Background
Angiogenesis is a process of new blood vessel formation from the preexisting vasculature. This process is mainly controlled by the interactions between two vascular cell types, endothelial cells (ECs), and pericytes (PCs) [
1]. Although the role of ECs in angiogenesis has been extensively studied, that of PCs remains unclear except for in-vessel stabilization and paracrine signalling [
2]. Previously, we revealed that KAI1 is a hypoxia-responsible gene and expressed in the ischemic myocardium and hypoxic bone marrow stem cell niche [
3]. KAI1/CD82, a transmembrane protein and a member of the tetraspanin superfamily, is an evolutionally conserved molecule expressed in various tissue types. First identified to be involved in the T cell activation process, KAI1 is typically considered as a suppressor of metastasis. Most studies of KAI1 examined its function in suppressing metastasis and angiogenesis mainly in cancer cells and endothelial cells [
4]. Recently, we and others have reported that KAI1 regulates the cell cycle progression of the long-term repopulating hematopoietic stem cells (LT-HSCs) [
5,
6] and muscle stem-progenitor cells [
5,
6]. Thus, KAI1 has different roles in each cell and organ type. However, the specific role of KAI1 in perivascular cells/pericytes is unclear.
Angiogenesis is strictly controlled by maintaining a proper balance between pro- and anti-angiogenic factors [
2]. Most anti-angiogenic drugs used for cancer or vascular proliferative conditions block vascular endothelial growth factor (VEGF) signaling [
7]. The mechanism of angiogenesis caused by VEGF is well-known [
8,
9], but little is known about endogenous VEGF inhibitors and their control mechanism of the anti-angiogenic process. To date, at least 27 endogenous inhibitors of angiogenesis have been identified and detected in the blood [
10,
11]. Most originate from the fragments of large extracellular matrix and non-matrix-derived molecules; however, tetraspanin superfamily-derived endogenous inhibitors of angiogenesis have not been reported. Here, we found that KAI1 expressed in PCs is an important endogenous counter-regulator that inhibits angiogenesis driven by growth factors such as VEGF and PDGF and that the homeostasis of angiogenesis is controlled by paracrine interactions between PCs and ECs.
Materials and methods
Mice
Adult C57BL/6 mice (6–12 weeks, male or female) were purchased from The Jackson Laboratory (Bar Harbor, ME). All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at Seoul National University Hospital and complied with the National Research Council (NRC) ‘Guidelines for the Care and Use of Laboratory Animals’.
Generation of Kai1-EmGFP mouse
Kai1/Cd82-EmGFP (Kai1-GFP) mice were generated by Macrogen, Inc., using the CRISPR system. The mice were interbred and maintained under pathogen-free conditions. Protocols were reviewed and approved by the Institutional Animal Care and Use Committees (IACUC). C57BL/6N female mice were treated with pregnant mare serum gonadotropin and human chorionic gonadotropin. After 48 h, the female mice were mated with C57BL/6N stud male mice. On the next day, the vaginal plug was checked in female mice, and the mice were killed to harvest the fertilized embryos. Single-guide RNA (gRNA1: TCATTCTGAAGACTACAGCAAGG, gRNA2: AGCAAGGTCCCCAAGTACTGAGG), Cas9 nuclease, and dsDonor were mixed and microinjected into one cell embryo. Microinjected embryos were incubated at 37 °C for 1–2 h. Fourteen to sixteen injected one cell staged embryo were transplanted into the oviducts of pseudopregnant recipient mice (ICR). After the founders were born, genotyping of tail samples was performed by PCR (F1: CCCTTGTTAGTCC CCTCCTC, R1: TTACTTGTACAGCTCGTCCA; R2: CCCACACCCCT AAGTTGTCA). PCR-positive samples were subjected to TA cloning and analyzed by sequencing.
