Skip to main content
Erschienen in: BMC Endocrine Disorders 1/2020

Open Access 01.12.2020 | Research article

Leu72Met polymorphism of GHRL gene decreases susceptibility to type 2 diabetes mellitus in a Mexican population

verfasst von: Edgar Alfonso Rivera-León, Mara Anaís Llamas-Covarrubias, Sergio Sánchez-Enríquez, Erika Martínez-López, Mercedes González-Hita, Iris Monserrat Llamas-Covarrubias

Erschienen in: BMC Endocrine Disorders | Ausgabe 1/2020

Abstract

Background

Type 2 diabetes mellitus (T2D) is the most frequent type of diabetes. It has a multifactorial etiology, affecting millions of people worldwide. Ghrelin gene (GHRL) encodes the ghrelin peptide, which promotes food intake, induces body weight and adipogenesis. Several single nucleotide polymorphisms (SNPs) in GHRL gene have been associated with metabolic diseases. A protective effect of the Leu72Met (rs696217) polymorphism has been described for T2D in some populations, but this effect seems to depend on the ethnicity of the patients studied.

Methods

The aim of this study was to investigate the association between the GHRL Leu72Met (rs696217) SNP with the development of T2D and serum ghrelin levels in a Western Mexican population. We performed a case-control study in which we included 284 subjects (159 with previous T2D diagnosis and 125 control subjects (CS)). Leu72Met SNP was genotyped by using PCR-RFLPs technique. Serum ghrelin levels were measured using a commercial enzyme immunoassay. Genotypic and allelic distributions were compared using Chi square test. Student T-test and Mann-Whitney U test were used to compare quantitative variables. Odds ratio (OR) was used to evaluate the association between alleles or genotypes and T2D. Multiple and logistic regression models were performed for adjustment. A two-tailed p-value ≤0.05 was considered statistically significant.

Results

Leu72Leu genotype was more frequent among T2D compared to CS (p < 0.05). After adjusting for age and body composition, there was a significant protective effect of the 72Met allele for T2D development (OR 0.40 IC 95% 0.23–0.70; p ≤ 0.001). Fasting serum ghrelin levels were lower in T2D than CS (p ≤ 0.0001) irrespective of age, body weight and BMI. No associations were found between genotypes and ghrelin serum levels in our population.

Conclusions

The GHRL 72Met allele decreases susceptibility for T2D development in a Western Mexican population. Serum ghrelin levels are lower in T2D independently of Leu72Met polymorphism genotype.
Hinweise
Edgar Alfonso Rivera-León and Iris Monserrat Llamas-Covarrubias contributed equally to this work.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
T2D
Type 2 Diabetes Mellitus
IDF
International Diabetes Federation
GHRL
Ghrelin Gene
GHSR1a
Growth hormone secretagogue receptor
CS
Control Subjects
BFP
Body Fat Percentage
FG
Fasting Glucose
TG
Triglycerides
TC
Total Cholesterol
DNA
Deoxyribonucleic acid
PCR
Polymerase Chain Reaction
RFLP
Restriction Fragment Length Polymorphism
SNP
Single Nucleotide Polymorphism
HDL-C
High Density Lipoprotein
OR
Odds Ratio

