Background
Esophageal carcinoma remains one of the most prevalent and aggressive cancers, ranking as the sixth most common cause of cancer-related deaths worldwide, and with a particularly high annual incidence rate in China [
1]. Esophageal carcinoma is widely considered to have two clinical subtypes, namely esophageal adenocarcinoma and esophageal squamous cell carcinoma (ESCC) [
2]. ESCC represents the more sinister of the subtypes, owing to its especially poor outcome and prognosis, which is largely due to its late diagnosis [
3,
4]. Although commendable improvements have been achieved in diagnosis, surgical techniques, and post-surgical management, ESCC patients are often afflicted by ESCC recurrence [
5]. Mesenchymal stromal cells (MSCs) are crucial components of the tumor microenvironment, and MSCs-derived beta-2-microglobulin is involved in the processes of epithelial mesenchymal transition, migration and tumor growth in ESCC [
6]. Human umbilical cord mesenchymal stem cells (hUCMSCs) can secrete exosomes during various biological processes and hUCMSCs-derived exosomes (hUCMSCs-exos) have emerged as potential therapeutic agents [
7].
As extracellular vesicles secreted by various cell types, exosomes, can serve as noninvasive biomarkers for early diagnosis of various types of cancers, and hold promise as therapeutic agents [
8]. hUCMSCs-exo can alleviate inflammation and facilitate the functional recovery of mice with spinal cord injury [
9]. More importantly, hUCMSCs-exo represses the progression of pancreatic ductal adenocarcinoma by delivery of exogenously loaded miR-145-5p [
10]. Numerous microRNAs (miRNAs or miRs), including miR-375, have been highlighted as promising diagnostic and prognostic biomarkers for ESCC patients [
11‐
13]. Downregulation of miR-375 is a frequent observation in ESCC, which correlates with poor prognosis, low survival rate, and tumor metastasis [
14,
15]. Moreover, exosomes secreted from cells might deliver therapeutic miRs to cancer cells and neighboring cells. The exosomal miRs play a fundamental role in the development of various human diseases including cancers [
16]. For example, exosomal miR-21 has been proposed as a promising target for experimental ESCC treatment [
17]. In this study, our interrogation of bioinformatics data bases predicted miR-375 to target enabled homolog (ENAH). Commonly referred to as Mena, ENAH is a member of the Ena/vasodilator-stimulated phosphoprotein group and consists of actin-related proteins that play different roles in various cells [
18]. Additionally, ENAH is highly expressed in gastric cancer and apparently enables its development, highlighting its potential as a prognostic marker for gastric cancer patients [
19]. Based on the aforementioned exploration of literature, we hypothesized that exosomal miR-375 contributes to the development of ESCC by regulating ENAH expression. Hence, we undertook the present study to determine the underlying mechanisms of miR-375 delivered via hUCMSCs-exo in ESCC using in vitro and in vivo assays.
Materials and methods
Ethics statement
The study was approved by the Ethics Committee and Experimental Animal Ethics Committee of the First Affiliated Hospital of Zhengzhou University and performed in strict accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants or their relatives prior to enrollment. Animal experiments were conducted following the recommendations in the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health. Extensive efforts were made to minimize animal usage and discomfort during experimentation.
Tissue collection
A total of 50 ESCC patients aged 44–79 years (mean age of 62.02 ± 9.49 years) were recruited from the First Affiliated Hospital of Zhengzhou University between May 2017 and October 2018. Among them, 25 patients were diagnosed with stage I ESCC, 17 with stage II ESCC, and 8 with stage IIIa ESCC. All patients had undergone surgical resection of their respective tumors prior to initiation of chemotherapy. Both ESCC tissues and adjacent normal tissues were collected during surgery and stored at − 80 °C. All patients were pathologically diagnosed with ESCC and had not received radiotherapy or chemotherapy prior to surgery [
20]. Patients who died during follow-up due to conditions unrelated to ESCC were excluded from the study.
