Skip to main content
Erschienen in: Virology Journal 1/2014

Open Access 01.12.2014 | Research

Infection of Beet necrotic yellow vein virus with RNA4-encoded P31 specifically up-regulates pathogenesis-related protein 10 in Nicotiana benthamiana

verfasst von: Wen-Qi Wu, Hui-Yan Fan, Ning Jiang, Ying Wang, Zong-Ying Zhang, Yong-Liang Zhang, Xian-Bing Wang, Da-Wei Li, Jia-Lin Yu, Cheng-Gui Han

Erschienen in: Virology Journal | Ausgabe 1/2014

Abstract

Background

Beet necrotic yellow vein virus (BNYVV) is the infectious agent of sugar beet rhizomania, which consists of four or five plus-sense RNAs. RNA4 of BNYVV is not essential for virus propagation in Nicotiana benthamiana but has a major effect on symptom expression. Early reports showed that RNA4-encoded P31 was associated with severe symptoms, such as curling and dwarfing, in N. benthamiana.

Results

We discovered that the pathogenesis-related protein 10 (PR-10) gene can be up-regulated in BNYVV-infected N. benthamiana in the presence of RNA4 and that it had a close link with symptom development. Our frame-shift, deletion and substitution analysis showed that only the entire P31 could induce PR-10 up-regulation during BNYVV infection and that all the tryptophans and six cysteines (C174, C183, C186, C190, C197 and C199) in the cysteine-rich P31 had significant effects on PR-10 expression. However, P31 could not interact directly with PR-10 in yeast.

Conclusions

Our data demonstrated that only integrated P31 specifically induced PR-10 transcription, which coincided closely with the appearance of severe symptoms in BNYVV-infected N. benthamiana, although they could not interact directly with each other in yeast.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1743-422X-11-118) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

WQW, HYF and NJ performed the experiments. YW, ZYZ, YLZ, XBW, DWL, JLY contributed reagents/materials/analysis tools. CGH conceived of the study and participated in its design and coordination. WQW, YW and CGH wrote the manuscript. All authors read and approved the final manuscript.

Introduction

Beet necrotic yellow vein virus (BNYVV)[1] is a member of the Benyvirus genus, which causes rhizomania disease of sugar beet (Beta vulgaris L.) transmitted by the soil-inhabiting plasmodiophorid, Polymyxa betae[2]. Rhizomania[3] is one of the most economically important diseases affecting sugar beet, and it is widespread in all of the sugar beet-growing areas of Europe, Asia and America[4]. The disease is characterized by abnormal rootlet proliferation and reduced sugar yields[5]. The BNYVV genome consists of four or five plus-sense 5′-capped and 3′-polyadenylated RNAs[6, 7]. RNA1 and RNA2 carry ‘house-keeping’ genes that are involved in virus replication, assembly, cell-to-cell movement and the suppression of post-transcriptional gene silencing[811]. Extra genomic components, consisting of smaller RNA3, RNA4 and RNA5, each of which plays an important but unique role in pathogenicity and vector transmission are necessary for the efficient production of typical rhizomania symptoms, long-distance movement and vector propagation[6, 10, 1215]. The RNA3-encoded P25 protein is responsible for the virulence and avirulence factors in leaves of some resistant sugar beet lines[16]. The P25 protein also functions in the induction of rhizomania symptoms of sugar beet roots and the severe symptom expression in the Chenopodiaceae hosts[1721]. The RNA5-encoded 26-kDa protein (P26), which is associated with symptom severity but is dispensable for BNYVV survival, has been found in small areas of Europe and in most areas of Asia[4, 22, 23].
In the case of BNYVV, the presence of the RNA4-encoded single 31-kDa protein (P31) is involved in enhanced symptom expression, efficient root-specific silencing suppression and efficient vector transmission by P. betae[13]. BNYVV induces plant stunting, downward curling of the upper leaves and severe mosaicism with leaf distortions in the systemic host Nicotiana benthamiana[24] without affecting viral RNA accumulation[2, 13]. The entire P31 is required for the expression of severe symptoms in N. benthamiana[13].
When a pathogen attacks a plant, it displays an innate pathogen-specific resistance by producing responses, including oxidative bursts of cells, changes in cell wall composition and the synthesis of compounds like phytoalexin and pathogenesis-related proteins (PRs). PRs are a major category of host proteins induced during biotic and abiotic stresses, which have been identified in 17 different families thus far in monocotyledonous and dicotyledonous plants based on their structural and functional properties[2528]. The PR-10 family plays an important role among the PR groups. RNase activity has been reported for some PR-10 proteins and may be involved in its antimicrobial activity[29].
Thus, we investigated gene transcription levels in N. benthamiana infected by different BNYVV isolates, and we found that RNA4 could dramatically up-regulate PR-10 expression and was closely linked to symptom appearance. Frame-shift and deletion mutations in the P31-encoding region indicated that only an entire intact P31 could induce PR-10 up-regulation. An amino acid substitution analysis of the P31 protein showed that several cysteine/tryptophan positions affected PR-10 expression and symptom development during BNYVV infection.

Results

BNYVV coupled with RNA4 specifically induces PR-10 and PR-Q up-regulation in N. benthamiana

Previous studies showed that N. benthamiana inoculated with a BNYVV isolate without RNA4 (BN3, which contains BNYVV RNAs 1, 2 and 3) does not show severe symptoms, whereas a BNYVV isolate with RNA4 (BN3 + 4, which contains BNYVV RNAs 1, 2, 3 and 4) induces a downward curling of the upper leaves at 10–12 days post inoculation (dpi) in N. benthamiana. The plant is stunted and these first leaves that undergo curling gradually wilt[13, 30]. After 15 dpi, the newly-grown leaves recovered in plants infected by BN3 without RNA4[30]. Plant development is regulated by many genes in different situations, such as biotic stresses. The relative expression levels of select genes, involved with gene silencing and pathogenesis, were determined using quantitative real-time PCR (qPCR) at 11 dpi. The primers used in detection are listed in Table 1. The genes related to gene silencing were expressed at similar levels in plants infected with BN3 and BN3 + 4 (Figure 1A), except for DCL-2, which was expressed at twice the level with BN3 + 4 than with BN3. PR-a, PR-c and NPR1-1 expression levels were not different between the test plant types, although PR-b was up-regulated less than three-fold with BN3. PR-Q and PR-10 were up-regulated by tens of folds, and PR-10 had at least a 30-fold increased expression level in BN3 + 4 compared with BN3. Thus, BN3 + 4 specifically induced PR-10 and PR-Q up-regulation in N. benthamiana, and PR-10 had the highest expression level.
Table 1
Sequences of primers for qRT-PCR
Primer
Sequence (5′ − 3′)
RDR2_FOR
CATAAGAAATTGGCATCGGCG
RDR2_REV
TCCAGCAAAATGTCACCTACC
RDR6_FOR
CTTTGGATGAGAAGTGCCTA
RDR6_REV
TTTGGGACAAGCTCAAGTC
AGO1_FOR
GCTCTAGAAGATCTGTACAAGACTTGGC
AGO1_REV
CGAATTCTTATTGGCAAACAACCTAGT
AGO2_FOR
TAACATGGTGTTTGTGCGTGAATC
AGO2_REV
CAGTGGCTCTCAAAAGACCAAAGT
AGO4-1_FOR
TATATCCATTGTGGCTCCGGTAAG
AGO4-1_REV
AGAAACATTTTCCTGAAGTCGAGGC
DCL1_FOR
TGTGGGTGATGCAGTATT
DCL1_REV
TGAAACCTGGTTTTGATAGT
DCL2_FOR
CGGGATCC_CCGGGATTTATTCGTAAT
DCL2_REV
CCCTCGAG_AATGACAAAGCCGCTACT
DCL3_FOR
ACTTGTTGAATGCGGTGAAG
DCL3_REV
CCCCTGTCGTTCTAGCTCAT
DCL4_FOR
CGTCCGTGCCCAGAAATCT
DCL4_REV
AATGCAATTGCCGCTTTGA
PRa_FOR
TGTGTTCCTGTTGCTGAATGTT
PRa_REV
GGCGTTGGAATAATGAAGGTAG
PRb_FOR
GGCCTCCAAGCAATTCTCCTCT
PRb_REV
CCATTTAAAGGACATGCTGCTAC
PRc_FOR
GGGCTGATGAACAAAAGTATTA
PRc_REV
AACATCACCACTCTCACAAACA
PR-10_FOR
GAAGAAGAACACAATGAAGGCA
PR-10_REV
CAGTAGGATTGGCAAGAAGGTA
PR-Q_FOR
TTGTTCGGCAAAATGACCAG
PR-Q_REV
TGTGGCTACTAAATCAGGGTT
NPR1-1_FOR
AAAACCTCAGCAAGGAACGCTA
NPR1-1_REV
TGTTGGCCTATTTGTATAGTGGA
PP2A_FOR
GACCCTGATGTTGATGTTCGCT
PP2A_REV
GAGGGATTTGAAGAGAGATTTC
To examine whether other plant viruses could induce PR-10 up-regulation, N. benthamiana was inoculated with several plant viruses, including Beet black scorch virus (BBSV), Brassica yellows virus (BrYV), Barley stripe mosaic virus (BSMV), Cucumber mosaic virus (CMV), Pea enation mosaic virus (PEMV), potato virus X (PVX), Tobacco necrosis virus (TNV) and Tobacco rattle virus (TRV). We detected PR-10 expression levels in all the tested plants when symptoms of the corresponding viruses appeared on leaves at 7–14 dpi. However, the PR-10 expression levels were not up-regulated when N. benthaminana plants were inoculated with these viruses, and the PR-10 expression level increased, at most, by three-fold. This is far less than was seen with the BN3 + 4 inoculations, indicating that the high level of PR10 up-regulation in N. benthamiana was BNYVV isolate specific (Figure 1E). Of course, it is possible that there are other plant viruses that could up-regulate PR-10 gene expression levels.