Background

Diabetes mellitus is an heterogeneous group of disorders characterized by hyperglycemia due to an absolute or relative deficit in insulin production or action [1]. Type 2 diabetes mellitus (T2D) is the most frequent metabolic alteration accounting for around 90% of all diabetes cases [2]. Worldwide, the International Diabetes Federation (IDF) estimated that there were 415 million adults had diabetes mellitus patients in 2015, and predicted a rise to 552 million by 2030 [3, 4]. In Mexico, the prevalence of T2D is 13.9% in adult population [5] and also it is also predicted to increase [6], given the lifestyle risk factors of Mexican population [79]. Its etiology is multifactorial involving a sedentary lifestyle, obesity, poor quality of diet and genetic factors [3]. T2D courses with a progressive deterioration of pancreatic beta cells, leading to chronic hyperglycemia that conducts in most cases to organ failure such as kidney, liver, retina, nervous and cardiovascular system [10]. Ghrelin gene (GHRL) encodes ghrelin peptide, a 28 amino acids hormone produced mainly in the stomach that is involved in food intake regulation. Ghrelin is an orexigenic hormone that promotes food intake, induces body weight gain and adipogenesis. This hormone is recognized by the growth hormone secretagogue receptor 1a (GHSR1a) which is present in various tissues such as pituitary, myocardium, pancreatic islets and in the hypothalamus. Once the interaction with its receptor is stablished, ghrelin mainly induces the expression of food intake stimulating the neuropeptides: neuropeptide Y and Agouti related peptide and inhibits the expression of proopiomelanocortin, an anorexigenic neuropeptide. Additional functions have also been reported for ghrelin such as: modulation of food reward, olfactory sensitivity, myocardial contraction, sleep, stress and depression regulation [11, 12]. Several polymorphisms exist in the ghrelin gene and some of them seem to be associated with metabolic diseases [12]. In particular, the Leu72Met (rs696217) polymorphism shows a protective effect to T2D in some populations [13, 14]. The Leu72Met polymorphism consists of a transversion of an Cytosine for an Adenine in the position 247 of the GHRL gene, consequently leading to an amino acid change (missense) from Leucine to Methionine in codon 72 [15]. It is known that there is a differential effect of this polymorphism in terms of T2D susceptibility among different ethnic groups [16], so far, there is no evidence about genotypic and allelic frequencies and their association with T2D and in serum ghrelin levels in Mexican population.

Methods

Subjects

A case-control study in which were included one hundred and fifty-nine adult subjects with previous diagnosis of T2D and one hundred and twenty-five adult normal weight control subjects (CS) that did not present T2D was conducted. We included male and female participants of age ≥ 30 in both groups, and in the CS group we also considered a BMI not higher than 24.9 as inclusion criteria. None of them had history of cancer, rheumatologic, kidney or liver disease, or thyroid and parathyroid disorders or were using medication that interfere with glucose tolerance or serum lipid levels. This study was approved by the local ethics committee (registration code: C.I. 086) and all the participants signed a written informed consent in accordance with the Declaration of Helsinki.

Anthropometric measurements

Height was measured using a stadiometer (SECA Inc., México). Waist and hip circumferences were obtained in centimeters by a measuring tape (SECA 201). Body mass index (BMI; kg/m2), weight and body fat percentage (BFP) were obtained using a bioelectrical impedance scale (TFB-300A, Tanita®, Tokyo, Japan). All anthropometric measurements were performed in accordance to the International Society for the Advancement of Kinanthropometry standards.

Biochemical analysis

Blood samples were obtained by venipuncture with Vacutainer® system from all subjects after an 8 h overnight fasting period. Serum levels of fasting glucose (FG), triglycerides (TG), total cholesterol (TC) and high-density lipoprotein cholesterol (HDL-C) were determined using standard biochemical methods (BioSystems®, Barcelona, Spain). In addition, a subsample of the study individuals was made in order to measure total plasma ghrelin levels in duplicate with the RayBiotech, Inc., Norcross GA, USA enzyme immunoassay.

Genotyping

DNA isolation was performed by the Miller method [17]. Samples of DNA of each subject were analyzed by the polymerase chain reaction of restriction fragment-length polymorphisms (PCR-RFLPs) in order to determine the Leu72Met genotype. First, a PCR was carried out to amplify the region of the SNP using the following primers: forward 5′ TCTCTGGGCTTCAGTCTTCT 3′ and reverse 5′ CACTGCCACCTCTCCTGC 3′. PCR was performed in a final volume of 25 μL, containing 200 ng of gDNA, 20 μM of each primer, 1.5 U/μL of Taq polymerase (Fermentas Thermo Fisher Scientific®, Waltham MA, USA), 1X buffer, and 0.1 mM of each dNTP (Dongsheng Biotech Co., Guandong, China) with the next conditions: denaturation (95 °C 30 s), annealing (60 °C 30 s) and extension (72 °C 30 s) for 30 cycles performed on a programmable thermocycler (TC-300, Techne®, Staffs, UK). Finally, 10 μL of the amplified fragments by PCR were incubated for enzyme digestion with 1.5 U of BsrI restriction enzyme (New England Biolabs®, Ipswich MA, USA) for 20 min at 60 °C. PCR fragments and digestion products were analyzed in 2% agarose gel stained with Gel Red™ (Biotinum, Inc., Hayward CA, USA).