Cell culture
ESCC cell lines (KYSE70, ECA109, and EC9706) as well as the human normal esophageal epithelial cell line HEEC were purchased from the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China). The cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) at 37 °C with 5% CO
2. The medium was changed every 2–3 days. Upon reaching 80% confluence, the cells were treated with trypsin and passaged. The cells at the logarithmic growth phase were collected for subsequent experimentation [
20].
Cell treatment
Cells at the logarithmic growth phase were detached with trypsin to prepare a single cell suspension, which was seeded into a 6-well plate. When cell confluence reached approximately 60%, miR-375 mimic, miR-375 inhibitor, plasmids overexpressing ENAH, small interfering RNA (siRNA)-ENAH as well as plasmids as negative control (NC) (NC-mimic, NC-inhibitor, ENAH-NC and siRNA-NC) were delivered into the ESCC cells and hUCMSCs alone or collectively as per the instructions of the Lipofectamine 2000 reagent (11668–019, Invitrogen, New York, California, USA). The aforementioned mimics and inhibitors were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). siRNA-ENAH#1 (sense 5′-GGUCCUAUGAUUCAUUACATT-3′; antisense 5′-UGUAAUGAAUCAUAGGACCTT-3′), siRNAENAH#2: (sense 5′-GCGAGAAAGAAUGGAAAGATT-3′; antisense 5′- UCUUUCCAUUCUUUCUCGCTT-3′) and siRNA-NC (sense 5′-UUCUCCGAACGUGUCACGUTT-3′; antisense 5′-ACGUGACACGUUCGGAGAATT-3′) were synthesized by Guangzhou RiboBio Co., Ltd. (Guangdong, China). The eukaryotic expression plasmid containing the full length of human ENAH cDNA, pDC316-mCMV-EGFP, was purchased from Guangzhou Land Biology Company (Guangdong, China) with the empty vector applied as the ENAH-NC. A total of 100 pmol of each type of plasmid as well as 5 μL of lipofectamine 2000 were separately diluted in 250 μL Opti-minimum essential medium (MEM) and subsequently fully mixed together in the 6-well plate for transfection. Two days later, the medium was renewed with RPMI-1640 complete medium for further experiments. After 24 h of transfection, reverse transcription quantitative polymerase chain reaction (RT-qPCR) was conducted in order to determine the mRNA level. After 48 h of transfection, western blot analysis was conducted to determine the protein level.
Dual-luciferase reporter gene assay
Firefly luciferase reporter vector carrying wild type (WT) ENAH-3’untranslated region (UTR) (PGLO-ENAH-WT) and vector expressing mutant type ENAH sequence with mutant (MUT) miR-375 binding site (PGLO-ENAH-MUT) were purchased from Guangzhou Land Biology Company (Guangdong, China). Renilla luciferase plasmid pRL-TK was regarded as the positive control. The aforementioned recombinant vectors PGLO-ENAH-WT and PGLO-ENAH-MUT were co-transfected with miR-375 mimic and NC-mimic in human embryonic kidney (HEK)-293 T cells after the cells had reached 70–80% confluence. The cells were seeded into a 12-well plate, after which the transfection process was performed using the ratio between firefly luciferase reporter vector: mimic: pRL-TK = 0.5 μg: 50 nM: 0.1 μg. After 24 h, the cells were lysed and the luciferase activity was detected using the Dual-Luciferase® Reporter Assay System (E1910, Promega, Madison, WI, USA) for firefly and renilla luciferases, whereupon the relative luciferase activity was expressed as the ratio of firefly luciferase activity to renilla luciferase activity.
