT/enhancer binding protein α (C/EBPα), and sterol regulatory element binding protein 1c (SREBP1c) are the major transcriptional genes involved in adipogenesis[
4,
5].
To target obesity, current pharmacotherapy strategies are grouped into two categories[
6]. The first category is to medicate people with obesity with drugs, including suppressants and anorexics, that can suppress food intake by regulating the central nervous system. The second category involves drugs that inhibit the absorption of specific nutrients in food[
7]. However, these drugs, of which there are two varieties, can have undesirable side effects, such as hypertension, cardiac arrhythmia, constipation, and headache[
8].
Because of the unavoidable side effects of the currently available anti-obesity drugs, the development of herbal medicinal products to treat obesity has become a global focus and there are many studies concerning natural medicines that might have beneficial effects in obese patients. Some natural compounds, plants and formulas, such as berberine, prunetin, aster glehni, and taeumjowi-tang have proven anti-obesity effects[
9‐
12]. As well as these studies, there is a lot of research in progress globally to develop effective and safe natural anti-obesity drugs.
HOX-7 is a newly combined formula for treating obesity, composed of seven herbs (Coicis semen, Nelumbo nucifera, Saliconia herbacea, Polygoni Multiflori Radix, Raphani semen, Piperis Longi Fructus, and Atractylodis Rhizoma). Coicis semen is an adlay seed and was reported to have anti-obesity effects in humans[
13]. Nelumbo nucifera has also been reported to show anti-obesity and hypolipidemic effects and decrese the expression of PPARγ[
14]. Recent research on Saliconia herbacea revealed its antioxidant and anti-proliferative properties[
15]. In addition, Saliconia herbacea has also been reported to have an adipogenesis inhibition effect[
16]. Polygoni Multiflori Radix has been used in the treatment of obesity and hyperlipidemia in East Asian countries for centuries, and a recent study demonstrated its effects in obesity[
17]. Raphani Semen, commonly known as radish seed, is used as a traditional medicine to treat constipation, chronic tracheitis, and hypertension[
18]. Furthermore, Raphani Semen, which has a high linolenic acid content, could have effects that reduce the risk of cardiovascular disease and was revealed to have anti-oxidative activity[
19]. Piperis Longi Fructus was verified for its anti-diabetic and anti-hyperlipidemic effects[
20]. Atractylodis Rhizoma was discovered to have an anti-inflammatory effect[
21] and anti-obesity effect in 3T3-L1 cells and animal model[
22]. Based on these studies, we examined the anti-obesity effects of HOX-7 in high-fat-diet (HFD)-induced obese mice.
Methods
Reagents
Coicis semen, Nelumbo nucifera, Saliconia herbacea, Polygoni Multiflori Radix, Raphani Semen, Piperis Longi Fructus, and Atractylodis Rhizoma were purchased from Omniherb Co. Ltd (Daegu, Republic of Korea). The normal diet (ND) and HFD were obtained from Research Diets (New Brunswick, NJ, USA). PPARγ, C/EBPα, SREBP1c, and β-actin monoclonal antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).
HOX-7 is composed of Coicis semen (260 g), Nelumbo nucifera (416 g), Saliconia herbacea (91 g), Polygoni Multiflori Radix (130 g), Raphani Semen (143 g), Piperis Longi Fructus (52 g), and Atractylodis Rhizoma (208 g). The dried herbs were refluxed with 70% ethanol for 3 h at 80°C. The extract was filtered and refluxed again under the same conditions. After filtration, the extract was completely dried using a freeze-dryer to obtain a solid ethanol extract. The yield was 17% (17 g per 100 g of total materials)
Animal experiments
Male C57BL/6 J mice (3 – 4 weeks) were purchased from Daehan Biolink (DaeJeon, Republic of Korea). Mice were maintained (4 mice/cage) under a 12 h light/dark cycle, at 22 ± 2°C, and a relative humidity of 55 ± 10%, under conditions that followed the National Institutes of Health guidelines and were approved by the Ethical Committee for Animal Care and the Use of Laboratory Animals, Sangji University (reg. no. 2014–3). Mice were given the diet and water ad libitum. After 1 week of acclimation, 32 mice were divided randomly and equally into 4 groups (n = 8 per group); the ND group, HFD group, and HFD with HOX-7 at 100 or 200 mg/kg (H100 or H200 respectively). ND group were fed a commercial standard chow diet and HFD group were fed the HFD for 12 weeks. HOX-7 was dissolved in DW and, orally and daily administrated for 12 weeks with HFD. Food intake and body weight were recorded every week. At the end of the experimental period, the mice were fasted overnight. The next day, animals were anesthetized with zoletil (Virbac, Carros Cedex, France) and their visceral fat pads were excised, weighed immediately, and stored at -80°C.