Time-course analysis showed that increased expression of the PR-10 gene is closely linked to the appearance of severe symptoms in the presence of RNA4

To confirm PR-10 expression characteristics during a BN3 + 4 infection, we examined the expression levels of the PR-10 gene, plant height and leaf curling at 3, 5, 7, 11 and 15 dpi. Initially, all plants were investigated using a western blot analysis with antiserum specific to the viral coat protein to confirm that plants were systemically infected by BNYVV (data not shown). The PR-10 expression level was determined by qPCR, and the expression curve was parabola shaped. At 5 dpi, the PR-10 expression level in plants infected with BN3 + 4 was slightly higher than with BN3, reaching the peak of the parabola at 7 dpi. Then, expression decreased, but was still higher than with BN3, and the level of PR-10 returned to normal by 15 dpi (Figure 1B). The leaves of plants inoculated with BN3 + 4 were slightly distorted at 5 dpi, compared with those infected with BN3, and the newly-growing leaves showed severe symptoms at 7 dpi. The plant heights showed the largest disparities by 11 dpi when the stunting of plants infected with BN3 + 4 became apparent. The neonatal leaves recovered and appeared flat at 14 dpi. After 15 dpi, newly-growing stems in plants inoculated with BN3 appeared normal (Figure 1C and D).

First initiation codon of the BNYVV P31 gene is required to induce PR-10 expression

The open reading frame (ORF) of P31 contains five potential initiation codons. To identify the translational start codon, the P31 gene nucleotide sequence was modified to produce a series of frame-shift mutants (Figure 2A). Four frame-shift mutations (P31-2, −3, −4 and −5) were created after each initiation codon, which abolished the synthesis of P31 proteins initiated at the front AUGs. N. benthamiana was inoculated with BN3 alone, RNA4 wild type (WT) or each mutants plus BN3. The expression level of PR-10 was examined and no significant differences were observed among BN3 and the mutants (Figure 2B), suggesting that PR-10 up-regulated expression required the entire P31 protein. All plants inoculated with the mutants showed mild symptoms similar to those for BN3, contrasting with the severe symptoms induced by BN3 + 4 at 11 dpi (Figure 2C and D).
To confirm P31 expression, a GUS gene without a start codon was fused to the P31 gene in RNA4 to produce P31GUS. Frame-shift mutants were also constructed and named P31GUS-2, −3, −4 and −5. Tetragonia expansa leaves were inoculated with a mixture of WT and each mutant transcript together with BN3, and every inoculated leaf produced similar local lesions at 7 dpi[31]. Histochemical GUS staining of the leaves collected from the different treatments revealed the expression of the fused proteins. Blue spots were observed on leaves inoculated with P31GUS, P31GUS-2 and −3, but the latter two frame-shift mutants produced less and smaller spots than the WT (Figure 2E). This comparative analysis permitted us to conclude that P31 translation initiation mainly occurred at the first AUG, but the second and third AUG may weakly express an incomplete protein that could not induce PR-10 expression nor severe symptoms in N. benthamiana.

Spontaneous deletions in the P31 gene coding region result in the loss of induced PR-10 expression

BNYVV isolates maintained by mechanical inoculation into leaves of hosts often accumulate specific forms of RNA-4 deletion mutants[32, 33]. On the basis of reported spontaneous deletion sequences, two deletion mutants were created: P31-ΔL and -ΔS. When comparing the spontaneous deletion mutants with WT, P31-ΔL showed the largest deletion region, aa 107–272, and P31-ΔS the smallest, aa 130–238, as was reported for mutants isolated from France[3234]. The deletion regions, nt 697–1194 and nt 768–1091, were located in the 3′-half of the P31 gene (Figure 3A). The PR-10 expression levels for BN3, P31-ΔL and -ΔS did not differ compared with WT (Figure 3B). Plants infected with the mutants had mild symptoms, such as leaf slight distortions, but little was distinguishable from the symptoms induced by BN3 (Figure 3C and D). Although the spontaneous deletion mutants did not affect the replication of BNYVV[34], they affected the expression of PR-10 and attenuated the pathogenicity of P31.

P31 is a cysteine-rich protein and most cysteines (Cys) are required for PR-10 up-regulation

Interestingly, the sequence analysis showed that P31 was rich in Cys and compared with the spontaneous deletion mutants mentioned above, most of the Cys were located in the deletion region. To examine the impact of these cysteines on PR-10 induction, alanine (Ala) scanning (substitution of Ala for Cys) was conducted for all of the Cys (C7A, C9A, C24A, C109A, C115A, C127A, C161A, C174A, C183A, C186A, C190A, C197A, C199A, C211A, C218A, C232A and C255A). Transcripts of each mutant mixed with BN3 were separately inoculated into five unfolded leaves of N. benthamiana, and different phenotypes were observed after 11 dpi. PR-10 expression levels were analyzed, and most expression patterns were in accordance with the degree of symptoms. Compared to PR-10 expression levels in plants inoculated with BN3, six Cys mutants (C174A, C183A, C186A, C190A, C197A and C199A) induced the same expression level, six Cys mutants (C7A, C9A, C24A, C109A, C211A and C218A) induced a 4- to 7-fold increase and five (C115A, C127A, C161A, C232A and C255A) induced a 10- to 15-fold increase (Figure 4A). At the same time, the severe symptoms in six substitution mutants positioned in P31174–199 disappeared compared with the WT. Four mutants (C7A, C9A, C161A and C211A) could still induce the down curling and distortion of upper leaves, but to a lesser degree than the WT. The remaining mutants (C24A, C109A, C115A, C127A, C218A, C232A and C255A) had the same leaf shape as WT. Only C24A, C109A, C115A, C127A, C218A, C232A and C255A mutants resulted in stunted plants, but others were similar to plants infected with BN3 (Figure 4B and C). These results indicated that some Cys in P31 were required for inducing PR-10 expression, and most of them (C174, C183, C186, C190, C197 and C199) were located in the cysteine-rich region. However, the effects of Cys on PR-10 and disease symptom expression differed.