Statistical analysis

The significance of genotypic and allelic frequencies differences was compared using Chi square test. Student T-test and Mann-Whitney U test were used to compare quantitative variables according to their distribution. The association between genotypes or alleles with T2D was analyzed with Odds ratio (OR). Also, there was performed multiple and logistic regression models for the adjustment of ghrelin serum levels and genotype. It was considered as statistically significant when a two-tailed p-value ≤0.05 resulted. All statistical analyses were done by means of IBM SPSS 20.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 8 (GraphPad Software®, La Jolla CA, USA).

Results

Basal characteristics of the study groups are shown in Table 1. T2D group showed a higher age and also significantly higher values in all clinical variables and anthropometrical variables than CS as expected. Ghrelin serum levels were evaluated in a subsample of 89 individuals (65 from T2D group and 24 CS) and we found significantly lower levels in serum T2D than in CS being: 50.5(60.8) pg/mL and 177.6(72.8) pg/mL respectively, Fig. 1 (values are expressed as median (interquartile range) p ≤ 0.0001). After an adjustment by age, body weight and BMI, the differences in serum ghrelin levels by groups remained significant (p ≤ 0.0001).
Table 1
Demographic, clinical and anthropometric characteristics of the study groups
 
CS n = 125
T2D n = 159
p
Demographic
 Age (years)
40.3 ± 8.8
51.1 ± 9.0
≤0.0100
Gender
 Female n (%)
86 (68.8)
95 (59.7)
NS
 Male n (%)
39 (31.2)
64 (40.3)
NS
Clinical and anthropometric
 Weight (kg)
63.1 ± 8.7
79.4 ± 15.9
≤0.0001
 BMI (Kg/m2)
23.3 ± 1.6
30.3 ± 5.5
≤0.0001
 SBP (mmHg)
117.1 ± 13.5
124.2 ± 15.4
0.0040
 DBP (mmHg)
75.2 ± 8.6
78.4 ± 10.9
0.0010
 Waist (cm)
80.5 ± 7.7
99.2 ± 11.6
≤0.0001
 Hip (cm)
98.5 ± 4.9
107.7 ± 11.0
≤0.0001
 BFP (%)
27.1 ± 6.7
34.1 ± 8.9
≤0.0001
 Glucose (mg/dl)
89.2 ± 14.5
182.9 ± 77.0
≤0.0001
 Cholesterol (mg/dl)
194.2 ± 76.9
211.6 ± 54.8
0.0400
 Triglycerides (mg/dl)
121.9 ± 88.6
209.9 ± 131.2
≤0.0001
 c-HDL (mg/dl)
50.8 ± 13.7
42.4 ± 14.3
≤0.0010
 c-LDL (mg/dl)
126.1 ± 45.8
149.4 ± 52.6
0.0020
CS Control Subjects, T2D Type 2 Diabetes Mellitus, BFP Body Fat Percentage, c-HDL High Density Lipoprotein cholesterol, c-LDL Low Density Lipoprotein cholesterol, NS non-significant. Values of gender are expressed as frequency (percentage) analyzed by chi square test. All the other variables are expressed as means±SD and compared by Student’s t-test
Genotypic and allelic distributions are shown in Table 2. Both allele and genotype proportions were in equilibrium according to Hardy-Weinberg’s law. Genotypic frequencies were significantly different between study groups (p ≤ 0.005). Both the Leu72Leu genotype and Leu72 allele, were markedly more frequent in T2D group than in CS. In the risk analysis, it was detected that the Leu72Met genotype and the 72Met allele were associated with decreased risk for T2D (OR 0.41 IC 95% 0.23–0.70; p = 0.0014 and OR 0.52 IC 95% 0.33–0.84; p = 0.006 respectively). After adjustment by age, body weight and BMI, Leu72Met genotype was no longer associated with T2D risk (p = 0.37), but the 72Met allele remained as a significant protective factor (OR 0.40 IC 95% 0.23–0.70; p ≤ 0.001). Serum ghrelin levels did not show differences when compared between genotypes (data not shown).
Table 2
Genotypic and allelic distribution in T2D and CS
 