Cells
MS1 (mouse endothelial cell line) and B16 (mouse melanoma cell line) cells were cultured in DMEM high glucose (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific) and 1× antibiotics-antimycotics (Thermo Fisher Scientific). 10T1/2 was maintained in RPMI 1640 HEPES (Thermo Fisher Scientific) supplemented with 10% FBS (Thermo Fisher Scientific) and 1× antibiotics-antimycotics (Thermo Fisher Scientific). Mouse primary perivascular cells (PVCs) and mouse primary aorta endothelial cells (ECs) were harvested and expanded in DMEM high glucose supplemented with 20% FBS. Human umbilical vein endothelial cells (HUVEC; human primary endothelial cell) were obtained from Lonza (Basel, Switzerland) and cultured in EGM-2MV (Lonza). HUVEC were cultured in 1.5% gelatin-coated dishes. Human brain vessel pericyte (HBVP, catalog no. #1200; ScienCell) was grown on poly-l-lysine-coated dishes (15ul diluted in 10 mL of distilled water) and maintained in Pericyte Medium (catalog no. #0413; ScienCell).
Immunofluorescence analysis
Eyeballs including the optic nerve were collected from the mice at postnatal day 2 and 5. The retinae were stained with Lectin from Bandeiraea simplicifolia fluorescein isothiocyanate (FITC) conjugate (catalog no. L9381; Sigma-Aldrich), anti-CD31 phycoerythrin (PE) conjugate (catalog no. 340297; BD Biosciences), anti-NG2 Alexa 488 conjugate (catalog no. AB5320A4; Merck Millipore), anti-NG2 cy3 conjugate (catalog no. AB5320C3; Merck Millipore), anti-collagen IV antibody (catalog no. AB748; Merck Millipore), and anti-GFP (catalog no. A6455; Thermo Fisher Scientific). MS1 and 10T1/2 cells were fixed in 2% cold paraformaldehyde (Wako) for 10 min on ice. After washing with phosphate-buffered saline (PBS), the samples were blocked with 1% bovine serum albumin and 0.1% Triton X-100, followed by staining with anti-KAI1 (catalog no. SC-1087; Santa Cruz), anti-CD9 (catalog no. SC-13118; Santa Cruz), anti-alpha-smooth muscle actin Cy3 conjugate (catalog no. C6198; Sigma-Aldrich), anti-CD31 PE conjugate (BD Biosciences), and Bandeiraea simplicifolia fluorescein isothiocyanate conjugate (Sigma-Aldrich). After staining, the tissue and cells were examined by confocal microscopy (Zeiss).
Gene expression analysis
Total RNAs were separated and purified and cell harvesting at representative time points. RNeasy® mini kit (catalog no. 74104; QIAGEN) and QIAshredder (catalog no. 79654; QIAGEN) were used to separate and purify RNA from cells. To synthesis the cDNA from RNA, we used qPCR RT master mix from Toyobo (catalog no. FSQ-201; TOYOBO). Real-time PCR was performed with SyBR Green I Mastermix (Applied Biosystems) using an ABI PRISM TM 7500 Sequence Detection System (Applied Biosystems). RT-PCR was performed using the S1000 Thermal Cycler (BIO-RAD) and detected the agarose gel with Gel Doc XR + Gel Documentation System (BIO-RAD). Information on the primers used is provided in the Supplemental Materials.
Western blot
Cells were lysed with lysis buffer (catalog no. #9803s; Cell Signaling Technology) containing protease inhibitor cocktail (catalog no. #3100-001; Gendepot). Total protein was immunoblotted with primary antibodies against KAI1 (catalog no. ab135779; Abcam), LIF (catalog no. AB-449-NA; R&D Systems), tSrc, pSrc (Tyr416), and pSrc (Tyr527) (Cell Signaling Technology), Myc (catalog no. 05-724; Sigma-Aldrich), p53 (catalog no. MABE327; Merck Millipore), Pbx1 (catalog no. sc-889; Santa Cruz), Cav-1 (Caveolin-1, catalog no. sc-894; Santa Cruz), Flot1 (Flotillin1, catalog no. #3253s; Cell signaling Technology), p-VEGFR2 (catalog no. ab38473; Abcam), total VEGFR2 (catalog no. #2479s; Cell Signaling Technology), p-PDGFRβ (catalog no. #3166s; Cell signaling Technology), total PDGFRβ (catalog no. #4564s; Cell signaling Technology), PDGF-BB (catolg no. 07-1437; Sigma-Aldrich), and VEGF-A (catalog no. #ABS82; Merck Millipore) followed by incubation in horseradish peroxidase-conjugated secondary antibodies (Jackson Laboratory). GAPDH (catalog no. ab9485; Abcam) and beta-actin (catalog no. ab8227; Abcam) were used as an internal control.