Tryptophans (Trp) in P31 are also important for inducing PR-10 up-regulation

P31 has a root-specific silencing suppression function, and recent studies showed that some viral suppressors of RNA silencing mimic the host glycine/tryptophan protein to prevent gene silencing[3538]. P31 contains five Trp, and there is a glycine before the first and third Trp, respectively. Thus, we used Ala to replace Trp 103, 152, 251, 259 and 276. After 12 dpi, PR-10 expression levels in the test plants infected with the mutants appeared for the same as those infected with BN3 (Figure 5A). Symptoms were not observed except for with the W152A mutant, which showed a slight distortion of the upper leaves (Figure 5B and C). Our mutation analyses revealed that every Trp in P31 was important for inducing PR-10 up-regulation and symptom development.

P31 cannot interact directly with PR-10 in a yeast system

The PR-10 gene of N. benthamiana (NbPR10) was cloned by RT-PCR, and it was 483 bp long and capable of encoding a 160-aa peptide. There was a typical GxGGxG motif at 47–52 aa, which is known as the phosphate-binding loop (P-loop), which is frequently found in protein kinases as well as in nucleotide-binding proteins (Figure 6A)[30]. A yeast two-hybrid (YTH) assay was performed to determine whether NbPR-10 and P31 had any intrinsic ability to interact. The preliminary results indicated that they could not interact directly in yeast (Figure 6B).

Discussion

In the presence of RNA-1 and −2, RNA4 induces leaf stunting, curling and severe mosaicism with leaf distortions in N. benthamiana without affecting viral RNA accumulation[39]. BNYVV p31 plays a multifunctional role in efficient vector transmission, enhanced symptom expression and root-specific silencing suppression[13]. Here, we demonstrated that RNA4 drastically up-regulated the expression of PR-10 and PR-Q genes, but the silencing-associated genes had the same expression levels as in N. benthamiana infected with BN3. A time-course detection showed that the up-regulation of PR-10 gene in the presence of RNA4 was coincided closely with the appearance of symptoms, and that the PR-10 expression occurred slightly before the symptoms.
The PR-10 family is one of the most important families among the PR groups. Unlike most PRs, PR-10 proteins are typically intracellular, small and acidic, with similar three-dimensional structures[26, 4042]. In vitro PR-10 proteins have been reported to have ribonuclease activity, enzymatic activities in plant secondary metabolisms and roles in abiotic stresses[26]. The PR-10 family is structurally related to ribonucleases[29, 43, 44]. As reported, there is a strikingly conserved sequence motif GxGGxG at residues aa 47–52 throughout the family of intracellular PR proteins[45]. This same motif also occurred in the NbPR-10 from N. benthamiana. This motif is frequently found in protein kinases and nucleotide-binding proteins[46].
A few viruses can trigger a PR-10 response in their host[43, 4749], but the capability to cleave viral RNA remains to be determined. Some PR-10s have their strongest expression in root tissue[40, 50, 51]. BNYVV causes rhizomania disease of sugar beet, which is characterized by excessive growth of lateral roots and constriction of the taproot, and RNA4-encoded P31 is involved in root-specific silencing suppression. Our results showed that, in BN3 + 4 infected plants, PR-10 expression and symptom development occurred at similar times. This is somewhat surprising given that PR-10 is associated with inducing symptoms. However, the experiment showed that P31 could not interact directly with PR-10. Thus, P31, like P25, which interacts with transcription factors[52], works with some factors in the process of PR-10 expression. Of course, we cannot rule out the possibility that the increased PR-10 level is a response to BN3 + 4 infection, although it failed to achieve its aim of defending against virus infection. However, it can be an indirect result, a molecular marker or an indicator of symptom development. To address the relationship between PR-10 expression and symptom development, additional experiments will be required.
The RNA4-encoded putative ORF contains five potential in-frame initiation codons. Our results clearly demonstrated that the first AUG in the P31 ORF was used for expression of P31, but the second and third AUG may have weak functions in expressing an incomplete protein if the first AUG was shifted. This was indirectly demonstrated by the GUS activities. Such lower accumulation levels are probably due to a nucleotide sequence upstream of the AUG codon[53], which can down-regulate ribosome scanning and initiation at the first AUG. We viewed other proteins encoded by BNYVV, including RdRp, CP, P14 and P26, and found that these proteins also had more than one potential initiation codon in the RNA’s 5′-leader sequence[54]. This may be an expression strategy. As observed, if P31 was incomplete, then, regardless of the spontaneous deletion mutant, it could not induce PR-10 up-regulation or severe systemic symptoms in N. benthamiana. Thus, the totality of P31 is necessary for viral pathogenicity and induction of PR-10 expression[13].
Cys with its thiol side-chain often participates in enzymatic reactions. Because of its high reactivity, the thiol group of cysteine has numerous biological functions[55]. Disulfide bonds are common to many extracellular proteins, where they presumably serve to stabilize the native conformation, and the improved stability can be translated in practical terms as better resistance to environmental extremes[56, 57]. The zinc finger is a structural motif of small proteins that is characterized by the coordination of one or more zinc ions to stabilize the fold[58]. In general, zinc fingers coordinate zinc ions with a combination of Cys and histidine residues, and recently different structures have been found[59]. Beet soil borne mosaic virus (BSBMV) is a member of Benyvirus and possesses a similar genomic organization to BNYVV[60]. A putative protein, P32, is encoded by BSBMV RNA-4 (GenBank: FJ424610.2) and has a similar function to P31. For instance, it is involved in symptom expression and viral transmission through its vector P. betae[61]. A sequence alignment of P31 and P32 showed that both were rich in Cys, about 6.03% and 6.36%, respectively, and, interestingly, 12 Cys shared the same locations. Based on structural predictions, several of them may link to form disulfide bonds, and if these links are broken, then P31 is probably easily degraded. In the N-terminal sequence of P31, there is a Cys7Cys9His19Cys24 motif. Although it is not predicted to result in a zinc finger, we hypothesize that it, or another region, has a similar functional domain. P31 is involved in silencing suppression in roots[13]. P14 and P16, which are found in BNYVV and Tobacco rattle virus, have the ability to suppress transgene silencing specifically in roots. All of these are cysteine-rich proteins, so we suspect that Cys may play an important role in root suppression.
In our results, plants infected by Cys mutants showed different relationships between PR-10 expression and symptom appearance. The most prominent one, C161A, showed a seven-fold higher expression level of PR-10 than that found with a BN3 infection, but it could not induce serious symptoms. We suspect that the region containing Cys 161 was important for symptom appearance but had less impact on the interaction with factors that up-regulated PR-10 expression. Accompanying PR-10 up-regulation, P31 can induce some symptoms, but the Cys mutants showed that P31 had more than one functional motif. Determining how these motifs function will require further experiments.
Proteins that perform biological functions should interact with other protein(s), and the amino acid Trp is more conserved within protein hotspot sites[62, 63]. Different residues in proteins affect their structure and function[64]. The three-dimensional structure of P31 has not been reported, so we cannot determine the function of Trp in the protein structure. The Trp mutants resulted in the loss of PR-10 induction and disease symptoms, suggesting that Trp may be involved in protein–protein interactions between virus and host.