Frequency n (%)
    
Genotype
CS
T2D
p
OR
IC95%
pb
Leu72Leua
79 (63.2)
127 (79.9)
 
Leu72Met
43 (34.4)
28 (17.6)
< 0.050
0.41
0.23–0.70
NS
Met72Met
3 (2.4)
4 (2.5)
 
0.83
0.18–3.81
NS
Allele
 Leua
201 (80.4)
282 (88.7)
 
 Met
49 (19.6)
36 (11.3)
< 0.050
0.40
0.23–0.70
≤0.001
NS non-significant. Genotypes are in Hardy-Weinberg equilibrium; Data was analyzed by Chi squared test. aGenotype and allele of reference. bAdjusted by age, body weight and BMI using multivariate logistic regression analysis

Discussion

This study aimed to describe the association between Leu72Met polymorphism and the risk of developing T2D in a Mexican population. We studied two groups, individuals with T2D and individuals with no T2D and with normal weight. As expected, T2D group showed significantly higher values in all clinical and metabolic variables, as compared to CS; this is explained by the natural history of T2D in which one or more of the following signs are common: overweight, obesity, high blood pressure, hyperglycemia and dyslipidemia [3]. On the other hand, lower serum ghrelin levels were detected in the T2D group. Since our groups were different in age distribution and the association between ghrelin levels body composition and age has been previously described [18, 19], we carried out an adjusted analysis in order to exclude the effect of age, body weight and BMI in our results. After adjusting, the difference detected in ghrelin levels in both groups remained significant (p ≤ 0.0001). About that, other studies have also encountered lower serum ghrelin levels in diabetic patients [2022]. Given these results, it is possible that somehow T2D modifies ghrelin production. Tong J et.al., showed that the continuous infusion of ghrelin in healthy volunteers induced the suppression of glucose stimulated-insulin secretion [23]; in line with that, other studies have demonstrated that ghrelin increases plasma glucose levels and decreases fasting insulin levels [12]. A study by Sun Y et.al., were ghrelin gene was deleted in ob/ob mice showed a reduction in hyperglycemia and enhancement in glucose-induced insulin secretion [24]. It is possible that in T2D, lower ghrelin serum levels are produced by a compensatory mechanism that seeks to avoid the increment in circulating levels of glucose and those levels are independent of the effect of Leu72Met genotype.
Regarding the Leu72Met polymorphism, genotypic and allelic distributions of this study are in accordance to what has been reported before by Berthold HK, Bing C, Zavarella S in Caucasians and by Kim S in Asians [13, 25, 26]. When we compared genotypic and allelic frequencies between groups, both Leu72Leu genotype and 72Leu allele were a lot more frequent in T2D than in CS. The association analysis with T2D, showed that 72Met allele and Leu72Met genotype were protective against T2D, but after the adjustment, only the 72Met allele remained associated, suggesting that the protective effect of Leu72Met is given by 72Met allele. To this respect, it has been described that the 72Met allele induces protection against T2D in Caucasians [13], whereas the opposite occurs in Asiatic and Danish populations [14, 25, 27, 28]. Moreover, the 72Met allele has also, been associated as a protective against insulin resistance and body fat accumulation [26, 29]. Finally, the 72Met allele has been associated with BMI increase and early development of obesity in Japanese adults and in Italian adolescents [30, 31]. All of this evidence contributes to the controversial role of this polymorphism in T2D, where its effects in susceptibility varies in different ethnic groups as it has also been described for other human features. It is known that in humans, approximately 15% of the SNP’s are population-specific and the differences could be due to the different proportions of SNP alleles in a specific population [16, 32]. But at the moment, the underlying mechanisms of molecular evolution of this SNP between different populations is unclear. Our results are the first evidence about the relationship of this polymorphism and T2D susceptibility in Mexican population. However, this data should be interpreted with caution given the limited sample size of the study. There is a need of more studies for a better elucidation of the relation of genetic variations of the ghrelin gene with metabolic function in this population.

