Background
Helicobacter pylori (
H. pylori) is a gram-negative bacterium, usually in a spiral-shaped form, which can be converted into coccoid cells under a hostile environment.
H. pylori infection often is associated with gastrointestinal diseases, such as chronic gastritis, peptic ulcer, gastric carcinoma, and mucosa-associated lymphoid tissue lymphoma [
1‐
7].
H. pylori colonizes the stomach of more than half of the world’s human population, but its mode of transmission remains unknown. Some reports indicate there is a higher prevalence of antibodies against this bacterium in veterinarians, butchers, and slaughterers than in other people, which suggests the possibility of zoonotic transmission [
8‐
10]. Recently, investigators have isolated
H. pylori from cows, sheep, camels, miniature pigs, and dogs’ milk. The isolated method for each animal is slightly different [
11,
12].
Current treatment and eradication of
H. pylori involve the use of triple therapy consisting of two antibiotics, inhibition of gastric acid secretion by histamine H
2-antagonists or proton pump inhibitors, and mucosal protection provided by sucralfate and bismuth. However, the organism’s increasing antibiotic resistance and side effects arising from these drugs are creating a general health problem, indeed a global pandemic, which is especially severe in developing countries such as China [
13]. Thus, safe and effective non-antibiotic agents are urgently needed. Accordingly, there is rekindled interest in the use of natural drugs, including herbs, which may possess anti-
H. pylori activities [
32] and also may have minimal side effects, easy accessibility, and affordability, even by the poor.
Traditional Chinese medicine has been used in Chinese health care for more than two thousand years. Side effects and adverse events of the traditional medicines are generally regarded as mild and infrequent [
14‐
16].
Tinospora sagittata (Oliv.)
Gagnep. var. craveniana (S.Y.Hu)
Lo (TSG) is an important species of the genus Tinospora (Menispermaceae), a traditional Chinese Miao-nationality herb which only grows on the Mount Emei of Sichuan province, and has been widely used in the treatment of gastrointestinal diseases. TSG is listed in the Pharmacopeia of the People’s Republic of China as a plant of origin for
Tinospora sagittata (Oliv.)
Gagnep, with anti-inflammatory, analgesic, anti-bacterial, anti-ulcer, anti-tumor, and anti-stress activities [
17‐
20]. The main chemical constituents of Radix Tinosporae are diterpenoid lactone, protoberberine alkaloids, aporphine alkaloids, and botanic steroids, among which diterpenoid lactones and alkaloids are considered important bioactive constituents. Palmatine is one of the major alkaloid compounds in TSG.
This study isolated a clinical H. pylori strain from swine by an improved method and investigated the bactericidal activities of TSG and its major component, palmatine, against the clinical H. pylori strain and H. pylori SS1 in vivo and in vitro.
Methods
Plant collection and extraction
TSG plants were collected from Mount Emei (Sichuan, China) between the months of September and October, 2014. The plants were identified and authenticated by Professor Qiao-jia Fan of the College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, China. A voucher specimen (TSG2014) was deposited in the Veterinary Medicine Department of Sichuan Agricultural University. We prepared an extract of TSG from the plants according to reported methods [
21]. Air-dried TSG (500 g) was refluxed with 95 % ethanol (
v/v) three times each for 2 h. The solvent was completely removed in vacuo to generate a semisolid residue, which yielded 14.72 % (
w/w) dry starting material. Stock solutions of the freeze-dried extracts were prepared for the initial screening by reconstitution in 1 % dimethyl sulfoxide (Amresco, America) to a final concentration of 1 g/mL.
Chemicals and reagents
Palmatine, amoxicillin, omeprazole, clarithromycin, and vancomycin were purchased from Shanghai Yuanye Bio-technology, Co., Ltd (Shanghai, China). Brucella broth, Columbia blood agar, and Mueller-Hinton agar were purchased from OXOID (Hampshire, UK).
Bacterial strain
H. pylori SS1 were purchased from the Chinese Center for Disease Control, Beijing.
Sampling
One hundred seventy gastric samples were randomly selected from pigs sent to the Xingrui slaughterhouse (A29180101) in Ya’an, Sichuan Province, China, during August 28, 2014. Gastric tissue samples of 0.5 to 1 cm were obtained from the pyloric stomach immediately after slaughtering. The samples were placed in 3 mL of sterile Brucella broth with 30 % glycerol and transported rapidly to the laboratory.