Materials and methods

Preparation of RNA4 mutants

DNA manipulation and cloning were performed as described by Sambrook et al.[65]. The mutants used in the experiment were produced by PCR-based, oligonucleotide-directed mutagenesis based on full-length RNA4 cDNA clone pUOF1-6[13]. Amino acid scanning mutants were also obtained by site-directed mutagenesis. All constructs were examined for sequence integrity.

Plants, viruses and viral inoculations

T. expansa and N. benthamiana were used for viral propagation and the observation of symptom phenotypes[13, 21]. The BNVYY laboratory isolated BN3 (RNA1 + 2 + 3) was used[66]. Unless otherwise stated, virus isolates were propagated in inoculated leaves of T. expansa. Infectious cDNA clones were linearized by Xba I and transcribed at 37°C for 2 h with a T7 RNA polymerase kit as described by the manufacturer (Promega). The leaves of test plants were inoculated with the in vitro-synthesized transcripts from each cDNA clone mixed with BN3. Local lesions generally appeared at 5–8 dpi, while systemic symptoms in N. benthamiana appeared at 10–12 dpi.

RNA extraction and reverse transcription (RT) PCR

Total RNA was extracted from 0.2 g of top leaves of tested N. benthamiana and used for RT-PCR detection[67]. RT-PCR was conducted using Moloney Murine Leukemia Virus Reverse Transcriptase as described by the manufacturer (Promega). cDNA was synthesized from 3 μg total RNA with oligo(dT) primer. The primers used for BNYVV detection were described previously[39]. Each experiment was repeated at least two times, and four plants were inoculated with each mutant. The total RNA extracted from each plant was tested separately by RT-PCR and qPCR.

qPCR

cDNA synthesized by RT was used for qPCR. The qPCR was performed using a Bio-RAD CFX96 Touchâ„¢ Real-Time PCR Detection System according to the manufacturer’s instructions, and the primer pairs used for qPCR are found in Table 1. The level of PP2A transcript amplified with primer pair PP2A-F and PP2A-R was used as an internal control. Quantification and statistical analysis of the qPCR results were performed using the software Bio-Rad CFX Manager Version 3.1 (Bio-Rad Laboratories Inc.).

GUS histochemistry

Freshly tested plant samples were incubated for 4–12 h at 37°C in the darkness in sufficient X-Gluc staining buffer (2 mM 5-bromo-4-chloro-3-indolyl β-D-glucuronic acid, 100 mM sodium phosphate buffer at pH 7.0, 10 mM EDTA, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide and 0.1% Triton X-100). Then, chlorophyll was removed with 70% (v/v) ethanol at room temperature.

Cloning of a new pathogenesis-related protein 10 gene from N. benthamiana

During a database (http://​solgenomics.​net/​) search with Nicotiana tabacum PR-10 (GenBank ID:JQ041907), a sequence from N. benthamiana highly homologous to NtPR-10 was identified. A pair of specific primers (PR10-forward: 5′-ATGGGTGTCACTACCTATACTCATG-3′ and PR10-reverse: 5′-TTAAACATAGAGAGAAGGATTAGCG-3′) were synthesized based on the newly identified sequence to clone the putative PR-10 gene (NbPR-10). Total RNA was isolated from young N. benthamiana leaves infected by BN3 + 4 and was reverse-transcribed to cDNA. The PCR product was gel purified and ligated into a pMD19-T vector (Takara) to obtain pMD–NbPR10 and confirmed through DNA sequencing.

YTH assays

The yeast strains, Saccharomyces cerevisiae AH109 and Y187, and the yeast vectors, pGBKT7 and pGADT7, as well as the positive control plasmids, pGBKT7-T and pGADT7-P53, were used for YTH analyses (Clontech). The fragments of NbPR-10 and P31 were ligated to pGBKT7 and pGADT7, respectively. Yeast transformations were conducted using the small-scale lithium acetate method. YTH assays were performed using the Matchmaker GAL4 Two-Hybrid System3 (Clontech), according to the manufacturer’s protocols. Co-transformants were plated on synthetic defined (SD) minimal medium minus adenine, histidine, leucine and tryptophan (SD/–Ade/–His/–Leu/–Trp).

Acknowledgements

This work was in part supported by the earmarked fund for China Agriculture Research System (CARS-2102), the Program for Changjiang Scholars and Innovative Research Team in University (IRT1042) and the National Natural Science Foundation of China (30671359 and 30471136).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

