Background
The developing brain is highly vulnerable to oxygen deprivation or hypoxia [
1,
2]. Risk factors including placental insufficiency, decreased utero-placental blood flow, as well as neonatal pulmonary and/or cardiac dysfunction can compromise neonatal oxygenation, thus affecting the development and growth of the brain [
3,
4]. Neuroinflammation, characterized by microglial activation, has been reported to play an important role in the hypoxic injuries in the neonatal brain [
5,
6]. A large number of a nascent form of microglia, known as the amoeboid microglial cells (AMCs), preponderate in the corpus callosum as well as the cerebellum of the developing brain [
1]. Hypoxia-induced activation of AMCs is known to result in the production of excessive amounts of inflammatory cytokines, such as, TNF-α and IL-1β, along with nitric oxide (NO) and reactive oxygen species (ROS). Collectively, they cause oligodendrocyte death and axonal degeneration, as well as disruption of the immature blood–brain-barrier (BBB) in the periventricular white matter (PWM), leading to neonatal mortality and long-term neurodevelopmental deficits [
1,
6‐
8]. A similar phenomenon is observed in the hypoxic developing cerebellum in which activated AMCs have been shown to induce Purkinje neuronal death through production of TNF-α and IL-1β [
9]. However, the mechanism via which hypoxia induces microglial activation remains to be fully explored. Hence, determination of the various mechanisms controlling microglial activation will play an important part in the suppression of neuroinflammation.
Toll-like receptors (TLRs) are first-line molecules for initiating innate immune responses. Among more than ten mammalian TLRs identified [
5], TLR4 has been shown to be expressed on microglia and mediates neuroinflammatory diseases [
10]. Numerous studies have demonstrated TLR4-dependent activation of microglia in neurodegenerative diseases and trauma in the central nervous system (CNS), such as Alzheimer’s disease (AD) and Parkinson’ s disease (PD) [
11,
12], as well as brain injury induced by ethanol [
13]. Besides the above, TLR4 is also reported to be involved in hypoxia-related diseases. It has been reported recently that TLR4 is involved in brain damage and inflammation after stroke and spinal cord injury in adult mice or rats [
14,
15]. In fact, increased expression of TLR4 after hypoxic treatment in microglia has also been reported
in vitro[
16]; however, the expression and putative roles of TLR4 in microglia of neonatal rats following hypoxic injury have remained elusive.
In light of the critical role of TLR4 in neuroinflammation and hypoxic-ischemic-related diseases, the current study was undertaken to determine the expression, putative roles and mechanism of TLR4 in the microglia of hypoxic neonatal rats both
in vivo and
in vitro. Considering the involvement of hypoxia-inducible factor-1 alpha (HIF-1α) in the induction of TLR4 expression in tissue macrophages exposed to hypoxic stress [
17], we sought to determine its role in TLR4 expression in hypoxic microglia. We report here that TLR4 participated in microglial activation in the hypoxic developing brain and microglia. TLR4 expression was constitutively expressed in microglia distributed in the corpus callosum and cerebellum and was noticeably increased in the brain of hypoxic pup rats. The increase in TLR4 expression in hypoxic microglia was dependent on HIF-1α, and TLR4 was found to mediate the release of pro-inflammatory mediators through the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathway. All these could collectively contribute to neonatal brain damage resulting from hypoxic exposure. Hence, regulation of TLR4 expression in microglia may therefore present as a novel therapeutic target for the treatment of various pathological states that involve hypoxia in the CNS.
Methods
Animals and hypoxia treatment
One-day-old Wistar rats (n = 58) were exposed to hypoxia by placing them in a chamber (Model MCO 18 M; SanyoBiomedical Electrical Co, Tokyo, Japan) filled with a gas mixture of 5% O2 and 95% N2 for 2 h. The rats were then allowed to recover under normoxic conditions for 3 and 24 h, and 3, 7 and 14 days before sacrifice; another group of 58 rats kept outside the chamber were used as age-matched controls. In addition, 3-day-old neonatal rats (n = 48) were used for the preparation of primary culture of microglia. All experiments were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications number 80–23). The project was approved by the Institutional Animal Care and Use Committee, National University of Singapore (IACUC number 095/08(A2)11). All efforts were made to reduce the number of rats used and their suffering.