Culture and collection
The samples were homogenized in 1 mL Brucella broth with 30 % glycerol by the use of sterile mortar grinders. A 500 μL homogenate of each biopsy specimen was inoculated on selective agar plates (Columbia blood agar supplemented with 7 % fresh defibrinated sheep blood and 3 % vancomycin). Plates were incubated at 37 °C in a microaerobic atmosphere (5 % O2, 10 % CO2, 85 % N2) for 3 to 7 days. Isolates were presumptively identified as H. pylori on the basis of colony morphology (gray, small, and translucent), Gram staining, rapid urease test and biochemical reactions (oxidase, catalase, and urease positive). The bacterial colonies were collected and prepared in Brucella broth with 10 % fetal calf serum for tests.
Identification
Five hundred microliters of bacterium solution were centrifuged, and DNA was extracted from the precipitates with the OMEGA Bacterial DNA Kit D3350 according to the manufacturer’s protocol. The DNA extracts were eluted in a volume of 200 μL and stored in a 20 °C freezer until PCR was performed.
PCR assays
PCR amplification of DNA from
H. pylori strains was performed by the use of species-specific primers (Table
1). All PCRs were performed in 25 μL volume and reaction mixtures containing 2.5 μL 10 × buffer (Mg
2+), 2.5 μL deoxynucleotide triphosphates (dNTPs) at a final concentration of 0.25 mmol/L, 1 μL of each primer at a final concentration of 0.4 μmol/L, 0.25 μL DNA polymerase (Easy Taq, TransGen Biotech) at a final concentration of 0.05 U/μL, and 5 μL DNA extracts. PCR amplification of
H. pylori was performed under these conditions: 3 min of pre-incubation at 94 °C, followed by 35 cycles of 20 s at 94 °C, 20 s at 60 °C, and 30 s at 72 °C. A final extension was performed for 5 min at 72 °C.
Table 1
Primer sequences used for H. pylori identification
16 s rRNA | F: CTGGAGAGACTAAGCCCTCC R: ATTACTGACGCTGATTGTGC | 109 |
ureAB | F: AAAGAGCGTGGTTTTCATGGCG R: GGGTTTTACCGCCGCCGAATTTAA | 217 |
cagA | F: ATAATGCTAAATTAGACAACT R: TTAGAATAATCAACAAACATC | 213 |
vacA | F: ATGCCGCCTTTTTCACAACC R: ACGGCCCATCCACACATTAC | 204 |
The amplification products were analyzed by the use of gel electrophoresis in 2 % agarose gels and visualized with an ultraviolet light illuminator. Nucleotide sequences were searched by use of the BLAST tool on the National Center for Biotechnology Information site (
http://www.ncbi.nlm.nih.gov/ BLAST).
Susceptibility test
Susceptibility of
H. pylori strains to TSG and palmatine was determined by use of the agar cup diffusion technique as described [
22]. Inoculated plates (Mueller-Hinton agar plates containing 5 % sheep blood) were incubated at 37 °C in an incubator under microaerophilic conditions for 3 to 7 days, after which the diameters of the zones of inhibition (mm) were measured. One percent of dimethyl sulfoxide was included in each plate as a solvent (negative) control; amoxicillin was included as positive controls.
Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) tests
Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined by the use of agar dilution methods according to the Clinical and Laboratory Standards Institute as described [
23,
24]. Briefly, the
H. pylori strains were inoculated on Mueller-Hinton agar plates containing 5 % sheep blood for 3 to 7 days. The bacterial colonies were collected and prepared in Brucella broth with 10 % fetal calf serum. Inoculates were prepared at a density adjusted to a 1.0 McFarland turbidity (3 × 10
8 CFU/mL) standard. Serial dilutions (1:2) of TSG were added to the Mueller-Hinton agar for final concentrations from 200 mg/mL down to 0.39 mg/mL, and palmatine and clarithromycin (as a positive control) were added to the Mueller-Hinton agar for final concentrations from 200 μg/mL down to 0.39 μg/mL. The no-drug containing agar and 1 % dimethyl sulfoxide agar served as negative controls. Agar plates were inoculated with
H. pylori strains and cultured for 3 days. The MIC was regarded as the lowest concentration that prevented visible growth from a duplicate experiment, and the MBC was the lowest concentration that completely inhibited bacterial growth.