WQW, HYF and NJ performed the experiments. YW, ZYZ, YLZ, XBW, DWL, JLY contributed reagents/materials/analysis tools. CGH conceived of the study and participated in its design and coordination. WQW, YW and CGH wrote the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Tamada T, Baba T: Beet necrotic yellow vein virus from rizomania-affected sugar beet in Japan. Ann Phytopathol Soc Jpn 1973, 39: 325-332.CrossRef Tamada T, Baba T: Beet necrotic yellow vein virus from rizomania-affected sugar beet in Japan. Ann Phytopathol Soc Jpn 1973, 39: 325-332.CrossRef
2.
Zurück zum Zitat Tamada T, Abe H: Evidence that beet necrotic yellow vein virus RNA-4 is essential for efficient transmission by the fungus Polymyxa betae. J Gen Virol 1989, 70: 3391-3398.CrossRef Tamada T, Abe H: Evidence that beet necrotic yellow vein virus RNA-4 is essential for efficient transmission by the fungus Polymyxa betae. J Gen Virol 1989, 70: 3391-3398.CrossRef
3.
Zurück zum Zitat Canova A: On the pathology of sugar beet. Informatore Fitopatologico 1959, 9: 390-396. Canova A: On the pathology of sugar beet. Informatore Fitopatologico 1959, 9: 390-396.
4.
Zurück zum Zitat Schirmer A, Link D, Cognat V, Moury B, Beuve M, Meunier A, Bragard C, Gilmer D, Lemaire O: Phylogenetic analysis of isolates of Beet necrotic yellow vein virus collected worldwide. J Gen Virol 2005, 86: 2897-2911.PubMedCrossRef Schirmer A, Link D, Cognat V, Moury B, Beuve M, Meunier A, Bragard C, Gilmer D, Lemaire O: Phylogenetic analysis of isolates of Beet necrotic yellow vein virus collected worldwide. J Gen Virol 2005, 86: 2897-2911.PubMedCrossRef
5.
Zurück zum Zitat Putz C, Vuittenez A: The intracellular location of beet necrotic yellow vein virus . J Gen Virol 1980, 50: 201-204.CrossRef Putz C, Vuittenez A: The intracellular location of beet necrotic yellow vein virus . J Gen Virol 1980, 50: 201-204.CrossRef
7.
Zurück zum Zitat Koenig R, Jarausch W, Li Y, Commandeur U, Burgermeister W, Gehrke M, Luddecke P: Effect of recombinant beet necrotic yellow vein virus with different RNA compositions on mechanically inoculated sugarbeets. J Gen Virol 1991,72(Pt 9):2243-2246.PubMedCrossRef Koenig R, Jarausch W, Li Y, Commandeur U, Burgermeister W, Gehrke M, Luddecke P: Effect of recombinant beet necrotic yellow vein virus with different RNA compositions on mechanically inoculated sugarbeets. J Gen Virol 1991,72(Pt 9):2243-2246.PubMedCrossRef
8.
Zurück zum Zitat Chiba S, Hleibieh K, Delbianco A, Klein E, Ratti C, Ziegler-Graff V, Bouzoubaa S, Gilmer D: The benyvirus RNA silencing suppressor is essential for long-distance movement, requires both zinc-finger and NoLS basic residues but not a nucleolar localization for its silencing-suppression activity. Mol Plant Microbe Interact 2013, 26: 168-181.PubMedCrossRef Chiba S, Hleibieh K, Delbianco A, Klein E, Ratti C, Ziegler-Graff V, Bouzoubaa S, Gilmer D: The benyvirus RNA silencing suppressor is essential for long-distance movement, requires both zinc-finger and NoLS basic residues but not a nucleolar localization for its silencing-suppression activity. Mol Plant Microbe Interact 2013, 26: 168-181.PubMedCrossRef
9.
Zurück zum Zitat Andika IB, Kondo H, Nishiguchi M, Tamada T: The cysteine-rich proteins of Beet necrotic yellow vein virus and Tobacco rattle virus contribute to efficient suppression of silencing in roots. J Gen Virol 2012, 93: 1841-1850.PubMedCrossRef Andika IB, Kondo H, Nishiguchi M, Tamada T: The cysteine-rich proteins of Beet necrotic yellow vein virus and Tobacco rattle virus contribute to efficient suppression of silencing in roots. J Gen Virol 2012, 93: 1841-1850.PubMedCrossRef
10.
Zurück zum Zitat Dunoyer P, Pfeffer S, Fritsch C, Hemmer O, Voinnet O, Richards KE: Identification, subcellular localization and some properties of a cysteine-rich suppressor of gene silencing encoded by peanut clump virus. Plant J 2002, 29: 555-567.PubMedCrossRef Dunoyer P, Pfeffer S, Fritsch C, Hemmer O, Voinnet O, Richards KE: Identification, subcellular localization and some properties of a cysteine-rich suppressor of gene silencing encoded by peanut clump virus. Plant J 2002, 29: 555-567.PubMedCrossRef
11.
Zurück zum Zitat Tamada T, Kusume T: Evidence that the 75 K readthrough protein of beet necrotic yellow vein virus RNA-2 is essential for transmission by the fungus Polymyxa betae . J Gen Virol 1991,72(Pt 7):1497-1504.PubMedCrossRef Tamada T, Kusume T: Evidence that the 75 K readthrough protein of beet necrotic yellow vein virus RNA-2 is essential for transmission by the fungus Polymyxa betae . J Gen Virol 1991,72(Pt 7):1497-1504.PubMedCrossRef
12.
Zurück zum Zitat Peltier C, Klein E, Hleibieh K, D'Alonzo M, Hammann P, Bouzoubaa S, Ratti C, Gilmer D: Beet necrotic yellow vein virus subgenomic RNA3 is a cleavage product leading to stable non-coding RNA required for long-distance movement. J Gen Virol 2012, 93: 1093-1102.PubMedCrossRef Peltier C, Klein E, Hleibieh K, D'Alonzo M, Hammann P, Bouzoubaa S, Ratti C, Gilmer D: Beet necrotic yellow vein virus subgenomic RNA3 is a cleavage product leading to stable non-coding RNA required for long-distance movement. J Gen Virol 2012, 93: 1093-1102.PubMedCrossRef
13.
Zurück zum Zitat Rahim MD, Andika IB, Han C, Kondo H, Tamada T: RNA4-encoded p31 of Beet necrotic yellow vein virus is involved in efficient vector transmission, symptom severity and silencing suppression in roots. J Gen Virol 2007, 88: 1611-1619.PubMedCrossRef Rahim MD, Andika IB, Han C, Kondo H, Tamada T: RNA4-encoded p31 of Beet necrotic yellow vein virus is involved in efficient vector transmission, symptom severity and silencing suppression in roots. J Gen Virol 2007, 88: 1611-1619.PubMedCrossRef
14.
Zurück zum Zitat Lemaire O, Merdinoglu D, Valentin P, Putz C, Ziegler-Graff V, Guilley H, Jonard G, Richards K: Effect of beet necrotic yellow vein virus RNA composition on transmission by Polymyxa betae . Virology 1988, 162: 232-235.PubMedCrossRef Lemaire O, Merdinoglu D, Valentin P, Putz C, Ziegler-Graff V, Guilley H, Jonard G, Richards K: Effect of beet necrotic yellow vein virus RNA composition on transmission by Polymyxa betae . Virology 1988, 162: 232-235.PubMedCrossRef
15.
Zurück zum Zitat Richards KE, Tamada T: Mapping functions on the multipartite genome of Beet necrotic yellow vein virus . Annu Rev Phytopathol 1992, 30: 291-313.CrossRef Richards KE, Tamada T: Mapping functions on the multipartite genome of Beet necrotic yellow vein virus . Annu Rev Phytopathol 1992, 30: 291-313.CrossRef
16.
Zurück zum Zitat Chiba S, Miyanishi M, Andika IB, Kondo H, Tamada T: Identification of amino acids of the beet necrotic yellow vein virus p25 protein required for induction of the resistance response in leaves of Beta vulgaris plants. J Gen Virol 2008, 89: 1314-1323.PubMedCrossRef Chiba S, Miyanishi M, Andika IB, Kondo H, Tamada T: Identification of amino acids of the beet necrotic yellow vein virus p25 protein required for induction of the resistance response in leaves of Beta vulgaris plants. J Gen Virol 2008, 89: 1314-1323.PubMedCrossRef
17.