Conclusions

72Met allele of the Leu72Met polymorphism of GHRL gene decreases the risk of T2D development in Mexican population. Serum ghrelin levels are decreased in T2D patients as compared to CS independently with the Leu72Met polymorphism genotype in a Mexican population.

Acknowledgements

The authors would like to thank to the National Council of Science and Technology (CONACyT) and the PhD program of Molecular Biology in Medicine of the University of Guadalajara for the support.
This study was approved by the University of Guadalajara ethics in research committee with the registration code: C.I.086 and all the participants signed a written informed consent in accordance with the Declaration of Helsinki.
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Alam U, Asghar O, Azmi S, Malik RA. General aspects of diabetes mellitus. Handb Clin Neurol. 2014;126:211–22.CrossRef Alam U, Asghar O, Azmi S, Malik RA. General aspects of diabetes mellitus. Handb Clin Neurol. 2014;126:211–22.CrossRef
3.
Zurück zum Zitat Zheng Y, Ley SH, Hu FB. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat Rev Endocrinol. 2018;14(2):88–98.CrossRef Zheng Y, Ley SH, Hu FB. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat Rev Endocrinol. 2018;14(2):88–98.CrossRef
5.
Zurück zum Zitat Whittemore R, Vilar-Compte M, De La Cerda S, Marron D, Conover R, Delvy R, et al. Challenges to diabetes self-management for adults with type 2 diabetes in low-resource settings in Mexico City: a qualitative descriptive study. Int J Equity Health. 2019;18 [citado 30 de octubre de 2019]. Disponible en: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6708131/. Whittemore R, Vilar-Compte M, De La Cerda S, Marron D, Conover R, Delvy R, et al. Challenges to diabetes self-management for adults with type 2 diabetes in low-resource settings in Mexico City: a qualitative descriptive study. Int J Equity Health. 2019;18 [citado 30 de octubre de 2019]. Disponible en: https://​www.​ncbi.​nlm.​nih.​gov/​pmc/​articles/​PMC6708131/​.
6.
Zurück zum Zitat Meza R, Barrientos-Gutierrez T, Rojas-Martinez R, Reynoso-Noverón N, Palacio-Mejia LS, Lazcano-Ponce E, et al. Burden of type 2 diabetes in Mexico: past, current and future prevalence and incidence rates. Prev Med. 2015;81:445–50.CrossRef Meza R, Barrientos-Gutierrez T, Rojas-Martinez R, Reynoso-Noverón N, Palacio-Mejia LS, Lazcano-Ponce E, et al. Burden of type 2 diabetes in Mexico: past, current and future prevalence and incidence rates. Prev Med. 2015;81:445–50.CrossRef
7.
Zurück zum Zitat la Cruz-Góngora VD, Martínez-Tapia B, Cuevas-Nasu L, Flores-Aldana M, Shamah-Levy T. Dietary intake and adequacy of energy and nutrients in Mexican older adults: results from two National Health and nutrition surveys. Salud Publica Mex. 2017;59(3):285–98.CrossRef la Cruz-Góngora VD, Martínez-Tapia B, Cuevas-Nasu L, Flores-Aldana M, Shamah-Levy T. Dietary intake and adequacy of energy and nutrients in Mexican older adults: results from two National Health and nutrition surveys. Salud Publica Mex. 2017;59(3):285–98.CrossRef
8.
Zurück zum Zitat Gaona-Pineda EB, Mejía-Rodríguez F, Cuevas-Nasu L, Gómez-Acosta LM, Rangel-Baltazar E, Flores-Aldana ME. Dietary intake and adequacy of energy and nutrients in Mexican adolescents: results from Ensanut 2012. Salud Publica Mex. 2018;60(4):404–13.CrossRef Gaona-Pineda EB, Mejía-Rodríguez F, Cuevas-Nasu L, Gómez-Acosta LM, Rangel-Baltazar E, Flores-Aldana ME. Dietary intake and adequacy of energy and nutrients in Mexican adolescents: results from Ensanut 2012. Salud Publica Mex. 2018;60(4):404–13.CrossRef