Flow cytometry
Cells were collected in FACS buffer [dPBS (Thermo Fisher Scientific) containing 1% FBS and 0.1% bovine serum albumin (Amresco)]. Cells were stained with antibodies, anti-CD82 (Miltenyi Biotec.), CD31 (Santa Cruz), and PDGFRβ (R&D Systems) for 30 min on ice washed out with FACS buffer after staining and analyzed with a BD FACSCanto II™ (BD Biosciences), followed by sorting using a BD FACSAria™ (BD Biosciences) instrument.
Virus transduction
Adenovirus carrying mouse KAI1 was created with the pAdEasy vector system and titrated using the plaque-forming unit assay. 10T1/2 and MS-1 cells were transduced at a multiplicity of infection of 500 and 1000 pfu (plaque-forming unit), respectively, with 1 μg/mL polybrene (Sigma-Aldrich). For lentivirus transduction, MS1 cells were transduced by GFP encoded lentivirus using polybrene.
In vitro angiogenesis assay
For the Matrigel two-dimensional tube formation assay, confocal dishes (Ibidi) were coated with 80 μL matrigel (Corning) and incubated for 30 min in a 37 °C incubator for polymerization. For EC-pericyte co-culture experiments, 3 × 104 MS1 (EC) and 1 × 104 WT/Kai1 K/O mouse primary PVCs were seeded onto the polymerized GFR-matrigel with EBM 5% media. For the EC-conditioned medium set, 3 × 104 MS1 cells were seeded onto a matrigel coated µ-Dish (Ibidi) with conditioned media of primary PVCs from WT or Kai1 K/O mouse. For the three-dimensional spheroid sprouting assay, spheroids of PVCs, ECs, and B16 cells combinations were generated using the hanging drop method. Spheroids seeded onto polymerized matrigel. For the tube formation assay using an overconfluent PVC monolayer, a high density of 10T1/2 cells was incubated for 5 days in growth media and GFP expressing-ECs (MS1) were co-cultured with the PVC monolayer for 3 days.
Tube formation images were acquired by fluorescence microscopy and using a Zeiss LSM-710 META confocal microscope. Random fields were measured in terms of tube length and number of branching points by ImageJ software (National Institutes of Health).
Lipid raft isolation
Lipid raft isolation in mouse PCs (10T1/2) and ECs (MS-1) was performed. For lipid-protein crosslinking, the cells were treated with 1.25 mM DTSSP (catalog no. 21578; Thermo Fisher Scientific) solution and incubated for 1 h on ice at 4 °C. The cells were washed with cold PBS and 5 mM EDTA and then 0.75 mL cold PBS and 5 mM EDTA were added. The samples were frozen overnight at − 80 °C. The cells were lysed with 0.8 mL 0.1% Triton X-100 membrane raft isolation buffer [1 M Tris–HCL, pH7.4, 1 M NaCl, 100 mM EDTA, Triton X-100, DW, protease inhibitor cocktail (500×)] by passing through a 23-gauge needle on a 5-mL syringe 20 times. Next, 500 μL supernatant 1 mL OptiPrep (catalog no. 1114542; Proteogenix) separation medium (60% iodixanol) were added, resulting in a 40% iodixanol solution of lysed cells. Using a Pasteur pipet, the 40% iodixanol solution was carefully overlaid with equal amounts of 30% iodixanol solution, followed by 5% iodixanol solution. The gradient was visible to the naked eye. Samples were ultra-centrifuged for 5 h at 132,000 g and 4 °C. The membrane rafts were present in the second fraction and were visible. Western blotting was performed as described above.