Zurück zum Zitat Klein E, Link D, Schirmer A, Erhardt M, Gilmer D: Sequence variation within Beet necrotic yellow vein virus p25 protein influences its oligomerization and isolate pathogenicity on Tetragonia expansa . Virus Res 2007, 126: 53-61.PubMedCrossRef Klein E, Link D, Schirmer A, Erhardt M, Gilmer D: Sequence variation within Beet necrotic yellow vein virus p25 protein influences its oligomerization and isolate pathogenicity on Tetragonia expansa . Virus Res 2007, 126: 53-61.PubMedCrossRef
18.
Zurück zum Zitat Vetter G, Hily JM, Klein E, Schmidlin L, Haas M, Merkle T, Gilmer D: Nucleo-cytoplasmic shuttling of the beet necrotic yellow vein virus RNA-3-encoded p25 protein. J Gen Virol 2004, 85: 2459-2469.PubMedCrossRef Vetter G, Hily JM, Klein E, Schmidlin L, Haas M, Merkle T, Gilmer D: Nucleo-cytoplasmic shuttling of the beet necrotic yellow vein virus RNA-3-encoded p25 protein. J Gen Virol 2004, 85: 2459-2469.PubMedCrossRef
19.
Zurück zum Zitat Tamada T, Uchino H, Kusume T, Saito M: RNA 3 deletion mutants of beet necrotic yellow vein virus do not cause rhizomania disease in sugar beets. Phytopathology 1999, 89: 1000-1006.PubMedCrossRef Tamada T, Uchino H, Kusume T, Saito M: RNA 3 deletion mutants of beet necrotic yellow vein virus do not cause rhizomania disease in sugar beets. Phytopathology 1999, 89: 1000-1006.PubMedCrossRef
20.
Zurück zum Zitat Jupin I, Guilley H, Richards KE, Jonard G: Two proteins encoded by beet necrotic yellow vein virus RNA 3 influence symptom phenotype on leaves. EMBO J 1992, 11: 479-488.PubMedPubMedCentral Jupin I, Guilley H, Richards KE, Jonard G: Two proteins encoded by beet necrotic yellow vein virus RNA 3 influence symptom phenotype on leaves. EMBO J 1992, 11: 479-488.PubMedPubMedCentral
21.
Zurück zum Zitat Tamada T, Shirako Y, Abe H, Saito M, Kiguchi T, Harada T: Production and pathogenicity of isolates of beet necrotic yellow vein virus with different numbers of RNA components. J Gen Virol 1989, 70: 3399-3409.CrossRef Tamada T, Shirako Y, Abe H, Saito M, Kiguchi T, Harada T: Production and pathogenicity of isolates of beet necrotic yellow vein virus with different numbers of RNA components. J Gen Virol 1989, 70: 3399-3409.CrossRef
22.
Zurück zum Zitat Ward L, Koenig R, Budge G, Garrido C, McGrath C, Stubbley H, Boonham N: Occurrence of two different types of RNA-5-containing beet necrotic yellow vein virus in the UK. Arch Virol 2007, 152: 59-73.PubMedCrossRef Ward L, Koenig R, Budge G, Garrido C, McGrath C, Stubbley H, Boonham N: Occurrence of two different types of RNA-5-containing beet necrotic yellow vein virus in the UK. Arch Virol 2007, 152: 59-73.PubMedCrossRef
23.
Zurück zum Zitat Miyanishi M, Kusume T, Saito M, Tamada T: Evidence for three groups of sequence variants of beet necrotic yellow vein virus RNA 5. Arch Virol 1999, 144: 879-892.PubMedCrossRef Miyanishi M, Kusume T, Saito M, Tamada T: Evidence for three groups of sequence variants of beet necrotic yellow vein virus RNA 5. Arch Virol 1999, 144: 879-892.PubMedCrossRef
24.
Zurück zum Zitat Andika IB, Kondo H, Tamada T: Evidence that RNA silencing-mediated resistance to Beet necrotic yellow vein virus is less effective in roots than in leaves. Mol Plant Microbe Interact 2005, 18: 194-204.PubMedCrossRef Andika IB, Kondo H, Tamada T: Evidence that RNA silencing-mediated resistance to Beet necrotic yellow vein virus is less effective in roots than in leaves. Mol Plant Microbe Interact 2005, 18: 194-204.PubMedCrossRef
25.
Zurück zum Zitat Van Loon L, Rep M, Pieterse C: Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 2006, 44: 135-162.PubMedCrossRef Van Loon L, Rep M, Pieterse C: Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 2006, 44: 135-162.PubMedCrossRef
26.
Zurück zum Zitat Liu J-J, Ekramoddoullah AKM: The family 10 of plant pathogenesis-related proteins: their structure, regulation, and function in response to biotic and abiotic stresses. Physiol Mol Plant Pathol 2006, 68: 3-13.CrossRef Liu J-J, Ekramoddoullah AKM: The family 10 of plant pathogenesis-related proteins: their structure, regulation, and function in response to biotic and abiotic stresses. Physiol Mol Plant Pathol 2006, 68: 3-13.CrossRef
27.
Zurück zum Zitat Christensen AB, Cho BH, Næsby M, Gregersen PL, Brandt J, Madriz‐Ordeñana K, Collinge DB, Thordal‐Christensen H: The molecular characterization of two barley proteins establishes the novel PR-17 family of pathogenesis-related proteins. Mol Plant Pathol 2002, 3: 135-144.PubMedCrossRef Christensen AB, Cho BH, Næsby M, Gregersen PL, Brandt J, Madriz‐Ordeñana K, Collinge DB, Thordal‐Christensen H: The molecular characterization of two barley proteins establishes the novel PR-17 family of pathogenesis-related proteins. Mol Plant Pathol 2002, 3: 135-144.PubMedCrossRef
28.
Zurück zum Zitat Van Loon L, Van Strien E: The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 1999, 55: 85-97.CrossRef Van Loon L, Van Strien E: The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 1999, 55: 85-97.CrossRef
29.
Zurück zum Zitat Fernandes H, Michalska K, Sikorski M, Jaskolski M: Structural and functional aspects of PR-10 proteins. FEBS J 2013, 280: 1169-1199.PubMedCrossRef Fernandes H, Michalska K, Sikorski M, Jaskolski M: Structural and functional aspects of PR-10 proteins. FEBS J 2013, 280: 1169-1199.PubMedCrossRef
30.
Zurück zum Zitat Srivastava S, Emery RN, Kurepin LV, Reid DM, Fristensky B, Kav NN: Pea PR 10.1 is a ribonuclease and its transgenic expression elevates cytokinin levels. Plant Growth Regul 2006, 49: 17-25.CrossRef Srivastava S, Emery RN, Kurepin LV, Reid DM, Fristensky B, Kav NN: Pea PR 10.1 is a ribonuclease and its transgenic expression elevates cytokinin levels. Plant Growth Regul 2006, 49: 17-25.CrossRef
31.
Zurück zum Zitat Quillet L, Guilley H, Jonard G, Richards K: In vitro synthesis of biologically active Beet necrotic yellow vein virus RNA. Virology 1989, 172: 293-301.PubMedCrossRef Quillet L, Guilley H, Jonard G, Richards K: In vitro synthesis of biologically active Beet necrotic yellow vein virus RNA. Virology 1989, 172: 293-301.PubMedCrossRef
32.
Zurück zum Zitat Bouzoubaa S, Guilley H, Jonard G, Richards K, Putz C: Nucleotide Sequence Analysis of RNA-3 and RNA-4 of Beet Necrotic Yellow Vein Virus , Isolates F2 and G1. J Gen Virol 1985, 66: 1553-1564.CrossRef Bouzoubaa S, Guilley H, Jonard G, Richards K, Putz C: Nucleotide Sequence Analysis of RNA-3 and RNA-4 of Beet Necrotic Yellow Vein Virus , Isolates F2 and G1. J Gen Virol 1985, 66: 1553-1564.CrossRef
33.
Zurück zum Zitat Chenggui H, Dawei L, Jialin Y, Shucai Q, Lili Y, Han C, Li D, Yu J, Qin S, Yang L, Liu Y: Location of the deleted sequence of spontaneously deleted RNAs of Beet Necrotic Yellow Vein Virus NM lsolate. Chin J Virol 2000, 16: 49-53.CrossRef Chenggui H, Dawei L, Jialin Y, Shucai Q, Lili Y, Han C, Li D, Yu J, Qin S, Yang L, Liu Y: Location of the deleted sequence of spontaneously deleted RNAs of Beet Necrotic Yellow Vein Virus NM lsolate. Chin J Virol 2000, 16: 49-53.CrossRef
34.