9.
Zurück zum Zitat López-Olmedo N, Carriquiry AL, Rodríguez-Ramírez S, Ramírez-Silva I, Espinosa-Montero J, Hernández-Barrera L, et al. Usual intake of added sugars and saturated fats is high while dietary Fiber is low in the Mexican population. J Nutr. 2016;146(9):1856S–65S.CrossRef López-Olmedo N, Carriquiry AL, Rodríguez-Ramírez S, Ramírez-Silva I, Espinosa-Montero J, Hernández-Barrera L, et al. Usual intake of added sugars and saturated fats is high while dietary Fiber is low in the Mexican population. J Nutr. 2016;146(9):1856S–65S.CrossRef
11.
Zurück zum Zitat Choi HJ, Cho YM, Moon MK, Choi HH, Shin HD, Jang HC, et al. Polymorphisms in the Ghrelin Gene Are Associated with Serum High-Density Lipoprotein Cholesterol Level and not with Type 2 Diabetes Mellitus in Koreans. None. 2006;91(11):4657–63. Choi HJ, Cho YM, Moon MK, Choi HH, Shin HD, Jang HC, et al. Polymorphisms in the Ghrelin Gene Are Associated with Serum High-Density Lipoprotein Cholesterol Level and not with Type 2 Diabetes Mellitus in Koreans. None. 2006;91(11):4657–63.
12.
Zurück zum Zitat Poher A-L, Tschöp MH, Müller TD. Ghrelin regulation of glucose metabolism. Peptides. 2018;100:236–42.CrossRef Poher A-L, Tschöp MH, Müller TD. Ghrelin regulation of glucose metabolism. Peptides. 2018;100:236–42.CrossRef
13.
Zurück zum Zitat Berthold HK, Giannakidou E, Krone W, Mantzoros CS, Gouni-Berthold I. The Leu72Met polymorphism of the ghrelin gene is associated with a decreased risk for type 2 diabetes. Clin Chim Acta. 2009;399(1–2):112–6.CrossRef Berthold HK, Giannakidou E, Krone W, Mantzoros CS, Gouni-Berthold I. The Leu72Met polymorphism of the ghrelin gene is associated with a decreased risk for type 2 diabetes. Clin Chim Acta. 2009;399(1–2):112–6.CrossRef
14.
Zurück zum Zitat Liao N, Xie Z-K, Huang J, Xie Z-F. Association between the ghrelin Leu72Met polymorphism and type 2 diabetes risk: a meta-analysis. Gene. 2013;517(2):179–83.CrossRef Liao N, Xie Z-K, Huang J, Xie Z-F. Association between the ghrelin Leu72Met polymorphism and type 2 diabetes risk: a meta-analysis. Gene. 2013;517(2):179–83.CrossRef
15.
Zurück zum Zitat Gueorguiev M, Lecoeur C, Meyre D, Benzinou M, Mein CA, Hinney A, et al. Association studies on ghrelin and ghrelin receptor gene polymorphisms with obesity. Obesity. 2009;17(4):745–54.CrossRef Gueorguiev M, Lecoeur C, Meyre D, Benzinou M, Mein CA, Hinney A, et al. Association studies on ghrelin and ghrelin receptor gene polymorphisms with obesity. Obesity. 2009;17(4):745–54.CrossRef
17.
Zurück zum Zitat Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215.CrossRef Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16(3):1215.CrossRef
18.
Zurück zum Zitat Serra-Prat M, Fernández X, Burdoy E, Mussoll J, Casamitjana R, Puig-Domingo M, et al. The role of ghrelin in the energy homeostasis of elderly people: a population-based study. J Endocrinol Invest. 2007;30(6):484–90.CrossRef Serra-Prat M, Fernández X, Burdoy E, Mussoll J, Casamitjana R, Puig-Domingo M, et al. The role of ghrelin in the energy homeostasis of elderly people: a population-based study. J Endocrinol Invest. 2007;30(6):484–90.CrossRef
19.