Histological analysis
Representative epididymal adipose tissues from each group were fixed with 4% paraform aldehyde and embedded in paraffin. Sections of adipose tissue were cut and stained with hematoxylin and eosin (H&E) for analysis of adipocyte surface area and diameter. The images of the stained slides were observed using a SZX10 microscope (Olympus, Seoul, Republic of Korea) and photographed. Digital images were taken from each slide (5 per group), and adipocyte diameters were measured using Image J software.
Quantitative Real-time polymerase chain reaction (PCR) analysis
Total RNA was isolated from the homogenized epididymal adipose tissues using TRIzol Reagent (Life Technologies, NY, USA), according to the manufacturer’s instructions. The total RNA was then quantified using an Epoch micro-volume spectrophotometer system (BioTek Instruments Inc, VT, USA). Synthesis of cDNA was carried out with quantified equal amounts of total RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, CA, USA). The program was set for 60 min of initiation at 45°C, followed by 5 min of incubation at 95°C, and then maintained at 4°C. A Step One Plus® Real-time PCR system with an SYBR Green Master Mix (Applied Biosystems) and primers (Bioneer, Seoul, Republic of Korea) were used to perform a real-time PCR. All primer sequences are shown in Table
1. The steps were as follows: 10 min at 95°C, 40 cycles of 15 s at 95°C, 45 s at 58°C, a final melting curve of 15 s at 95°C, 1 min at 60°C, and 15 s at 95°C. Fold changes of gene expression were calculated using the comparative threshold cycle (Ct) method (Applied Biosystems). Each value was normalized for the initial control, glyceraldehydes-3-phosphate dehydrogenase (GAPDH).
PPARγ
| TTCGGAATCAGCTCTGTGGA | CCATTGGGTCAGCTCTTGTG |
C/EBPα
| AAACAACGCAACGTGGAGAC | ACCAAGGAGCTCTCAGGCAG |
SREBP1c
| ATCGCAAACAAGCTGACCTG | AGATCCAGGTTTGAGGTGGG |
LXR
| TCCTACACGAGGATCAAGCG | AGTCGCAATGCAAAGACCTG |
LPL
| AGGACCCCTGAAGACACAGC | TTGGGCACCCAACTCTCATA |
aP2
| AGCATCATAACCCTAGATGG | GAAGTCACGCCTTTCATAAC |
Western blot analysis
The epididymal tissues dissected from the experimental animals were homogenized in a commercial lysis buffer PRO-PREP® (Intron Biotechnology Inc., Gyeongi-do, Republic of Korea) and centrifuged at 13000 rpm (4°C) for 5 min. Subsequently, the supernatant was transferred to a fresh 1.5 ml tube. The quantification of the protein was carried out using Bio-Rad protein assay reagent. Each protein sample was loaded on Tris-glycine SDS-polyacrylamide gels, followed by transfer to polyvinylidene difluoride (PVDF) membranes (Millipore, MA, USA). The membranes were then blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) at room temperature for 1 h and incubated at 4°C overnight with 1:1000 dilutions of the primary antibodies. The following day, the membranes were washed with TTBS 3 times for 10 min each and reacted with 1:2500 dilutions of the secondary antibodies for 2 h at room temperature. After reaction, immunoreactive protein bands were visualized using enhanced chemiluminescence (Santa Cruz Biotechnology). Bio-rad Quantity One® Software was used for the densitometric analysis.