Zurück zum Zitat Bouzoubaa S, Niesbach-Klosgen U, Jupin I, Guilley H, Richards K, Jonard G: Shortened forms of Beet necrotic yellow vein virus RNA-3 and −4: internal deletions and a subgenomic RNA. J Gen Virol 1991,72(Pt 2):259-266.PubMedCrossRef Bouzoubaa S, Niesbach-Klosgen U, Jupin I, Guilley H, Richards K, Jonard G: Shortened forms of Beet necrotic yellow vein virus RNA-3 and −4: internal deletions and a subgenomic RNA. J Gen Virol 1991,72(Pt 2):259-266.PubMedCrossRef
35.
Zurück zum Zitat Burgyán J, Havelda Z: Viral suppressors of RNA silencing. Trends Plant Sci 2011, 16: 265-272.PubMedCrossRef Burgyán J, Havelda Z: Viral suppressors of RNA silencing. Trends Plant Sci 2011, 16: 265-272.PubMedCrossRef
37.
Zurück zum Zitat Giner A, Lakatos L, García-Chapa M, López-Moya JJ, Burgyán J: Viral protein inhibits RISC activity by argonaute binding through conserved WG/GW motifs. PLoS Pathog 2010, 6: e1000996.PubMedPubMedCentralCrossRef Giner A, Lakatos L, García-Chapa M, López-Moya JJ, Burgyán J: Viral protein inhibits RISC activity by argonaute binding through conserved WG/GW motifs. PLoS Pathog 2010, 6: e1000996.PubMedPubMedCentralCrossRef
38.
Zurück zum Zitat Azevedo J, Garcia D, Pontier D, Ohnesorge S, Yu A, Garcia S, Braun L, Bergdoll M, Hakimi MA, Lagrange T: Argonaute quenching and global changes in Dicer homeostasis caused by a pathogen-encoded GW repeat protein. Genes Dev 2010, 24: 904-915.PubMedPubMedCentralCrossRef Azevedo J, Garcia D, Pontier D, Ohnesorge S, Yu A, Garcia S, Braun L, Bergdoll M, Hakimi MA, Lagrange T: Argonaute quenching and global changes in Dicer homeostasis caused by a pathogen-encoded GW repeat protein. Genes Dev 2010, 24: 904-915.PubMedPubMedCentralCrossRef
39.
Zurück zum Zitat Wang Y, Fan H, Wang XB, Li M, Han C, Li D, Yu J: Detection and characterization of spontaneous internal deletion mutants of Beet necrotic yellow vein virus RNA3 from systemic host Nicotiana benthamiana . Virol J 2011, 8: 335.PubMedPubMedCentralCrossRef Wang Y, Fan H, Wang XB, Li M, Han C, Li D, Yu J: Detection and characterization of spontaneous internal deletion mutants of Beet necrotic yellow vein virus RNA3 from systemic host Nicotiana benthamiana . Virol J 2011, 8: 335.PubMedPubMedCentralCrossRef
40.
Zurück zum Zitat Xie Y-R, Chen Z-Y, Brown RL, Bhatnagar D: Expression and functional characterization of two pathogenesis-related protein 10 genes from Zea mays . J Plant Physiol 2010, 167: 121-130.PubMedCrossRef Xie Y-R, Chen Z-Y, Brown RL, Bhatnagar D: Expression and functional characterization of two pathogenesis-related protein 10 genes from Zea mays . J Plant Physiol 2010, 167: 121-130.PubMedCrossRef
41.
Zurück zum Zitat Ziadi S, Poupard P, Brisset M-n, Paulin J-P, Simoneau P: Characterization in apple leaves of two subclasses of PR-10 transcripts inducible by acibenzolar-S-methyl, a functional analogue of salicylic acid. Physiol Mol Plant Pathol 2001, 59: 33-43.CrossRef Ziadi S, Poupard P, Brisset M-n, Paulin J-P, Simoneau P: Characterization in apple leaves of two subclasses of PR-10 transcripts inducible by acibenzolar-S-methyl, a functional analogue of salicylic acid. Physiol Mol Plant Pathol 2001, 59: 33-43.CrossRef
42.
Zurück zum Zitat Liu X, Huang B, Lin J, Fei J, Chen Z, Pang Y, Sun X, Tang K: A novel pathogenesis-related protein (SsPR10) from Solanum surattense with ribonucleolytic and antimicrobial activity is stress-and pathogen-inducible. J Plant Physiol 2006, 163: 546-556.PubMedCrossRef Liu X, Huang B, Lin J, Fei J, Chen Z, Pang Y, Sun X, Tang K: A novel pathogenesis-related protein (SsPR10) from Solanum surattense with ribonucleolytic and antimicrobial activity is stress-and pathogen-inducible. J Plant Physiol 2006, 163: 546-556.PubMedCrossRef
43.
Zurück zum Zitat Park CJ, Kim KJ, Shin R, Park JM, Shin YC, Paek KH: Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J 2004, 37: 186-198.PubMedCrossRef Park CJ, Kim KJ, Shin R, Park JM, Shin YC, Paek KH: Pathogenesis-related protein 10 isolated from hot pepper functions as a ribonuclease in an antiviral pathway. Plant J 2004, 37: 186-198.PubMedCrossRef
44.
Zurück zum Zitat Moiseyev GP, Fedoreyeva LI, Zhuravlev YN, Yasnetskaya E, Jekel PA, Beintema JJ: Primary structures of two ribonucleases from ginseng calluses: New members of the PR-10 family of intracellular pathogenesis-related plant proteins. FEBS Lett 1997, 407: 207-210.PubMedCrossRef Moiseyev GP, Fedoreyeva LI, Zhuravlev YN, Yasnetskaya E, Jekel PA, Beintema JJ: Primary structures of two ribonucleases from ginseng calluses: New members of the PR-10 family of intracellular pathogenesis-related plant proteins. FEBS Lett 1997, 407: 207-210.PubMedCrossRef
45.
Zurück zum Zitat Hoffmann-Sommergruber K, Vanek-Krebitz M, Radauer C, Wen J, Ferreira F, Scheiner O, Breiteneder H: Genomic characterization of members of the Bet v 1 family: genes coding for allergens and pathogenesis-related proteins share intron positions. Gene 1997, 197: 91-100.PubMedCrossRef Hoffmann-Sommergruber K, Vanek-Krebitz M, Radauer C, Wen J, Ferreira F, Scheiner O, Breiteneder H: Genomic characterization of members of the Bet v 1 family: genes coding for allergens and pathogenesis-related proteins share intron positions. Gene 1997, 197: 91-100.PubMedCrossRef
46.
Zurück zum Zitat Saraste M, Sibbald PR, Wittinghofer A: The P-loop—a common motif in ATP-and GTP-binding proteins. Trends Biochem Sci 1990, 15: 430-434.PubMedCrossRef Saraste M, Sibbald PR, Wittinghofer A: The P-loop—a common motif in ATP-and GTP-binding proteins. Trends Biochem Sci 1990, 15: 430-434.PubMedCrossRef
47.
Zurück zum Zitat Xu P, Blancaflor EB, Roossinck MJ: In spite of induced multiple defense responses, tomato plants infected with Cucumber mosaic virus and D satellite RNA succumb to systemic necrosis. Mol Plant Microbe Interact 2003, 16: 467-476.PubMedCrossRef Xu P, Blancaflor EB, Roossinck MJ: In spite of induced multiple defense responses, tomato plants infected with Cucumber mosaic virus and D satellite RNA succumb to systemic necrosis. Mol Plant Microbe Interact 2003, 16: 467-476.PubMedCrossRef
48.
Zurück zum Zitat Pühringer H, Moll D, Hoffmann-Sommergruber K, Watillon B, Katinger H, da Câmara Machado ML: The promoter of an apple Ypr10 gene, encoding the major allergen Mal d 1, is stress-and pathogen-inducible. Plant Sci 2000, 152: 35-50.CrossRef Pühringer H, Moll D, Hoffmann-Sommergruber K, Watillon B, Katinger H, da Câmara Machado ML: The promoter of an apple Ypr10 gene, encoding the major allergen Mal d 1, is stress-and pathogen-inducible. Plant Sci 2000, 152: 35-50.CrossRef
49.
50.
Zurück zum Zitat Hashimoto M, Kisseleva L, Sawa S, Furukawa T, Komatsu S, Koshiba T: A novel rice PR10 protein, RSOsPR10, specifically induced in roots by biotic and abiotic stresses, possibly via the jasmonic acid signaling pathway. Plant Cell Physiol 2004, 45: 550-559.PubMedCrossRef Hashimoto M, Kisseleva L, Sawa S, Furukawa T, Komatsu S, Koshiba T: A novel rice PR10 protein, RSOsPR10, specifically induced in roots by biotic and abiotic stresses, possibly via the jasmonic acid signaling pathway. Plant Cell Physiol 2004, 45: 550-559.PubMedCrossRef