5-ethynyl-2′-deoxyuridine (EdU) staining
ESCC cells at the logarithmic growth phase were inoculated into a 96-well plate at a density of 4 × 104 cells/well in triplicates. After 24 h of culture, the cells were exposed to various treatments. After 48 h of treatment, the cells were labeled with EdU, incubated in EdU medium at 100 μL/well for 2 h. The cells were subsequently incubated with 100 μL/well cell fixative, 2 mg/mL glycine, and 100 μL/well penetrant (phosphate-buffered saline [PBS] containing 0.5% Triton X-100). The cells were stained with 1 × Apollo reaction solution and 1 × Hoechst 33342 reaction solution (100 μL/well), followed by incubation with anti-fluorescence quenching blocking solution (100 μL/well). Images were captured under a microscope for counting the number of EdU-stained cells. The cells with a red stained nucleus were regarded as positive cells. The number of positive and negative cells was determined in three randomly selected visual fields under a microscope, and the EdU staining rate (%) was calculated as the number of positive cells / (number of positive cells + number of negative cells) × 100%.
Following a 48 h period of transfection, the ESCC cells (100 cells/well) were seeded into ultralow-adhesion 96-well plates, which had previously been coated with 10 g/L poly 2-hydroxyethylmethacrylate (HEMA) solution dissolved in absolute ethanol and air-dried for 24 h. The cells were cultured at 37 °C with 5% CO
2 in serum-free tumor stem cell medium supplemented with Dulbecco’s modified Eagle’s medium/Ham’s F-12 medium (DMEM/F12), B27 (1:50), 20 ng/mL epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), 2 mM
L-glutamine, 0.4% bovine serum albumin (BSA), 5 μg/mL insulin, 1% knockout serum replacement and 0.8% methyl cellulose. The culture medium was changed at regular 48 h intervals. Images of tumorsphere formed after ten days were obtained under an optical microscope. The number of tumorspheres of diameter exceeding 75 μm in diameter was counted to determine the sphere formation efficiency (SFE): SFE = number of spheres/total number of cells in each well [
21].
Flow cytometry
The ESCC cells were collected for flow cytometry which was performed in accordance with the instructions of the Annexin V-fluorescein isothiocyanate/propidium iodide (FITC/PI) detection kit (MA0220, Dalian Meilun Biotech Co., Ltd. Dalian, China). Cells at a concentration of 2–5 × 105 cell/mL were centrifuged at 500 g for 5 min, and resuspended in 195 μL binding buffer. The cells were subsequently incubated with 5 μL Annexin V-FITC and 10 μL PI (20 μg/mL) at room temperature in the dark, followed by flow cytometric analysis.
Transwell assay
After 48 h of transfection, the ESCC cells were starved in serum-free medium for 24 h and then trypsinized. Next, the cells were resuspended in serum-free RPMI-1640 medium containing 10 g/L BSA, with the cell density adjusted to 3 × 104 cell/mL. Cell invasion was detected by Transwell assay. Matrigel (YB356234, Shanghai Yu Bo Biotech Co., Ltd., Shanghai, China) was thawed at 4 °C overnight, and 200 μL portions were diluted with 200 μL serum-free medium. Matrigel (50 μL) was added into the apical chamber of the Transwell plates and incubated for 2–3 h until the substance had hardened. The ESCC cells were subsequently trypsinized and resuspended in RPMI-1640 medium, with the cell density adjusted to 1 × 105 cell/mL. Next, 200 μL portions of cell suspension was added into the Matrigel-coated apical chamber of the Transwell plates, and 800 μL culture medium containing 20% FBS was added to the basolateral chamber. After incubation at 37 °C for 20–24 h, the Transwell plate was rinsed with 4% paraformaldehyde for 10 min. After staining of the fixed cells with 0.1% crystal violet, the chambers were allowed to settle at room temperature for 30 min. The cells on the upper surface were then carefully wiped off with a cotton ball. The cells in the chamber were photographed under an inverted microscope, and counted in a minimum of four randomly selected visual fields. The cells were incubated in non-Matrigel-coated chamber for 16 h for cell migration detection.