Determining LIF concentrations in conditioned medium (ELISA)
Leukemia inhibitory factor (LIF) concentrations in the conditioned media of adenovirus-transduced MS1 and 10T1/2 cells were determined using a mouse LIF Quantikine ELISA Kit (R&D Systems). 1:2 diluted standard, control, and samples were incubated for 2 h at room temperature followed by a total of five washes. Next, 100 μL of mouse LIF Conjugate was added and incubated for 2 h at room temperature, followed by five washes, and then 100 μL of substrate solution was added and incubated for 30 min at room temperature in the dark. Finally, 100 μL of stop solution was added and the optical density of each sample was determined using a microplate reader (Promega). The concentration was calculated by four-parameter logistic (4-PL) regression.
Acyl-biotin exchange (ABE) assay
mPVCs (101/2) and mECs (MS-1) were harvested by using palmitoylation lysis buffer (PLB) containing 1% NP-40, 10% glycerol, 50 mM N-ethylmaleimide, 1 μM PMSF (Sigma-Aldrich), 200X PIC (Biovision), 50 mM Tris–HCl pH 7.4, and 150 mM NaCl. Additionally, DHHC3 and DHHC4 knockdown mPVCs (101/2) by short interfering RNA (Santa Cruz) were harvested in PLB buffer. Lysates were briefly sonicated and incubated at 4 °C for 24 h, followed by centrifugation at 13,300 rpm 30 min at 4 °C. The supernatant was subject to chloroform–methanol protein precipitation (4:1:3 = methanol:chloroform:water). The protein pellet was solubilized in 0.5% SDS buffer and briefly sonicated. Concentrated proteins were treated with 0.5 M hydroxylamine (catalog no. 031-329-9000; Sigma-Aldrich) or Tris–HCl pH 7.4 buffer (negative control) for 2 h at room temperature. Next, the proteins were precipitated by the chloroform–methanol precipitation method, solubilized in 0.5% SDS, and then briefly sonicated. Solubilized proteins were diluted with 1/10 dilution to 0.05% SDS and immunoprecipitated with 40 μL neutravidin (Invitrogen) for 2 h at 4 °C. Immunoprecipitated beads were washed three times with PLB and eluted in 2× DTT-containing SDS-PAGE sample buffer (3 M). Samples obtained through the ABE assay were performed through the western blotting described above.
RNA sequencing
RNA was extracted from pericytes of WT and
Kai1 K/O mice. RNA sequencing reads were aligned to the mouse genome build mm9 (NCBI37) using TopHat 2.0.9 and Bowtie 0.12.9 with a segment-length of 21, which allowed 2 mismatches per read. Expression levels for 23,170 RefSeq genes were measured by reads per kilobase per million mapped reads (RPKM). Differentially expressed genes between conditions were tested by Cuffdiff. Differentially expressed genes were defined as having more than a twofold change and an adjusted
p value less than 0.05. Hierarchical clustering of samples was performed by R (
www.R-project.org). Gene Ontology (GO) analysis was performed (
http://geneontology.org/). Gene Set Enrichment Analysis (GSEA) was performed against custom-made lists from the GO database. The RNA-seq data have been deposited in the Gene Expression Omnibus (GEO) database (GSE114465).
