Background
Atrial fibrillation (AF) is one of the most common cardiac rhythm disorders [
1]. The population of AF cases aged ≥35 years in China is 5.26 million according to 2010 Chinese Census and the number of AF ablation is increasing rapidly. Catheter ablation is superior to antiarrhythmic drugs in maintaining sinus rhythm [
1]. The perioperative stage of atrial fibrillation catheter ablation refers to 3 weeks before operation, intraoperative period and 3 months after surgery, which requires anticoagulant therapy to cooperate with surgical treatment. Catheter ablation is a complex procedure with high risk of asymptomatic stroke during this period, hence, the management of patients should be treated with discretion. There is highly consistent evidence from observational studies that a continuous warfarin strategy during radiofrequency catheter ablation of AF reduces the risk of thromboembolic complications without increasing the risk of bleeding. Warfarin, an oral anticoagulant drug, is prescribed for patients who have undergone a catheter ablation procedure for treating atrial fibrillation. However, because of ethnic and individual dosing variations, warfarin dosage should be based on the International Normalized Ratio (INR) and carefully regulated [
2]. Inadequate warfarin dosage could lead to harmful effects such as bleeding and thromboembolism, especially at the initial treatment phase [
3].
Warfarin dosage has been found to be significantly associated with single nucleotide polymorphisms (SNPs) in the genes, vitamin K epoxide reductase complex subunit 1 (
VKORC1) and cytochrome P450 complex subunit 4F2 (
CYP4F2) [
4‐
12]. However, SNPs in
VKORC1 and
CYP4F2 are reported to be significantly different due to different ethnic backgrounds [
5,
11,
13‐
16]. The G allele of
VKORC1–1639 and the C allele of
VKORC1–1173, which are responsible for higher stable warfarin dose, were present in higher frequencies in Caucasian than in the Han Chinese population [
14‐
17]. The T allele of
CYP4F2 rs2108622, also responsible for higher stable warfarin dose [
5], had a higher frequency in Indian and Caucasian population than in the Chinese and African-American population [
11].
The dicoumarol-sensitive NAD(P)H: quinone oxidoreductase 1 (NQO1) catalyzes the two-electron reduction of several quinones, including vitamin K (K1, K2 and K3). NQO1 is thought to reduce vitamin K to vitamin K hydroquinone that functions as a co-factor for the γ-carboxylation and further activation of clotting factors [
18]. Thus, the
NQO1 gene is considered to be an additional candidate genetic factor that can affect warfarin dose. However, this hypothesis is challenged by two findings. Firstly, NQO1-deficient mice dosed with warfarin are able to reduce vitamin K and do not manifest a bleeding problem, questioning the role of NQO1 in vitamin K reduction [
19,
20]. Secondly, SNPs in the
NQO1 gene exhibit ethnic variation. The T allele of
NQO1 rs1800566, which is responsible for a higher stable warfarin dose [
4], has higher frequency in Hispanic-Americans than in African-Americans [
4]. Besides, NQO1 is found to have a significant association with warfarin dose in Hispanic-Americans [
4], but is not associated with warfarin dose in African-Americans [
21]. Till date, no studies have been performed in the Sichuan Han Chinese population. Therefore, it is important to determine if
NQO1 variants also influence warfarin dose in the Han Chinese patients.
Herein, we examined the impact of ethnic variation in VKORC1, CYP4F2 and NQO1 genes on warfarin dosage in the Han Chinese patients.
Methods
Study subjects
Patients enrolled in this study must meet five requirements: (1) underwent a catheter ablation procedure for atrial fibrillation; (2) received oral warfarin at a stable dose for at least 3 weeks prior to catheter ablation and 3 months after ablation; (3) their INR values controlled in a range of 1.5 to 3.0; (4) Han Chinese living in the Sichuan Province; (5) did not have a history of liver dysfunction or liver enzymes > 3 times the upper limit of normal. A total of 222 patients (82 males and 140 females) in West China Hospital were studied. Their demographic information including age, body weight, height and stable warfarin dosage was carefully recorded, and their blood samples were collected for genotype determination. The study population included had high (≥2) risk according to the CHA2DS2-VASc risk score. The Ethics Committee of West China Hospital, Sichuan University approved this study. All participants provided their written informed consent to participate in this study. The ethics committees approved this consent procedure.
Genotyping of polymorphisms
Genomic DNA was isolated from blood samples using a commercially available kit (QIAamp DNA Blood Mini Kit, Qiagen, CA). SNPs, including
VKORC1 rs9923231,
CYP4F2 rs2108622 and
NQO1 rs1800566, were determined by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. All PCR reactions were carried out in a 25 μl volume containing 50 ng genomic DNA, 2.5 mM dNTPs, 10 mM each of forward and reverse primers, 2.5 ml 10X Ex Taq buffer and 0.75 U Ex Taq DNA polymerase (Takara, Japan). PCR thermocycling consisted of an initial denaturation period of 5 min at 95 °C; then 40 cycles of a denaturation at 95 °C for 30 s, an annealing period of 30 s at 62 °C for
NQO1, 58 °C for
CYP4F2, 61 °C for
VKORC1, an extension period for 45 s at 72 °C; and a final extension for 10 min at 72 °C. Details on forward/reverse primer sequences, amplified product sizes and restriction enzymes used are shown in Table