Zurück zum Zitat Tschöp M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E, Heiman ML. Circulating ghrelin levels are decreased in human obesity. Diabetes. 2001;50(4):707–9.CrossRef Tschöp M, Weyer C, Tataranni PA, Devanarayan V, Ravussin E, Heiman ML. Circulating ghrelin levels are decreased in human obesity. Diabetes. 2001;50(4):707–9.CrossRef
20.
Zurück zum Zitat Gómez-Díaz RA, Gómez-Medina MP, Ramírez-Soriano E, López-Robles L, Aguilar-Salinas CA, Saucedo R, et al. Lower Plasma Ghrelin Levels are Found in Women with Diabetes-Complicated Pregnancies. J Clin Res Pediatr Endocrinol. 2016;8(4):425–31.CrossRef Gómez-Díaz RA, Gómez-Medina MP, Ramírez-Soriano E, López-Robles L, Aguilar-Salinas CA, Saucedo R, et al. Lower Plasma Ghrelin Levels are Found in Women with Diabetes-Complicated Pregnancies. J Clin Res Pediatr Endocrinol. 2016;8(4):425–31.CrossRef
21.
Zurück zum Zitat Ukkola O, Pöykkö SM, Antero KY. Low plasma ghrelin concentration is an indicator of the metabolic syndrome. Ann Med. 2006;38(4):274–9.CrossRef Ukkola O, Pöykkö SM, Antero KY. Low plasma ghrelin concentration is an indicator of the metabolic syndrome. Ann Med. 2006;38(4):274–9.CrossRef
22.
Zurück zum Zitat Al Qarni AA, Joatar FE, Das N, Awad M, Eltayeb M, Al-Zubair AG, et al. Association of Plasma Ghrelin Levels with Insulin Resistance in Type 2 Diabetes Mellitus among Saudi Subjects. Endocrinol Metab (Seoul). 2017;32(2):230–40.CrossRef Al Qarni AA, Joatar FE, Das N, Awad M, Eltayeb M, Al-Zubair AG, et al. Association of Plasma Ghrelin Levels with Insulin Resistance in Type 2 Diabetes Mellitus among Saudi Subjects. Endocrinol Metab (Seoul). 2017;32(2):230–40.CrossRef
23.
Zurück zum Zitat Tong J, Prigeon RL, Davis HW, Bidlingmaier M, Kahn SE, Cummings DE, et al. Ghrelin suppresses glucose-stimulated insulin secretion and deteriorates glucose tolerance in healthy humans. Diabetes. 2010;59(9):2145–51.CrossRef Tong J, Prigeon RL, Davis HW, Bidlingmaier M, Kahn SE, Cummings DE, et al. Ghrelin suppresses glucose-stimulated insulin secretion and deteriorates glucose tolerance in healthy humans. Diabetes. 2010;59(9):2145–51.CrossRef
24.
Zurück zum Zitat Sun Y, Asnicar M, Saha PK, Chan L, Smith RG. Ablation of ghrelin improves the diabetic but not obese phenotype of Ob/Ob mice. Cell Metab. 2006;3(5):379–86.CrossRef Sun Y, Asnicar M, Saha PK, Chan L, Smith RG. Ablation of ghrelin improves the diabetic but not obese phenotype of Ob/Ob mice. Cell Metab. 2006;3(5):379–86.CrossRef
25.
Zurück zum Zitat Bing C, Ambye L, Fenger M, Jørgensen T, Borch-Johnsen K, Madsbad S, et al. Large-scale studies of the Leu72Met polymorphism of the ghrelin gene in relation to the metabolic syndrome and associated quantitative traits. Diabet Med. 2005;22(9):1157–60.CrossRef Bing C, Ambye L, Fenger M, Jørgensen T, Borch-Johnsen K, Madsbad S, et al. Large-scale studies of the Leu72Met polymorphism of the ghrelin gene in relation to the metabolic syndrome and associated quantitative traits. Diabet Med. 2005;22(9):1157–60.CrossRef
26.
Zurück zum Zitat Zavarella S, Petrone A, Zampetti S, Gueorguiev M, Spoletini M, Mein CA, et al. A new variation in the promoter region, the −604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance. Int J Obes (Lond). 2008;32(4):663–8.CrossRef Zavarella S, Petrone A, Zampetti S, Gueorguiev M, Spoletini M, Mein CA, et al. A new variation in the promoter region, the −604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance. Int J Obes (Lond). 2008;32(4):663–8.CrossRef
27.
