Increased tartrate-resistant acid phosphatase (TRAP) expression in malignant breast, ovarian and melanoma tissue: an investigational study

Serum samples were collected from patients with breast (n = 34) and ovarian (n = 39) cancer and from 37 controls, of whom 17 were premenopausal and 20 were postmenopausal (Table 1). A history of medications or conditions that could possibly affect bone metabolism (e.g. osteoporosis, thyroid disease, fractures, rheumatoid arthritis, osteoarthritis, steroid treatment) resulted in exclusion from the control group. Biopsy specimens of breast (n = 21), ovarian (n = 8) and cervical (n = 7) cancer, malignant melanoma (n = 6), benign breast tissue (n = 2), normal ovarian tissue (n = 3), and normal skin (n = 3) were investigated for TRAP expression by immunohistochemistry. 13 of the 34 breast cancer patients, but none of the ovarian cancer patients, had metastatic bone disease.

Primary tumor cells from malignant pleural effusions and ascites associated with metastatic breast cancer (4 cases) and ovarian cancer (4 cases) were isolated and cultured. The effusions had been aspirated because of clinical symptoms. The aspirates (20–500 ml) were centrifuged, and the resulting cell pellets washed twice in phosphate buffered saline (PBS, Biochrom, Berlin, Germany). Cells were cultured in HBCA medium [12] supplemented with 10% fetal bovine serum (FBS, PAA Laboratories, Cölbe, Germany) and gentamycin (50 μg/ml, Biochrom) at 2 × 10⁵ cells/ml in a plastic cell-culture flask in a humidified incubator (atmosphere of 5% CO₂). Contaminating fibroblasts were eliminated by trypsin treatment every other day and the remaining tumor cell monolayer was cultured until the cells were of homogeneous morphology (passage 3–4). If the tumor cells had divided adequately, contaminating leukocytes and fibroblasts were absent after these few passages.

The following commercially available cell lines were also investigated: Breast cancer cell lines MCF7, MDA-MB-468, BT20, and HBL-100, ovarian cancer cell lines OAW42 and SKOV3, and cervical cancer cell lines SiHa and CaSki. The breast and ovarian cancer cell lines were obtained from Cell Line Services (Heidelberg, Germany) and cervical cancer cell lines from the Department of Obstetrics and Gynecology, University of Jena, Germany. All cell lines were cultured in RPMI1640 medium (Biochrom) supplemented with 10% FBS and gentamycin (Biochrom).

The serum samples were analyzed using a TRAP-ELISA Kit (Medac, Wedel, Germany) according to the manufacturer's instructions. The range of the ELISA was 1–10 U/l. In some cases the TRAP concentration was higher than 10 U/l: these samples were diluted 1:4 in the sample dilution buffer provided with the kit and reanalyzed. Final serum concentrations were then derived by multiplication of the value obtained by four.

Immunocytological investigations were performed on the cells cultured from the malignant pleural effusions and ascites and commercially available established cell lines. Cells were seeded onto APES-(3-amino-propyltriethoxy-silane; Roth, Karlsruhe, Germany) coated slides and grown over night. They were then fixed with 4% formalin and washed in PBS for 10 min, followed by distilled water for 2 minutes and then acetone/methanol [1:2 for 5 min].

For immunohistochemistry, sections of routinely-processed paraffin-embedded tissue were cut at 2–3 μm, placed onto APES-coated slides, dewaxed in xylene, and rehydrated in graded ethanols and TRIS-buffered saline (TBS; 25 mM TRIS/HCl, pH 7.4, 137 mM NaCl, 2.7 mM KCl). For antigen retrieval, sections were subjected to heat pretreatment by boiling in 0.01 M sodium citrate buffer (pH 6.0) for 10 min in a microwave oven (600 Watt/sec.).

For specific detection of the TRAP antigen, the sections and cell smears were incubated with goat serum for 30 min and then with the TRAP monoclonal antibody at 1:100 dilution in antibody diluent (DAKO, Hamburg, Germany). The TRAP antibody is directed against the N-terminal portion of human TRAP (clone: 26E5, subtype: IgG2b; Novocastra Laboratories Ltd., Newcastle, United Kingdom). After one wash in PBS, the horseradish-peroxidase (HRP)-labeled rabbit anti-mouse specific secondary antibody (DAKO, dilution 1:100) was applied. The detection reaction was developed with 3,3'-diaminobenzidine (DAB; Sigma, Deisenhofen, Germany) or Vector VIP (Vector Laboratories, Burlingame, CA, USA). The sections and smears were counterstained with hematoxylin (Mayers, Sigma), dehydrated through graded ethanols, and embedded in Entelan (Merck, Darmstadt, Germany).

Immunoreactivity of the cells and tissues was evaluated by comparison with control sections incubated with an IgG control antibody. They were rated positive [+] if a clear brown or purple color was detected in the majority of the cells, as weakly positive [(+)] if less than 50% of the cells were stained (the majority weakly)), and as negative [-] if no staining was detectable.

RNA was extracted from the cell lines obtained from the patients and from the commercial cell lines using the Quiagen RNA-extraction kit (Quiagen, Hamburg, Germany). LPS-activated dendritic cells, which have been described to express TRAP [13], and JAR choriocarcinoma cells served as negative controls, respectively. mRNA was transcribed with reverse transcriptase and oligo T-primers (both from Promega, Mannheim, Germany). 5 μg of cDNA were used for PCR. Two different sets of primers, which were designed specifically to amplify mRNA of human TRAP 5b, were used. Both gave identical results. The first set had the following sequences: upstream-primer 3'CTTTCTACCGCCTGCACTTC5', and downstream primer 3'GCTGTTTCTTGAGCCAGGAC5'. The second primer pair consisted of the upstream primer 3'AGGCTTTTCCTCCAACCTGT5' and downstream primer: 3'GGAACTCAGCAAAGGTGAGC5', Taq polymerase (Promega) was used at 1 U/μl in the buffer supplied by the manufacturer with 5 mM dNTP and 25 mM MgCl₂. The PCR was run for 40 cycles and the temperatures were 96°C, 60°C (annealing), and 72°C. The PCR products corresponding to the mRNA were 171 and 175 base pairs in size for the two different primer pairs respectively. PCR products were run on a 1% agarose gel and analyzed. RT-PCR was considered positive when a clear band of the expected size was visible on an ethidium bromide-stained gel.

The median values for serum TRAP concentrations are summarized in Table 1 and Figure 1. Serum from breast and ovarian cancer patients as well as controls were analyzed by ELISA. The TRAP concentration was above the detection limit in all the samples analyzed. Four of the samples from patients with visceral and bone metastases showed concentrations above the upper standard and the final concentration was therefore calculated from diluted samples.

We first evaluated serum from 14 breast cancer patients who had visceral metastases only, and found increased values (median 4.0) in almost all of these patients as compared to the control group as a whole (median 3.2) (Table 1). The values were comparable to those in patients with metastases confined to the bones. Interestingly, the highest serum concentrations were found in patients with aggressive disease, with both bone and visceral metastases (median 10) (Table 1).

Serum TRAP protein concentrations in 40 ovarian cancer patients with advanced disease were also determined. Analysis revealed that there were essentially two groups of ovarian cancer patients: one with high serum TRAP concentrations (median 3.7), almost equalling those of breast cancer patients with bone disease, and a second group with very low values (median 1.9).