TLR4 inhibitor administration
To assess the effect of TLR4 on inflammation in neonatal brain following hypoxic injury, postnatal rats were given a singe intraperitoneal injection of TLR4-specific inhibitor CLI-095 (Invivogen, San Diego, USA, catalogue number tlrl-cli95) dissolved in dimethyl sulfoxide (DMSO) (0.5 mg/kg body weight) and grouped as follows: normal control rats, hypoxia rats, rats + DMSO, hypoxia + DMSO, rats + CLI-095, hypoxia + CLI-095. Each rat received a single injection of vehicle or inhibitor 1 h before exposure to hypoxia (n = 3 rats at each time interval for each group). A total of 38 rats were used for the drug administration and the control. As there was no noticeable change in microglial activation after DMSO injection, only results from the control, hypoxia and hypoxia + CLI-095 groups are presented.
Primary culture and hypoxia treatment of microglial cells
Preliminary examination by immunofluorescence labeling showed an apparent increase in TLR4 expression in the corpus callosum and cerebellum. In view of this, primary culture of microglia from these brain areas was prepared for
in vitro investigations. Glial cells were isolated from the cerebrum and cerebellum of rat pups (3-day-old) and were placed in a 75 cm
2 flask at a density of 1.2 × 10
6 cells/ml of DMEM (Sigma-Aldrich, St Louis, MO, USA) supplemented with 10% fetal calf serum (Hyclone, Thermo Scientific, Waltham, MA, USA), non-essential amino acids, and insulin. The flasks were then placed in a 5% CO
2 incubator at 37°C. The medium was changed every 48 h. Once confluent (12 to 14 days), microglia were isolated from the mixed glial population by a method previously described [
18]. The purity of microglia was assessed by immunocytochemical labeling using lectin from tomato (
Lycopersicon esculentum) (1:100, Sigma, MO, USA, catalogue number L-0401), a marker of microglia. Microglial cultures with more than 96% purity were used for the study. For immunostaining (as described below) 2.5 × 10
5 cells/well were plated in poly-L-lysine coated coverslips placed in 24-well plates. For hypoxia treatment, the culture medium was changed to fresh medium for routine culture before the cells were exposed to hypoxia by placing them in a chamber filled with a gas mixture of 3% O
2 + 5% CO
2 + 92% N
2 for 24 h.
TLR4 neutralization in primary microglia
Primary culture microglia were plated in 24-well plates with a coverslip, at a density of 2.5 × 105 cells/well and divided into four groups: group I was exposed to hypoxia for 24 h; group II was treated with TLR4 neutralization antibody (10 μg/ml, a non-toxic concentration) (Santa Cruz Biotechnology, Santa Cruz, CA, USA, catalogue number sc-10741) for 1 h and immediately challenged with hypoxia for 24 h; group III was treated with TLR4 neutralization antibody for 25 h in normoxic conditions; group IV was incubated with normal complete medium and used as a control. After the various treatments, the cells were used for immunofluorescence staining.