51.
Zurück zum Zitat Liu JJ, Ekramoddoullah AK, Yu X: Differential expression of multiple PR10 proteins in western white pine following wounding, fungal infection and cold‐hardening. Physiol Plant 2003, 119: 544-553.CrossRef Liu JJ, Ekramoddoullah AK, Yu X: Differential expression of multiple PR10 proteins in western white pine following wounding, fungal infection and cold‐hardening. Physiol Plant 2003, 119: 544-553.CrossRef
52.
Zurück zum Zitat Thiel H, Varrelmann M: Identification of Beet necrotic yellow vein virus P25 pathogenicity factor-interacting sugar beet proteins that represent putative virus targets or components of plant resistance. Mol Plant Microbe Interact 2009, 22: 999-1010.PubMedCrossRef Thiel H, Varrelmann M: Identification of Beet necrotic yellow vein virus P25 pathogenicity factor-interacting sugar beet proteins that represent putative virus targets or components of plant resistance. Mol Plant Microbe Interact 2009, 22: 999-1010.PubMedCrossRef
53.
Zurück zum Zitat Kozak M: At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol 1987, 196: 947-950.PubMedCrossRef Kozak M: At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol 1987, 196: 947-950.PubMedCrossRef
54.
Zurück zum Zitat Link D, Schmidlin L, Schirmer A, Klein E, Erhardt M, Geldreich A, Lemaire O, Gilmer D: Functional characterization of the Beet necrotic yellow vein virus RNA-5-encoded p26 protein: evidence for structural pathogenicity determinants. J Gen Virol 2005, 86: 2115-2125.PubMedCrossRef Link D, Schmidlin L, Schirmer A, Klein E, Erhardt M, Geldreich A, Lemaire O, Gilmer D: Functional characterization of the Beet necrotic yellow vein virus RNA-5-encoded p26 protein: evidence for structural pathogenicity determinants. J Gen Virol 2005, 86: 2115-2125.PubMedCrossRef
55.
Zurück zum Zitat Jocelyn PC: Biochemistry of the SH Group. London: Academic Press; 1972. Jocelyn PC: Biochemistry of the SH Group. London: Academic Press; 1972.
56.
Zurück zum Zitat Abkevich V, Shakhnovich E: What can disulfide bonds tell us about protein energetics, function and folding: simulations and bioninformatics analysis. J Mol Biol 2000, 300: 975-985.PubMedCrossRef Abkevich V, Shakhnovich E: What can disulfide bonds tell us about protein energetics, function and folding: simulations and bioninformatics analysis. J Mol Biol 2000, 300: 975-985.PubMedCrossRef
57.
Zurück zum Zitat Anfinsen CB: Principles that govern the folding of protein chains. Science 1973, 181: 223-230.PubMedCrossRef Anfinsen CB: Principles that govern the folding of protein chains. Science 1973, 181: 223-230.PubMedCrossRef
58.
Zurück zum Zitat Klug A, Rhodes D: ‘Zinc fingers’: a novel protein motif for nucleic acid recognition. Trends Biochem Sci 1987, 12: 464-469.CrossRef Klug A, Rhodes D: ‘Zinc fingers’: a novel protein motif for nucleic acid recognition. Trends Biochem Sci 1987, 12: 464-469.CrossRef
59.
60.
Zurück zum Zitat Lee L, Telford EB, Batten JS, Scholthof KB, Rush CM: Complete nucleotide sequence and genome organization of Beet soilborne mosaic virus , a proposed member of the genus Benyvirus . Arch Virol 2001, 146: 2443-2453.PubMedCrossRef Lee L, Telford EB, Batten JS, Scholthof KB, Rush CM: Complete nucleotide sequence and genome organization of Beet soilborne mosaic virus , a proposed member of the genus Benyvirus . Arch Virol 2001, 146: 2443-2453.PubMedCrossRef
61.
Zurück zum Zitat D'Alonzo M, Delbianco A, Lanzoni C, Autonell CR, Gilmer D, Ratti C: Beet soil-borne mosaic virus RNA-4 encodes a 32 kDa protein involved in symptom expression and in virus transmission through Polymyxa betae . Virology 2012, 423: 187-194.PubMedCrossRef D'Alonzo M, Delbianco A, Lanzoni C, Autonell CR, Gilmer D, Ratti C: Beet soil-borne mosaic virus RNA-4 encodes a 32 kDa protein involved in symptom expression and in virus transmission through Polymyxa betae . Virology 2012, 423: 187-194.PubMedCrossRef
62.
Zurück zum Zitat Ma B, Nussinov R: Trp/Met/Phe hot spots in protein-protein interactions: potential targets in drug design. Curr Top Med Chem 2007, 7: 999-1005.PubMedCrossRef Ma B, Nussinov R: Trp/Met/Phe hot spots in protein-protein interactions: potential targets in drug design. Curr Top Med Chem 2007, 7: 999-1005.PubMedCrossRef
63.
Zurück zum Zitat Ma B, Elkayam T, Wolfson H, Nussinov R: Protein–protein interactions: structurally conserved residues distinguish between binding sites and exposed protein surfaces. Proc Natl Acad Sci 2003, 100: 5772-5777.PubMedPubMedCentralCrossRef Ma B, Elkayam T, Wolfson H, Nussinov R: Protein–protein interactions: structurally conserved residues distinguish between binding sites and exposed protein surfaces. Proc Natl Acad Sci 2003, 100: 5772-5777.PubMedPubMedCentralCrossRef
64.
Zurück zum Zitat Welfle H, Missel Witz R, Welfle K, Schindelin H, Scholtz AS, Heinemann U: Conformations and conformational changes of four Phe → Trp variants of the DNA‐binding histone‐like protein, HBsu, from Bacillus subtilis studied by circular dichroism and fluorescence spectroscopy. Eur J Biochem 1993, 217: 849-856.PubMedCrossRef Welfle H, Missel Witz R, Welfle K, Schindelin H, Scholtz AS, Heinemann U: Conformations and conformational changes of four Phe → Trp variants of the DNA‐binding histone‐like protein, HBsu, from Bacillus subtilis studied by circular dichroism and fluorescence spectroscopy. Eur J Biochem 1993, 217: 849-856.PubMedCrossRef
65.
Zurück zum Zitat Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning. New York: Cold spring harbor laboratory press; 1989. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning. New York: Cold spring harbor laboratory press; 1989.
66.
Zurück zum Zitat Liu T, Han C, Li D, Cai Z, Yu J, Liu Y: Effect of the RNA5 component on pathogenicity of beet necrotic yellow vein virus. Chin Sci Bull 2003, 48: 796-799.CrossRef Liu T, Han C, Li D, Cai Z, Yu J, Liu Y: Effect of the RNA5 component on pathogenicity of beet necrotic yellow vein virus. Chin Sci Bull 2003, 48: 796-799.CrossRef
67.
Zurück zum Zitat Liu D, Shi L, Han C, Yu J, Li D, Zhang Y: Validation of reference genes for gene expression studies in virus-infected Nicotiana benthamiana using quantitative real-time PCR. PLoS One 2012, 7: e46451.PubMedPubMedCentralCrossRef Liu D, Shi L, Han C, Yu J, Li D, Zhang Y: Validation of reference genes for gene expression studies in virus-infected Nicotiana benthamiana using quantitative real-time PCR. PLoS One 2012, 7: e46451.PubMedPubMedCentralCrossRef
Metadaten
Titel
Infection of Beet necrotic yellow vein virus with RNA4-encoded P31 specifically up-regulates pathogenesis-related protein 10 in Nicotiana benthamiana
verfasst von
Wen-Qi Wu
Hui-Yan Fan
Ning Jiang
Ying Wang
Zong-Ying Zhang
Yong-Liang Zhang
Xian-Bing Wang
Da-Wei Li
Jia-Lin Yu
Cheng-Gui Han
Publikationsdatum
01.12.2014
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2014
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/1743-422X-11-118

Weitere Artikel der Ausgabe 1/2014

Virology Journal 1/2014 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.