hUCMSC isolation and identification
Fresh human umbilical cords were obtained from three parturient women at-term (aged 25–27 years) after Cesarean section at the First Affiliated Hospital of Zhengzhou University. hUCMSCs were collected for primary culture in accordance with the standard methods, stated below in brief [
22]. The umbilical cord was rinsed with 75% ethanol and then rinsed in DMEM supplemented with 1% glutamine, 10% FBS (Thermo Fisher Scientific, Waltham, MA, USA), 100 μg/mL streptomycin and penicillin (Thermo Fisher Scientific, Waltham, MA, USA) After removal of excess blood, the umbilical cord was sliced into small pieces (3–5 mm) and incubated at 37 °C under 5% CO
2. Upon reaching 80 to 90% confluence, the cells were trypsinized for passage. The hUCMSCs that were sub-cultured fewer than 5 times were used for subsequent experiments. The morphological cell changes were evaluated under an optical microscope (Olympus Corporation, Tokyo, Japan). The differentiation of the hUCMSCs was induced for four weeks using commercially available MSC osteogenic, chondrogenic and adipogenic differentiation kits (Cyagen, Silicon Valley, CA, USA), respectively. Next, the hUCMSCs were stained to evaluate the osteogenic, chondrogenic and adipogenic differentiation abilities based on the manufacturer’s instructions. Images were then captured using a microscope (CK40, Olympus Corporation, Tokyo, Japan).
Flow cytometry was employed to analyze the immunophenotypic characteristics of the hUCMSCs. In brief, hUCMSCs were treated with trypsin for 2–4 min, washed with calcium- and magnesium-free PBS, after which they were blocked using 10% normal goat serum to ensure low non-specific binding. The cells were then incubated with FITC-labeled antibodies against cluster of differentiation (CD)44 (338803), CD73 (344015), CD90 (328107), CD105 (323203), CD14 (367115), CD19 (392507), CD34 (343603), CD45 (368507), CD11b (301329), HLA-DR (307603) and FITC-labeled isotype control immunoglobulin G (IgG) (402006) (1:100, BioLegend, San Diego, CA, USA) for 30 min, resuspended in 10% normal goat serum and analyzed using a CyAn ADP Analyzer (Beckman Coulter, Brea, CA, USA).
Exosome extraction and identification
After 72 h of culture in FBS-free medium, the hUCMSCs were centrifuged at 1200×g and 4 °C for 25 min to ensure removal of cell debris and dead cells, followed by filtration through a 0.2-mm filter. The resulting solution was centrifuged at 120,000×g and 4 °C for 2.5 h and centrifuged again at 120000 g at 4 °C for 2 h. The collected exosomes were resuspended in PBS and extracted for subsequent use.
To determine the characteristics of exosomes, the respective levels of the specific surface markers heat shock protein 70 (HSP70), CD63, and CD9 were measured by western blot analysis. Exosome size was determined by Zetasizer Nano ZS (Malvern Instruments, Malvern, UK). The exosomes were then allowed to settle on copper grids coated with Forvar and carbon. Copper grids were immersed in 2% phosphotungstic acid for 1 min. The morphology of exosomes was analyzed under a transmission electron microscope (TEM) (Tecnai Spirit; FEI, Hillsboro Oregon, USA) [
22].
Fluorescent labeling and transfer of exosomes
Carboxyfluorescein succinimidyl ester (CFSE) dye was diluted at a ratio of 1:1000 and subsequently mixed with 20 μg portions of exosomes secreted by hUCMSCs. The mixture was allowed to stand at 37 °C for 15 min and finally centrifuged at 100,000×g for 70 min. CFSE-traced exosomes were co-cultured with ESCC cells for 12, 24, or 48 h, whereupon the exosomes internalized by ESCC cells were visualized under a fluorescence microscope.
To determine the transfer of exosomal miR-375, hUCMSCs were transfected with Cy3-labeled miR-375 mimic (GenePharma Co., Ltd., Shanghai, China). The hUCMSCs expressing Cy3-miR-375 were then co-cultured with ESCC cells for 48 h using a 24-well Transwell chamber. Next, the ESCC cells were stained with FITC-Phalloidin (YEASEN Biotech, Shanghai, China) and the uptake of Cy3-miR-375 by ESCC cells was visualized under a fluorescence microscope.