Bactericidal activities test
Bactericidal activities were evaluated by the use of time-kill curves with 0.5, 1, and 2 × MIC of drugs, and with blank, clarithromycin, and 1 % dimethyl sulfoxide controls.
H. pylori SCYA201401 and
H. pylori SS1 (0.1 mL at 1 × 10
8 CFU/mL) were added to 90-mm plates with the calculated concentrations of drugs or dimethyl sulfoxide and Brucella broth with 10 % fetal calf serum (final volume 10 mL), and cultured with gentle shaking at 37 °C in a microaerobic atmosphere. At 0, 4, 8, 12, 16, 20, 24, 32, 40 and 48 h, 0.1 mL of liquid was removed, serially diluted, and plated on Columbia blood agar plates (
n = 2 per group). Colonies were counted and averaged after 3 days of incubation [
25].
Model establishment
A total 108 mice C57BL/6 mice (6–8 week old, male/female = 1:1, weight 25 ± 5 g) were purchased from the specific pathogen-free facility at Chengdu Dossy Experimental Animals Co., Ltd. (license No. SCXK, Sichuan, 2013–24). All experimental procedures involving animals were approved by the Sichuan Agricultural University Animal Care and Use Committee (registration No. SCAU2015101801). In accordance with the Guidelines of the International Committee on Laboratory Animals, the animals were maintained in environmentally controlled rooms at 20–25 °C with a relative humidity of 55 ± 5 % and 12 h light/dark cycle. Food and water were available ad libitum. Mice were provided with sawdust bedding material and housed under these conditions for one week, then fasted for 12 h prior to the experiments.
A group of 12 mice, selected randomly as blank control, were inoculated with sterile liquid medium (Brucella broth with 10 % fetal calf serum). A group of 48 mice (the SCYA201401experimental group) was inoculated intragastrically with 0.3 mL of H. pylori SCYA201401 (1 × 108 CFU/mL) on three alternate days. Another 48 mice (the SS1experimental group) were inoculated intragastrically with 0.3 mL of H. pylori SS1 (1 × 108 CFU/mL) on three alternate days. Animals were fasted 24 h before and 2 h after each inoculation. After 24 days, 8 mice from the SS1 experimental group, 8 mice from the SCYA201401experimental group, and 2 mice from the control group were sacrificed by cervical dislocation without anesthesia prior to the end of the experiment, and used for assessing the by use of a rapid urea test (RUT) and bacterial culture. Only if there was a 100 % infection rate (all 18 mice positive in the RUT and bacterial culture) was the experiment continued.
Group and drug administration
Mice of two experimental groups were randomly divided into four groups: TSG, palmatine, triple therapy (omeprazole, clarithromycin, and amoxicillin), and model groups. Drugs dosages used in in vivo experiments were equivalent to those that are used clinically. The TSG and palmatine groups were treated intragastrically with 4 g/kg and 50 mg/kg daily for 1 week, respectively. The triple therapy group was treated intragastrically with a suspension of omeprazole (0.8 μg/kg), clarithromycin (20 μg/kg), and amoxicillin (40 μg/kg) daily for 1 week [
26]. The SS1 model group, the SCYA201401 model group, and blank control group were given saline solution.
Eradication rate of H. pylori
At the last day of medication, all groups were deprived of feed but allowed free access to water for 24 h and then sacrificed. Stomachs were collected at the time of sacrifice, opened along the greater curvature, and washed with phosphate-buffered saline at 4 °C . Half of the antral section was isolated for RUT determination at room temperature within 24 h; the change to pink color was regarded as positive. The other half of the antral section and part of the gastric body were used for bacterial culture according to the method described above. Successful eradication of H. pylori was defined as negative findings from both RUT and bacterial culture.
Statistical analysis
Eradication rates were compared among groups with a Fisher’s exact test using SPSS 20.0 software (IBM Corp., Armonk, NY, United States). P < 0.05 was considered statistically significant.