Zurück zum Zitat Li Y-Y, Lu X-Z, Yang X-X, Wang H, Geng H-Y, Gong G, et al. GHRL gene Leu72Met polymorphism and type 2 diabetes mellitus: a meta-analysis involving 8,194 participants. Front Endocrinol. 2019;10:559. Li Y-Y, Lu X-Z, Yang X-X, Wang H, Geng H-Y, Gong G, et al. GHRL gene Leu72Met polymorphism and type 2 diabetes mellitus: a meta-analysis involving 8,194 participants. Front Endocrinol. 2019;10:559.
28.
Zurück zum Zitat Kim S-Y, Jo D-S, Hwang PH, Park JH, Park SK, Yi HK, et al. Preproghrelin Leu72Met polymorphism is not associated with type 2 diabetes mellitus. Metabolism. 2006;55(3):366–70.CrossRef Kim S-Y, Jo D-S, Hwang PH, Park JH, Park SK, Yi HK, et al. Preproghrelin Leu72Met polymorphism is not associated with type 2 diabetes mellitus. Metabolism. 2006;55(3):366–70.CrossRef
29.
Zurück zum Zitat Ukkola O, Ravussin E, Jacobson P, Pérusse L, Rankinen T, Tschöp M, et al. Role of ghrelin polymorphisms in obesity based on three different studies. Obes Res. 2002;10(8):782–91.CrossRef Ukkola O, Ravussin E, Jacobson P, Pérusse L, Rankinen T, Tschöp M, et al. Role of ghrelin polymorphisms in obesity based on three different studies. Obes Res. 2002;10(8):782–91.CrossRef
30.
Zurück zum Zitat Kuzuya M, Ando F, Iguchi A, Shimokata H. Preproghrelin Leu72Met variant contributes to overweight in middle-aged men of a Japanese large cohort. Int J Obes (Lond). 2006;30(11):1609–14.CrossRef Kuzuya M, Ando F, Iguchi A, Shimokata H. Preproghrelin Leu72Met variant contributes to overweight in middle-aged men of a Japanese large cohort. Int J Obes (Lond). 2006;30(11):1609–14.CrossRef
31.
Zurück zum Zitat Miraglia del Giudice E, Santoro N, Cirillo G, Raimondo P, Grandone A, D’Aniello A, et al. Molecular screening of the ghrelin gene in Italian obese children: the Leu72Met variant is associated with an earlier onset of obesity. Int J Obes Relat Metab Disord. 2004;28(3):447–50.CrossRef Miraglia del Giudice E, Santoro N, Cirillo G, Raimondo P, Grandone A, D’Aniello A, et al. Molecular screening of the ghrelin gene in Italian obese children: the Leu72Met variant is associated with an earlier onset of obesity. Int J Obes Relat Metab Disord. 2004;28(3):447–50.CrossRef
32.
Zurück zum Zitat Huang T, Shu Y, Cai Y-D. Genetic differences among ethnic groups. BMC Genomics. 2015;16:1093.CrossRef Huang T, Shu Y, Cai Y-D. Genetic differences among ethnic groups. BMC Genomics. 2015;16:1093.CrossRef
Metadaten
Titel
Leu72Met polymorphism of GHRL gene decreases susceptibility to type 2 diabetes mellitus in a Mexican population
verfasst von
Edgar Alfonso Rivera-León
Mara Anaís Llamas-Covarrubias
Sergio Sánchez-Enríquez
Erika Martínez-López
Mercedes González-Hita
Iris Monserrat Llamas-Covarrubias
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
BMC Endocrine Disorders / Ausgabe 1/2020
Elektronische ISSN: 1472-6823
DOI
https://doi.org/10.1186/s12902-020-00596-3

Weitere Artikel der Ausgabe 1/2020

BMC Endocrine Disorders 1/2020 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Echinokokkose medikamentös behandeln oder operieren?

06.05.2024 DCK 2024 Kongressbericht

Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren. 

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

Proximale Humerusfraktur: Auch 100-Jährige operieren?

01.05.2024 DCK 2024 Kongressbericht

Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.

Die „Zehn Gebote“ des Endokarditis-Managements

30.04.2024 Endokarditis Leitlinie kompakt

Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.