Double immunofluorescence labeling in postnatal rats and primary culture microglia
Double immunofluorescence was carried out in the corpus callosum and cerebellum of rats at 3 days after hypoxic exposure (n = 5) and their corresponding controls (n = 5) to confirm the expression of TLR4 in microglia. Rats were anesthetized in 6% sodium pentobarbital and perfused with a fixative containing 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. The brains were removed and placed in the same fixative for 4 h, after which they were kept at 4°C overnight in 0.1 M phosphate buffer containing 15% sucrose. Sections (40 μm thick) of the corpus callosum and cerebellum were cut using a cryostat (Leica Microsystems Nussloch GmbH, Nussloch, Germany). The sections were washed with PBS, blocked with 5% normal serum for 1 h, and incubated in anti-rabbit TLR4 polyclonal antibody (dilution 1:100; Santa Cruz Biotechnology, catalogue number sc-10741) overnight at room temperature. After incubation, Cy3-conjugated secondary antibody was added and incubated at room temperature for 1 h. The sections were again incubated with the FITC-conjugated lectin from tomato (Lycopersicon esculentum) (1:100). Double immunofluorescence staining was also carried out with TLR4 and OX42 (1:100, Chemicon, International, Temecula, CA, catalogue number CBL1512) for the corpus callosum. The sections were then washed in PBS and mounted using a fluorescent mounting medium (Dako, Oregon City, USA, catalogue number S3023). Cellular localization was then examined under a confocal microscope (FV1000; Olympus, Tokyo, Japan) with the same exposure settings for each comparison group. Double immunofluorescence was also carried out in hypoxic rats to investigate the changes of TNF-α, IL-1β and iNOS expression after injection of TLR4 inhibitor. Double immunofluorescence staining of iNOS (anti-mouse 1:100, BD Pharmingen, San Jose, CA USA, catalogue number 610432) expression at 3 h, as well as that of TNF-α (1:100; anti-rabbit polyclonal, Millipore Bioscience Research Reagents, Billerica, MA, USA, catalogue number AB1837P) and IL-1β (1:100, anti-rabbit polyclonal, Millipore Bioscience Research Reagents, catalogue number AB1832P) at 3 d after hypoxia in microglia (lectin labeled) in CLI-095-injected rats and the corresponding controls were processed as described above. For double immunofluorescence staining in the primary microglia, the cells were fixed with 4% paraformaldehyde for 20 minutes and separately incubated with anti-rabbit TLR4, anti-rabbit TNF-α, anti-rabbit IL-1β, anti-mouse iNOS and anti-rabbit NF-κB/p65 (1:100, Santa Cruz Biotechnology, catalogue number sc-109) and were processed with the immunofluorescence staining as described above, then the sections were mounted using a fluorescent mounting medium (Sigma, catalogue number F6057).
BV-2 cell culture and hypoxia treatment
BV-2 cells were used for
in vitro study because our recent studies [
19,
20] have shown that this microglial cell line responds swiftly to hypoxia exposure. This was confirmed in this study, in which expression of HIF-1α was readily detected in hypoxic BV-2 cells, and the induced HIF-1α expression was acute in onset. BV-2 cells were cultured at 37°C in growth medium containing DMEM supplemented with 2% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA), and 1% antibiotic in a humidified incubator containing 5% CO
2, and 95% air. The culture medium was changed to fresh medium for routine culture before the cells were exposed to hypoxia by placing them in a chamber filled with a gas mixture of 3% O
2 + 5% CO
2 + 92% N
2 for 2, 4, 6, 8, 12 and 24 h.
HIF-1α neutralization in BV-2 microglia
BV-2 microglia were plated in 24-well plates with coverslips at a density of 1.5 × 105 cells/well and divided into four groups: group I was subjected to hypoxia for 8 h; group II was treated with HIF-1α antibody at (10 μg/ml, a non-toxic concentration) (Chemicon, catalogue number 400080) for 1 h and immediately challenged with hypoxia for 8 h; group III was treated with HIF-1α antibody for 9 h in normoxic conditions; group IV was incubated with normal growing medium and was used as a control. After various treatments, the cells were used for immunofluorescence staining. For western blot analysis, BV-2 cells were plated in 6-well plates following the above treatments.