Chromatin immunoprecipitation (ChIP)
Putative p53 and pbx1 binding sites were predicted using the EpiTect ChIP qPCR Primers website (Qiagen,
http://www.sabiosciences.com/chipqpcrsearch.php?app=TFBS&qs=1490097319). 10T1/2 cells were transfected with FLAG-tagged mouse KAI1 plasmid (KAI1 plasmid from R&D Systems, catalog no. RDC0331; pCMV-Tag 2B vector carrying FLAG obtained from Agilent Technologies) that had been incubated with polyethylenimine (Sigma-Aldrich) to improve transfection efficiency. For Src inhibition, 5 µM of PP2 (catalog no. P0042; Sigma-Aldrich) was added to the normal growth medium. The cells were fixed in 1% formaldehyde (catalog no. F8775; Sigma-Aldrich) for 10 min at room temperature for crosslinking and collected in a tube. The supernatant was discarded, and ChIP RIPA buffer (50 mM Tris–Cl, 150 mM NaCl, 10 mM Triton X-100, 1 mM EDTA, 0.1% sodium deoxycholate, 0.1% SDS, 1× protease inhibitor cocktail, 1 mM phenylmethane sulfonyl fluoride) was added to the pellet. To shear the DNA, both fractions were sonicated 10 times with a BIORUPTOR (30 s on and 30 s off per cycle; Diagenode). The immunoprecipitated sample was supplemented with a p53 (catalog no. MABE327; Merck Millipore) and pbx1 (catalog no. SC-889; Santa Cruz) antibody (2 µg) and rotated overnight. Protein A/G sepharose (catalog no. ab193262; Abcam) were added to pulldown the antibodies, and the samples were washed sequentially three times with homemade washing buffers 1, 2, and 3 (washing buffer 1: 20 mM Tris–Cl, 140 mM NaCl, 0.5 mM Triton X-100, 0.1 mM EDTA; washing buffer 2: 20 mM Tris–Cl, 500 mM NaCl, 0.5 mM Triton X-100, 0.1 mM EDTA; washing buffer 3: 20 mM Tris–Cl, 250 mM LiCl, 0.5 mM Triton X-100, 0.1 mM EDTA). Samples were incubated overnight at 65 °C for decrosslinking and recovered using a PCR purification kit (Qiagen). Recovered DNA was analyzed by semi-quantitative PCR.
Luciferase assay
10T1/2 cells were transiently co-transfected with firefly pGL3-control luciferase reporter vector (Promega) and renilla luciferase reporter plasmid pRL-TK (catalog no. E2241; Promega) by using Neon transfection system (Thermo Fisher Scientific). Lif promoter binding affinity-luciferase activity was detected using Dual-Glo Luciferase Assay system (Promega), following the protocol provided by the manufacturer.
Protein interaction assay
The surface plasmon resonance (SPR) binding studies were performed by Woojung BSC Inc. (Seoul, Korea) using a Biacore T200 (GE Healthcare, Sweden) instrument optical biosensor and CM5 chip (GE healthcare, Cat#. BR-1005-30, Sweden). The data were analyzed by using BIAevaluation software version 3.0 (GE Healthcare, Sweden). Real-time data showing the binding of recombinant KAI proteins to angiogenic cytokines was obtained using a Blitz instrument (ForteBio).
Immunoprecipitation
Kai1-Gfp fusion vector and Dhhc-Ha vectors were co-transfected into 293T cells using ViaFect (Promega) according to the manufacturer’s instructions. pEF-Bos-zDHHC-HA constructs were a generous gift from Professor Masaki Fukata (National Institute for Physiological Science (NIPS). 293T cells were harvested in IP buffer (20 mM Tris–Cl, 140 mM NaCl, 10 mM NP-40, 10 mM Triton X-100, 0.5 mM EDTA, and 1× protease inhibitor cocktail) to confirm the interaction between Kai1-VEGF-A and Kai1-PDGF-BB, respectively, and incubated for 10 min at 4 °C. Following incubation, centrifuge for 10 min at 4 °C and lysates transfer to a new tube. Lysates were incubated for overnight at 4 °C with anti-VEGF-A (Merck Millipore) (or anti-PDGF-BB; Sigma-Aldrich) antibody or normal rabbit IgG (catalog no. sc-2027; Santa Cruz Biotechnology). After incubation with the antibody, the lysates were incubated with protein A/G sepharose (Abcam) for 2 h at 4 °C. After washing the beads were resuspended in 2× reducing sample buffer and heated for 5 min at 95 °C to dissociate captured antigen from beads. Samples obtained through the immunoprecipitation were performed through the western blotting described above.
Duolink, proximity ligation assay (PLA)
10T1/2 cells were used for Kai1 and PDGF-BB, Kai1 and VEGF-A binding assay (PLA; Duolink Proximity Ligation). Cells were seeded on confocal dishes (Ibidi) and incubated for 24 h. After cells were attached, we treated 2-bp (5 μM) for 24 h. Then, cells were fixed 2% cold paraformaldehyde (Wako) for 10 min on ice and incubated with primary antibodies, Kai1 (catalog no. ab140238; Abcam), PDGF-BB (catolg no. 07-1437; Sigma-Aldrich), and VEGF-A (catalog no. #ABS82; Merck Millipore), as for IF. Duolink™ (catalog no. DUO92101; Sigma-Aldrich) experiments were performed using the protocol provided by Sigma-Aldrich. After PLA, the cells were examined by confocal microscopy (Zeiss).