Discussion
The major goal of this study was to determine the bactericidal activities of TSG and its major component, palmatine, against H. pylori. The rationale underlying the goal is that the current antibiotic treatments of H. pylori are becoming less effective and have unwanted side effects and consequences, so effective and safer treatments, perhaps herbal medications, have been needed. In order to accomplish the study’s goal we invoked a strategy of isolating H. pylori from pigs, inoculating mice with the H. pylori, and testing the effectiveness of the traditional Chinese medication, TSG, and its principal active component, palmatine, against the isolated H. pylori and standard strain H. pylori SS1 in vitro and in vivo. The principal findings of the study are that H. pylori isolated from pig could readily colonize mouse stomach and that treatment of H. pylori-infected mice with TSG completely eliminated the H. pylori. Thus, the results support the notion that a traditional Chinese medication, TSG, may have therapeutic potential against human H. pylori infection.
TSG belongs to Tinosporae (Menispermaceae), which consists of about 34 species, with 8 species found in China. Recent studies have shown that the ethanol extract of Radix Tinosporae significantly inhibited xylene-induced ear edema and acetic acid-induced writhing in mice [
20]. TSG has been used in treatment of gastritis and peptic ulcers by the Hmong for more than a thousand years. The chemical constituents of Radix Tinosporae mainly include diterpenoid lactone, protoberberine alkaloids, aporphine alkaloids, and botanic steroids, among which diterpenoid lactones (columbin) and alkaloids (columbamine, jatrorrhizine, palmatine) are considered important bioactive constituents. Phytochemical studies have shown that columbamine, jatrorrhizine, palmatine and menisperine are major diterpenoid lactones and alkaloids compounds in Radix Tinosporae [
33]. Although no investigations on antibacterial activity of TSG, columbamine, jatrorrhizine and menisperine against
H. pylori have been reported, there are a few reports on palmatine; 16 μg/mL palmatine in vitro or 50 mg/kg in vivo killed
H. pylori [
34,
35].
In our study, the MIC of TSG, 6.25 mg/mL, was sufficient to completely eliminate
H. pylori. Although this MIC is lower than that in another study (16 μg/mL) [
35], it took longer than TSG to completely eliminate the
H. pylori strains we used. Our in vivo experiments demonstrated the potential of TSG for eradication of
H. pylori, with efficacy equivalent to that of triple therapy. The observation that palmatine was less effective than TSG, implies that palmatine is not the only component of TSG with bactericidal effect against
H. pylori. Like other herbs, TSG is a complex compound, and some of it effective components likely are yet unknown. Hence, further research on TSG might prove useful in identifying components that could have greater anti-
H. pylori effect than has palmatine. Nevertheless, this study confirms the in vitro and in vivo anti-
H. pylori effects of TSG and its main component palmatine, and provide impetus for future research with these agents.
The findings of our initial experiments with abattoir pigs have important implications. We found a substantial isolation rate (about 25 %) in abattoir pigs. Others [
27] have reported that in 60 farms in England, over 79 % of porcine stomachs had either an oesophago-gastric ulcer or visible pre-ulcerative changes. Although it was not proven that
H. pylori caused the abnormalities, it may have, or the abnormalities may have been caused by a related bacterium, such as
Helicobacter heilmanni. The ease of transmission of porcine
H. pylori to mice in our study indicates the possibility of zoonotic transmission of
H. pylori. Accordingly, colonization of domestic animals has to be considered a possible cause of the high prevalence of
H. pylori infections in man.
The current medicinal treatment of
H. pylori is generally based on triple therapy regimen, inhibition of gastric acid secretion by histamine H
2-antagonists, proton pump inhibitors, as well as on mucosal protective therapy provided by sucralfate and bismuth [
28,
29]. Since antibiotic-resistant
H. pylori strains triggered a global pandemic and brought various harmful adverse effects, the search for safe and effective non-antibiotic agents is urgently required [
30,
31]. In recent years, active researches have rekindled interest in natural drugs possessing these activities, which are widely appreciated by the population especially in oriental countries [
32].
Since improved medical therapy for human H. pylori infection is clearly needed, the results of this study are encouraging. Although their relevance to the management of human H. pylori infection is unknown, they do indicate that non-antibiotic-based treatment options, such as herbal medication, deserve consideration.
Acknowledgments
This work was supported in part by a grant (2013NZ0019) from the Science and Technology Department of Sichuan Province, China. We thank the College of Veterinary Medicine, Sichuan Agricultural University, Cheng du 611130, China, for kindly providing facilities.