Co-culture of hUCMSCs-exo and ESCC cells
Exosomes were extracted from hUCMSCs that had been previously transfected with NC-mimic, miR-375 mimic, NC-inhibitor, or miR-375 inhibitor. The ESCC cells were then seeded into a 24-well plate and, upon reaching 60% confluence, hUCMSCs-exo and ESCC cells were then co-cultured for 48 h for subsequent experiments.
RT-qPCR
Total RNA was extracted from tissues or cells based on the instructions of the TRIzol reagent (15596–018, Beijing Solarbio Science & Technology Co. Ltd., Beijing, China). The primers (Table
2) used in the study were synthesized by Takara Biotechnology Ltd. (Dalian, China). Reverse transcription was performed in accordance with the instructions of the one-step miRNA reverse transcription kits (D1801, Harbin HaiGene, Harbin, China) and complementary DNA (cDNA) reverse transcription kits (K1622, Beijing Yaanda Biotechnology Co., Ltd., Beijing, China). Fluorescence quantitative PCR was performed using the fluorescence quantitative PCR system (ViiA7, Sun Yat-sen University Daan Gene Co., Ltd., UK). Relative transcription level of target genes was calculated based on the 2
-ΔΔCt method with U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) regarded as the internal controls [
23].
Table 2
Primer sequence for reverse transcription quantitative polymerase chain reaction
miR-375 | F: AGCCGTTTGTTCGTTCGGCT |
R: GTGCAGGGTCCGAGGT |
ENAH | F: TCAAGGGTAAGGGAAACTGG |
R: TGGCTCACAAGTGGTCCTCC |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT |
GAPDH | F: CTCCTCCTGTTCGACAGTCAGC |
R: CCCAATACGACCAAATCCGTT |
Western blot analysis
Total proteins were extracted from tissues or cells using radio-immunoprecipitation assay lysis buffer (R0010, Beijing SolarBio Science & Technology Co. Ltd., Beijing, China). After quantification and separation via polyacrylamide gel electrophoresis, the proteins were transferred onto a polyvinylidene fluoride membrane. The membrane was blocked using 5% BSA at room temperature for 1 h and incubated at 4 °C overnight with the primary antibodies against ENAH (ab124685, 1:5000), E-cadherin (ab15148, 1:500), N-cadherin (ab18203, 1:1000), Zinc finger protein SNAI 1 (Snail; ab53519, 1:1000), B-cell lymphoma 2 (Bcl-2) (ab182858, 1:2000), B-cell lymphoma extra-large (Bcl-xl) (ab32370, 1:1000), Bcl-2-associated X protein (Bax) (ab32503, 1:5000), CD133 (ab19898, 1:1000), Nanog (ab80892, 1:1000), octamer-4 (OCT-4) (ab134218, 1:1000), CD63 (ab216130, 1:500), HSP70 (ab79852, 1:10000), CD63 (ab79559, 1:1000), Cainexin (ab22595, 1:1000) and GAPDH (ab9485, 1:2500). The membrane was incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (ab205718, 1:20000) at room temperature for 1 h and then developed. All the aforementioned antibodies were purchased from Abcam, Inc. (Cambridge, UK). Protein quantification was performed using ImageJ 1.48u software (National Institutes of Health, Bethesda, Maryland, USA) with the relative protein expression was presented as a gray intensity ratio normalized to that of GAPDH.
Hematoxylin-eosin (HE) staining
The transplanted tumor tissues were extracted, fixed with 4% paraformaldehyde for 48 h at 4 °C, and then stored in 0.02% sodium azide solution. Next, the tissues were dehydrated in an ascending series of alcohol (70, 80, and 95%, absolute ethanol, iso-butanol and finally n-butanol), paraffin-embedded and cut into sections. The paraffin sections were dewaxed with xylene for 5 min, rehydrated with gradient ethanol (100, 95, 90, 80 and 70%), and stained with hematoxylin (H8070-5 g, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) for 25–30 min. After that, the sections were differentiated with 1% hydrochloric acid ethanol for 15–30 s, and washed with water for 10–15 min until turning sky blue. Then the sections were stained for 2 min with eosin solution (PT001, Shanghai Bogoo Biological Technology Co., Ltd., Shanghai, China), followed by gradient ethanol dehydration. The sections were dewaxed twice with xylene, 1 min for each, blocked with neutral gum, dried at room temperature and labeled. Finally, the sections were observed under an optical microscope (DMM-300D, Shanghai Caikon Optical Instrument Co. Ltd., Shanghai, China) to analyze the morphological changes of transplanted tumor cells [
24].