Mouse tumor graft model
For efficacy evaluation of rhKAI1 and KAI1 overexpressing cells, 2 × 106 PC-3 (human prostate cancer cell line), B16 (mouse melanoma cancer cell line) cells and MDA-MB231 cells were mixed with rhKAI1 protein (catalog no. 12275-H08H; SinoBiological) 4 μg or conditioned media of vehicle or Kai1 O/E 10T1/2 cell line or KAI1 peptide (wild-type sequence; NRPEVTYPCSCEVKGEEDNS, mutant sequence; NRPEVTAPASCEVKGAAANS), and subsequently embedded in 100 μL of matrigel (catalog no. 356231; Corning). NSG and C57BL/6 mice were subcutaneously injected with 100 μL of matrigel-cell mixture in the dorsal area. After 14 days, mice were killed in order to harvest tumor tissues. The tissues were fixed with 4% paraformaldehyde (Wako), paraffin-embedded and mounted on slide glasses. The samples were examined by immunofluorescence analysis.
Oxygen-induced retinopathy (OIR) in mice
Newborn mice were exposed to hyperoxia (75 ± 0.5% O2) from postnatal day 7 to 12 and returned to normal room air. At postnatal day 14, we intravitreally injected 1 μL of PBS, KAI WT, rhKAI1 and KAI Mut into the right eyes of mice (n = 4). At P17, the enucleated eyes were prepared for immunofluorescent staining of whole-mount retinas with Alexa Fluor® 594 isolectin GS-IB4 conjugate (5 μg/mL; Invitrogen). The whole-mount retinas were viewed with a fluorescence microscope (Eclipse 90i; Nikon). Then, the neovascular tufts were marked and calculated using Image J (NIH). The area of neovascular tufts was normalized to the area of whole retina.
Statistical analysis
All tests were repeated several times, independently, to verify reproducibility and the replicate number for each test is shown in each figure. We performed statistical analysis and used two-tailed Mann–Whitney rank sum tests using Prism software (version 5.00; GraphPad Software). The resulting p values are indicated as follows: NS, *p < 0.05, **p < 0.01, and ***p < 0.001. Data show the mean ± SEM.
Discussion
We demonstrated that the KAI1/CD82 is a key molecule to controlling angiogenesis and switching angiogenic milieu to a quiescent state. When a quiescent situation is required and induced, KAI1 is palmitoylated by zDHHC4 and localizes to the lipid raft membrane of PCs, induces transcription of Lif through the Src/p53 axis, and leads to downregulation of angiogenic genes in PCs (Vegfa, Fgf2, Pdgfbb, Dll4, Vegfr2 and Ang2) and in ECs (Sox17, Ang2, Esm1, Dll4, and Vegfr2). Finally, KAI1 inhibits angiogenesis. Another anti-angiogenic mechanism of KAI1 is its binding to VEGF-A and PDGF-BB, which leads to inhibition of phosphorylation or activation of VEGFR2 or PDGFRβ. Finally, we demonstrated the therapeutic potential of KAI1 using an in vivo diseases model by showing that angiogenesis can be suppressed by treatment with recombinant or peptide of KAI1.
Previous studies of the function of KAI1 mostly focused on activation of T cells and inhibition of metastasis and migration through suppression of Rac1/RhoA activity in the cancer cells [
25,
26]. Recently, we and other groups reported that KAI1 regulates the cell cycle of long-term repopulating hematopoietic stem cells (LT-HSCs) and muscle stem cells, respectively [
5,
6]. Here, we demonstrated another important function of KAI1; we found that PCs control angiogenesis and that KAI1 in PCs is a key molecule involved in inhibiting angiogenesis.