1. Genotyping results were confirmed by repeating the reactions twice.
Table 1
Single Nucleotide Polymorphism Genotyping based on the PCR-RFLP method
NQO1 rs1800566 | F: AAGCCCAGACCAACTTCT R: GCGTTTCTTCCATCCTTC | 196 | Hinf I | |
VKORC1 rs9923231 | F: ATCCCTCTGGGAAGTCAAGC R: CACCTTCAACCTCTCCATCC | 636 | BcnI | |
CYP4F2 V433 M rs2108622 | F: AGTCCCGGTCATCTCCCGCCAT R: CGCCAGCCTTGGAGAGACAGACA | 358 | PvuII | |
Statistical analysis
The frequency distributions of VKORC1 rs9923231, CYP4F2 rs2108622 and NQO1 rs1800566 were tested for deviation from Hardy-Weinberg equilibrium using the χ2-test. The differences in warfarin dose between the groups categorized by SNPs were analyzed by a two-sample t-test. Variables (age, body surface area, gender and variation of SNPs) associated with warfarin dose were analyzed by Pearson’s correlation coefficient and the χ2-test. Variables with P ≤ 0.1, and not strongly correlated with other factors, were analyzed by multiple linear regression analysis to find their joint association with warfarin dose. Data were analyzed using SPSS ver.17.0 (SPSS Inc., Chicago, IL). P < 0.05 was considered to be statistically significant. Data are shown as number (percentage) or mean ± SD (range).
Discussion
In this study, the effect of
VKORC1 rs9923231,
CYP4F2 rs2108622 and
NQO1 rs1800566 genotypes on the daily stable warfarin dose in Sichuan Han Chinese patients with catheter ablation of atrial fibrillation was determined, and the allelic frequency and genetic distribution of these genotypes were also compared with other ethnic populations. To our knowledge, this is the first study that investigates the effect of the
NQO1 rs1800566 genotype on warfarin dose in Han Chinese patients. Till date, such studies have been performed in African-American and Hispanic-American patients [
4,
21], but not in Han Chinese patients. Given the ethnic variation of
NQO1, there was a critical need for assessing its impact on the daily stable warfarin dose in Han Chinese patients in this study.
The allele
s identified to be responsible for higher warfarin dose requirement,
VKORC1 rs9923231,
CYP4F2 rs2108622 and
NQO1 rs1800566, were present at a low frequency in Sichuan Han Chinese patients, which might explain their sensitivity to warfarin and their requirement for a lower warfarin dose as compared to Caucasians. The allelic frequencies and genetic distributions of
VKORC1 rs9923231 in Han Chinese patients were different from Caucasian patients, the G allele of
VKORC1 rs9923231 had lower frequency in Han Chinese patients than in Caucasian patients. This finding might provide a reason to the different warfarin dose requirement between these two populations [
14,
16]. This finding also suggests that
VKORC1 is the genetic factor for ethnic variations in warfarin dose. However, the allelic frequencies and genetic distributions of the
CYP4F2 rs2108622 in Han Chinese patients were not different from Caucasian patients, confirming a previous study that suggested that
CYP4F2 did not influence ethnic variations in warfarin dose [
5]. The allelic frequency and genetic distribution of
NQO1 rs1800566 in Han Chinese patients were not different from the African-American population either [
21], suggesting that
NQO1 is also not a genetic factor in modulating ethnic variation in warfarin dose.
Multiple linear regression analysis demonstrated that
VKORC1 rs9923231 and
CYP4F2 rs2108622 associated significantly with the daily stable warfarin dose (
P < 0.001) and contributed 15 and 3% to individual variation in the daily stable warfarin dose, respectively. These results suggests that
VKORC1 rs9923231 and
CYP4F2 rs2108622 are significant genetic factors contributing to individual differences in warfarin dose within an ethnic population, as also indicated in previous studies [
5,
8,
10,
11,
13,
22,
23]. Therefore, monitoring of these two genotypes could help determine the personalized warfarin dose requirement in Han Chinese patients. Consistent with a previous study in African-American patients [
21],
NQO1 rs1800566 is not significantly associated with the daily stable warfarin dose in Han Chinese patients as well, suggesting that
NQO1 does not contribute to individual variations in warfarin dose within an ethnic population. Together with an in vitro study demonstrating that
VKORC1 plays a major role in vitamin K cycle whereas other enzymes play smaller roles [
24], our study suggests that
NQO1 may not be a significant genetic factor influencing warfarin dose.
While our data are limited by our small sample size, the sample we collected were almost Han Chinese and the other nationalities will be researched in the future.
Conclusion
Our current data support VKORC1 and CYP4F2, but not NQO1, genotypes in prediction of warfarin dose requirements in Han Chinese. Moving forward, developing the predictive ability that take genetic characteristics into account may help improve dose prescribing and reduce the risk of bleeding and thrombosis during the warfarin initiation period. Formal algorithm establishment will require a large sample.
Acknowledgements
The authors appreciate the cooperation of patients in the current study and express sincere thanks to the Chengdu Regencell Biotechnology Co., Ltd. who provided technical support.