Immunohistochemistry
The paraffin-embedded tumor tissues were deparaffinized, and dehydrated using gradient alcohol. The tissues were then washed with running water, H
2O
2 containing 3% methanol, distilled water, and 0.1 M PBS, followed by antigen retrieval in water bath. Goat serum blocking solution (C-0005, Shanghai Haoran Bio Technologies Co., Ltd., Shanghai, China) was added at room temperature and incubated for 20 min. The tissues were subsequently incubated with primary mouse antibody against ENAH (ab124685, 1:500, Abcam), Ki-67 (ab238020, 1:500, Abcam), E-cadherin (ab231303, 1:100, Abcam), and rabbit antibody against Bcl-2 (ab196495, 1:200, Abcam) at 4 °C overnight as well as the secondary goat anti-mouse IgG (ab6785, 1:1000, Abcam) or goat anti-rabbit IgG (ab6721, 1:1000, Abcam) at 37 °C for 20 min. After incubation with HRP-labeled streptavidin protein working solution (0343-10,000 U, Imubio™ Co., Ltd., Beijing, China) at 37 °C for 20 min, the tissues were rinsed with 0.1 M PBS and developed using diaminobenzidine (ST033, Guangzhou Weijia Technology Co., Ltd., Guangzhou, China). The tissues were then counterstained with hematoxylin (PT001, Shanghai Bogoo Biotechnology Co., Ltd., Shanghai, China) and 1% ammonia. The tissues were dehydrated using gradient alcohol and cleared using xylene. After mounting with neutral balsam, the cells were counted under a microscope in five randomly selected high-power visual fields from each section (100 cells/section). The samples were considered negatively stained when the percentage of positive cells was less than 10%, positively stained if the percentage of positive cells was between 10 and 50%, and strongly positive when the percentage of positive cells exceeded 50% [
25].
Subcutaneous xenograft tumor model in nude mice
A total of 60 specific pathogen-free female BALB/c nude mice aged five weeks and weighing 16–18 g were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The mice were subcutaneously injected with KYSE70 cells (5 × 106 cells/mL) or EC9706 cells (5 × 106 cells/mL) to establish a xenograft tumor model. Next, 250 μL serum-free Opti-MEM was used to dilute 100 pmol miR-375 agomir, and 5 μL lipofectamine 2000, respectively. The aforementioned diluents were fully mixed, allowed to stand for 20 min, and then incubated with ESCC cells in a 6-well plate. After 12 h of incubation, the culture medium was renewed for an additional 48 h period of culture. Next, the exosomes were extracted from miR-375 agomir-transfected hUCMSCs and NC-agomir-transfected hUCMSCs, namely exo-miR-375 agomir or exo-NC-agomir respectively. At the 5th, 10th, 15th, 20th, and 25th day, the nude mice were administered with normal saline via tail vein injection, exo-miR-375 agomir, or exo-NC-agomir. Tumor volume (V) was determined based on the following formula: V = A (maximum diameter) × B2 (vertical diameter)/2 (mm3). The mice were euthanized at day 28 and the xenograft tumors were resected and weighed. RNA and proteins were extracted from the tumors for RT-qPCR and western blot analysis. The tumor tissues were paraffin-embedded and sliced in accordance with the standard methods for histopathological analysis.
Statistical analysis
All data were analyzed using SPSS 21.0 software (IBM Corp. Armonk, NY, USA). Data were expressed as mean ± standard deviation. Data obeying normal distribution and homogeneity of variance between two groups were compared using unpaired t-test, while comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s test. The Kolmogorov-Smirnov method was applied to evaluate the normal distribution of data. Comparisons of cell proliferation at different time points were analyzed using repeated measures ANOVA. Differences were considered significant when p < 0.05.