During our investigation of how KAI1 to regulates angiogenesis, a paper [
27] was published by Wei et al
. who demonstrated that a lack of
Kai1 in endothelial cells promotes angiogenesis in a pathological state. However, they did not identify the vascular cells that predominantly express KAI1
. Based on this research, we investigated the main cells expressing KAI1 and the underlying mechanism of how KAI1 inhibits angiogenesis in the complex network between vascular cells. We generated
Kai1-
GFP transgenic mice and found that PCs, but not ECs, are the main cells expressing KAI1 among vascular cells. We demonstrated that ECs express KAI1 very weakly and that
Kai1 overexpression in ECs did not significantly inhibit angiogenesis, whereas KAI1 in PCs efficiently inhibited angiogenesis. We next determined the underlying mechanisms of how KAI1 on PCs control ECs to suppress angiogenesis.
In the
Kai1-GFP mice model, we confirmed that KAI1 is expressed not only in PCs, but also in leukocytes and erythrocytes. Previous studies also reported KAI1 expression in T cells, B cells, M1-like macrophages, and erythrocytes [
5,
25,
28]. However, the role of KAI1 remains unknown in macrophages, erythrocytes, and B cells, except for in T cell activation. The role of KAI1 on leukocytes and erythrocytes requires further analysis.
The most important difference in the intracellular distribution of KAI1 was that KAI1 was observed in the membrane layer of PCs but not in ECs, possibly because of palmitoylation of KAI1. Palmitoylation of KAI1 is observed mainly in the PCs but not in ECs. After screening of 23 enzymes in the zDHHC family, zDHHC4 was found to be the palmitoyltransferase responsible for the palmitoylation of KAI1. The recently discovered zDHHC4 molecule has not been widely studied [
29], and its role in vascular diseases should be further evaluated. Palmitoylation of proteins prevents ubiquitination-mediated protein degradation [
30,
31]. Thus, palmitoylation of KAI1 by zDHHC and its localization in lipid raft may increase its stability, leading to anti-angiogenic effects.
To identify the distal effector molecule of KAI1 in PCs, we analyzed the transcriptome of WT and Kai1−/− PCs, performed GSEA, and found LIF is the downstream effector of KAI1. We demonstrated that both EC and PC express LIF receptors, suggesting that an autocrine and paracrine network of KAI1/LIF and angiogenic factors functions between these cells.
Tetraspanin is commonly considered as a molecular facilitator that induces signalling by assisting other molecules without directly signalling itself, as it does not possess a signalling motif [
25]. Recently, however, there is an interesting article that suggested that the tetraspanin molecule, CD37, is directly involved in signal transduction [
32]. To evaluate the signalling pathway between KAI1 and LIF in PCs, we tested inhibitors of several major pathways and found that KAI1 induced LIF via Src stimulation in PCs. In several studies, overexpression of Kai1 was shown to cause transduction of multiple signals such as in SRC signalling [
25]. It has also been reported that KAI1 molecules bind to each other and activate SRC when treated with KAI1 antibody [
33]. Thus,
Kai1 is thought to activate SRC through the same mechanism by binding of KAI1 proteins to each other or by enhancing interactions with other tetraspanin molecules with high expression in PCs.
We found that the transcription factor p53 enhances LIF expression in response to KAI1 stimulation. Interestingly, p53 binds to the gene-regulating element of Lif through SRC signalling activated by KAI1, whereas Pbx1 binds to the promoter region of Lif independently of SRC signalling. Binding of Pbx1 to the Lif promoter may be facilitated via SRC-independent signalling by KAI1 or other signalling molecules of the tetraspanin-enriched web activated by KAI1. Moreover, the pbx1 binding site mutation did not affect activation of the Lif promoter. Here, we demonstrated the potential anti-angiogenic functions of p53 such as increasing LIF in response to KAI1. This new role for p53 in vascular cells and cancer cells requires further analysis.