Statistical analysis
All the values reported have been expressed as the mean ± SE. Data were analyzed using one-way analysis of variance (ANOVA) with Dunnett’s test. Statistical analysis was performed using GraphPad Prism (version 5) and P < 0.05 was accepted as statistically significant.
Discussion
Globally, obesity is the most prevalent health problem affecting all age groups and numerous studies have focused on developing natural anti-obesity herbal medicines[
23]. In line with these worldwide trends in anti-obesity research, we investigated the anti-obesity effect of HOX-7 and showed that it significantly reduced body and visceral fat weight in HFD-induced obese mouse model. In addition, we found that HOX-7 suppressed adipogenesis in epididymal adipose tissues.
Obesity is the result of a complicated process regulated by a number of adipogenic transcription factors[
24]. PPARγ is a ligand-activated transcriptional factor that has a key role in adipocyte differentiation[
25]. It is mostly expressed in adipose tissues and required for differentiation of preadipocytes to mature adipocytes[
25]. PPARγ activity is evoked when adipocyte differentiation starts, and it transfers hormonal stimulation to its target genes, one of which is C/EBPα. When C/EBPα responds to a PPARγ stimulus, it cooperates with PPARγ to achieve adipocyte differentiation. Although the initial expression of C/EBPα is induced by the PPARγ signal, it functions to further strengthen PPARγ activities by stimulating many specific genes required for adipocyte differentiation[
26]. Additionally, SREBP1c is required for optimal adipocyte differentiation. It regulates the transcription of many genes related to lipid, fatty acid, and glucose metabolism[
27]. Interestingly, SREBP1c participates in the production of an endogenous PPARγ ligand that reinforces PPARγ activity, which means that PPARγ might be a target gene of SREBP1c[
28]. Thus, PPARγ, C/EBPα, and SREBP1c are believed to be crucial to, and perform a leading role in, the progression of adipocyte differentiation. In this study, we examined the effect of HOX-7 on the expression of various adipogenesis-related genes and found that HOX-7 inhibited the expression of PPARγ, C/EBPα, and SREBP1c in epididymal adipose tissues. These results suggest that HOX-7 exerts anti-obesity effects through the regulation of adipogenic transcription factors.
The transcription factors aP2 and LPL are downstream targets of PPARγ and C/EBPα[
29]. Therefore, the gene expression of aP2 and LPL indicates the transcriptional activities of PPARγ and C/EBPα. We found that HOX-7 suppressed the gene expression of aP2 and LPL, thus further confirming the inhibitory effect of HOX-7 on the expression of PPARγ and C/EBPα. LXR is primarily considered a regulator of cholesterol and fatty acid metabolism in liver tissue and macrophages[
30]. LXR similarly stimulates adipocyte differentiation through the induction of PPARγ expression[
31]. LXR forms a positive relationship with PPARγ and mediates adipogenesis by affecting adipogenic transcriptional factors. In this study, HOX-7 also attenuated the expression of LXR at the mRNA level.
Conclusions
In summary, HOX-7 significantly suppressed body and visceral fat weight in an HFD-induced obese mouse model. HOX-7 inhibited the expression of adipogenesis-related genes, such as PPARγ, C/EBPα, and SREBP1c. Our findings suggest that HOX-7 could represent a novel natural anti-obesity herbal medicine.
Acknowledgements
This work was supported by Seoul R&BD program (Grant number, RI120003), and Sangji University Research Fund, 2013. We would like to thank Korea institute of science and technology (KIST) and CTCBIO Inc., Republic of Korea, for kind contribution to the chemical and medicinal experiments.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
All experimental work was done by HL, JS, and JJ. HL, HR, YK, and HA wrote the draft of manuscript, tabulated the data, and collected some references. SK, CO, KY made and supplied HOX-7 and other reagents. All authors participated in the design of the study data, read and approved the final manuscript.