Discussion
Despite recent advancement in ESCC therapeutic approaches that have delivered improved patient outcomes, ESCC patients still suffer from poor five-year survival rate [
26]. This highlights the importance of developing novel therapeutic targets for treating this disease. Recently, exosomal miRs exert functional effects affecting various cancer hallmarks, highlighting their potential as non-invasive therapeutic targets for cancer therapy [
27]. In the current study, we found that miR-375 delivered by exosomes from hUCMSCs suppressed the initiation and progression of ESCC by downregulating ENAH.
In the first part of the study, we illustrated that miR-375 was poorly expressed in ESCC. These results were consistent with the findings of a previous study reporting reduced expression of miR-375 both in ESCC tissues and serum samples, which was correlated with a low survival rate in ESCC patients [
28]. Moreover, miR-375 downregulation has been reported to be a promising prognostic biomarker for ESCC patients, and miR-375 could inhibit lymphatic vessel invasion of ESCC cells [
29]. In contrast to miR-375, ENAH was found to be highly expressed in ESCC. A prior study concluded that ENAH was expressed at high levels in gastric cancer, while the upregulation of ENAH aggravated the proliferation and migration of gastric cancer in vitro and in vivo [
30], which was consistent with the results of our study. Likewise, upregulated ENAH plays a tumor-promoting role in hepatocellular carcinoma [
31]. These results together provide strong evidence that upregulated ENAH performs an oncogenic role in multiple types of cancers including ESCC. Additionally, ENAH has been verified as a target of miR-495 and is associated with adipose cell differentiation in MSCs [
32]. A previous study demonstrated that downregulated ENAH suppressed proliferation and migration of GC cells [
33]. Moreover, ENAH depletion was previously reported to suppressed migration, invasion and metastasis in hepatocellular carcinoma [
34]. Likewise, ENAH deficiency inhibited cell invasion, and metastasis, thus inhibiting the progression of breast cancer [
18]. Therefore, results of the current study add to the evidence that ENAH is involved in the proliferation, migration, and invasion of ESCC in addition to other types of cancers.
Previous work concurs in showing that miR-375 suppresses the proliferation, migration, and invasion of cancer cells. For example, Hu et al. showed that restoration of miR-375 expression resulted in the suppression of cell invasion and proliferation while promoting cell cycle arrest [
35]. Another study showed that miR-375 overexpression suppressed migration and invasion of ESCC cells [
36]. Moreover, miR-375 directly targets short hox gene 2 (SHOX2), which further inhibits the metastasis and invasion of ESCC cells. Thus, miR-375/SHOX2 was proposed as a promising future therapeutic target for ESCC treatment [
20]. The aforementioned findings are consistent with present findings that miR-375 negatively targeted ENAH to suppress ESCC cell proliferation, migration, and invasion.
Another notable finding of the present study was that miR-375 delivered via exosomes could inhibit the development of ESCC. Various types of cells (including cancer cells) are capable of secreting exosomes, and exosomes derived from human MSCs mainly influence human diseases via the delivery of mRNAs, miRs, or proteins [
37,
38]. For example, miR-100 delivered by exosomes secreted from bone marrow-MSCs has been reported to inhibit breast cancer angiogenesis [
39]. Hence, we contend that exosomal miR-375 may suppress ESCC by inactivating the Bcl-2 signaling pathway, which has been previously identified in colon cancer [
40]. Additionally, hUCMSCs have the ability to suppress the initiation and development of lung cancer and hepatocellular cancer, highlighting that hUCMSCs can exert broad tumor-suppressive effects [
41]. Moreover, hUCMSCs-exo impairs the development of pancreatic ductal adenocarcinoma through delivery of exogenous miR-145-5p [
10]. Hence, it is reasonable to conclude that hUCMSCs-exo indeed transfers miR-375 to ESCC cells, which could ultimately prevent ESCC progression.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.