Tetraspanins are distributed in a broad tissues and enriched in the membrane of exosome [
34]. Exosome has been deciphered to participate in cellular communication through the shuttling of bioactive miRNAs, proteins, and mRNAs. While miRNAs do not code for proteins, they can modulate expression of target proteins by regulating the degradation or translation of their targeted mRNA. Emerging evidence shows that the progression and metastasis of human cancers are mediated by dysregulation of miRNAs [
35]. Inducing angiogenesis is also regulated by miRNAs [
35]. So, exosome is another valuable messenger to control angiogenesis through miRNA. To investigate the role of KAI1 in angiogenesis through the exosome, we compared miRNAs in exosome derived from wild-type or KAI1-knockout aorta. We performed quantitative real-time PCR and found that miR181a (known as inducing angiogenesis [
36,
37]) level was higher in exosome derived from KAI1 knockout aorta. In contrast, miR107 (known as suppressing angiogenesis [
38]) level was much lower in exosome derived from KAI1 knockout aorta (Additional file
1: Fig. EV11). Based on this result, we are planning on investigating the mechanism how KAI1 regulate the level of miRNAs. And also we are going to screen miRNAs regulated by KAI1.
Downstream of LIF, our study revealed that LIF from PCs or recombinant LIF inhibited the expression of various angiogenic factors in the neighboring cells (
Ang2,
Esm1,
Dll4,
Vefgr2 and
Sox17 in EC and
Vegf,
Fgf2,
Pdgfbb, Dll4, Vegfr2, and Ang2 in PC). Notably, key regulators of angiogenesis in ECs were inhibited, such as
Sox17 which enhances VEGF signalling in a positive feedback loop and increases the tip cell-related genes essential for angiogenesis [
39]. Thus, inhibition of the
Sox17 expression in ECs by the KAI1-LIF axis in PCs may have potent anti-angiogenic effects in ECs by blocking VEGF signalling through multiple aspects in the angiogenic microenvironment.
Analysis of the relationship between KAI1 and growth factor signalling showed that KAI suppressed VEGF expression via Src activation in prostate cancer cells [
40]. Ectopic KAI1 expression in renal cell carcinoma suppressed TGF-β1 signalling, leading to inhibition of migration and invasion [
41]. In this study, the very interesting finding is that KAI1 used another mechanism to inhibit growth factors and angiogenesis, which involved direct binding to and inhibition of VEGF and PDGF, but not FGF. VEGF is known to be structurally very similar to PDGF, and recent reports showed that PDGF can use VEGF-R2 as its receptor [
42]. Therefore, we expected that there are the common motif of VEGF and PDGF which binds to VEGFR2 and the sequence and structure of the KAI1 molecule involved in binding and inhibition of VEGF and PDGF. In this study, we identified the peptide from the anti-angiogenic sequence of KAI1 which bind and quench VEGF and PDGF simultaneously. It may lead to the development of therapeutic agents for cancer or various vascular diseases. Human VEGF-A has eight exons and seven introns, and alternative exon splicing of VEGF-A results in the production of four different isoforms: VEGF121, VEGF165, VEGF189, and VEGF206. There are three VEGF receptors VEGFR1, VEGFR2, and Neurophilin-1/Neurophilin-2, which have various affinities for VEGF [
43]. Increased VEGF expression is mostly related to pathological angiogenesis affecting the proliferation of cancer cells [
44]. Although VEGF
165 used in this study is the predominant isoform, further studies are needed to determine whether these various VEGF proteins bind to KAI1 protein.
In most of the previous studies, the anti-cancer effect of KAI1 was evaluated using
Kai1 over-expressing cancer cells [
40,
45]. In this study, we demonstrated the feasibility of using KAI1 as the anti-cancer therapeutic agent by KAI1-supplementation involving two components: (1) recombinant protein or peptide of KAI1 binds to and sequesters VEGF or PDGF, and (2) the supernatant of
Kai1-O/E PCs containing anti-angiogenic LIF. The anti-cancer effect by KAI1 supplementation show potential for drug development.
We identified a novel endogenous switch, KAI1, which turns angiogenesis off and is mainly expressed in PCs. This protein triggers the quiescent milieu by inducing the pivotal anti-angiogenic molecule LIF or by directly binding to and inhibiting VEGF and PDGF. These findings provide a new platform for mechanistic studies of vessel homeostasis. Our results demonstrate the importance of PCs in controlling ECs in the context of angiogenic equilibrium.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.