Silencing of TLR4 with small interfering RNA (siRNA)
TLR4 expression was silenced using TLR4 small interfering RNA (siRNA) (Ambion, Foster City, CA, USA, catalogue number s75207) according to the manufacturer’s instructions. Non-treated BV-2 cells and BV-2 cells transfected with nonspecific scramble siRNA that does not target any mouse genes (Control siRNA) were used as controls. The reverse transfection method was adopted for silencing. Briefly, after subculture, BV-2 cells were resuspended in Optimem (GIBCO, Invitrogen, catalogue number 31985070) and plated in 6-well plates at a density of 3 × 105 cells/ml. This was followed by adding 500 μl Optimem with 10 μl siRNA and 4 μl lipofectamine dropwise in the above well. The cells were incubated with the siRNA mix for 8 h and then the medium was replaced with DMEM with 2% FBS without antibiotics and incubated for another 16 h for RNA extraction to check the knockdown efficiency by reverse transcription (RT)-PCR. The microglia were subjected to hypoxia for 8 h at 40 h after transfection. After that, cells were either fixed for immunofluorescence staining, or protein was extracted for western blotting as below. For cell viability analysis, reverse transfection was carried out in a 24-well plate. At 40 h after transfection, both the transfected and non-transfected BV-2 cells were subjected to hypoxia for 8 h.
Cell viability analysis of BV-2 cells
The effect of hypoxia and siRNA transfection on the viability of BV-2 cells was evaluated by CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega, Fitchburg, WI, USA, catalogue number G3580). The cell viability of the non-treated BV-2 cells, control siRNA transfected BV-2 cells, TLR4 siRNA transfected BV-2 cells and the corresponding cells subjected to hypoxia for 8 h was measured. We added 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2 h-tetrazolium, inner salt (MTS) reagent into each well (20 μl/well) followed by incubation for 4 h at 37°C in a humidified atmosphere of 5% CO2 and 95% air, before the absorbance at 490 nm was measured using a microplate reader (GENIOS, Tecan, Switzerland). Cell viability was expressed as a percentage of control BV-2 cells.
Immunofluorescence staining in BV-2 cells
BV-2 cells were fixed with 4% paraformaldehyde in 0.1 M PBS for 15 minutes. Following rinsing with PBS, the coverslips with adherent cells were used for immunofluorescence staining. In every group, BV-2 cells were incubated, with either anti-rabbit TLR4 (1:100), anti-mouse HIF-1α (1:100), anti-rabbit TNF-α (1:100; Chemicon, Temecula, CA, USA, catalogue number AB2148P), anti-rabbit IL-1β (1:100; Chemicon, catalogue number AB1413), anti-mouse iNOS (1:100) or anti-rabbit NF-κB/p65 (1:100) overnight at room temperature. Subsequently, the cells were incubated in FITC/Cy3-conjugated secondary antibodies for 1 h at room temperature. After washing, the coverslips were mounted using a fluorescent mounting medium with 4′,6-diamidino-2-phenylindole (DAPI). All images were captured using a confocal microscope (Fluoview1000, Olympus, Tokyo, Japan).
Real time RT-PCR
Total RNA was extracted from all of the cells using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). RT reactions were performed using the RT system kit (Promega, Singapore). The resultant cDNA was diluted 10 times in double distilled H
2O and kept at −20°C for RT-PCR analysis. Primer pairs for
HIF-1α,
TNF-α,
IL-1β,
iNOS and
β-actin were designed using the primer design program (Primer 3 software version 1.0). The primer sequences for the genes and their corresponding amplicon size are listed in Table
1. RT-PCR was performed using a LightCycler (Roche Diagnostics, Indianapolis, IN, USA), and individual RT-PCRs were carried out in glass Light Cycler capillaries (Roche Diagnostics) according to the manufacturer’s instructions. The RT-PCRs were carried out in a 10-μl final volume containing the following: 5 μl 2xSYBR Green I master mix (Qiagen); 1 μl of 5 μM forward primer and 1 μl of 5 μM reverse primer; and 3 μl of diluted cDNA. After an initial denaturation step at 95°C for 15 minutes, temperature cycling was initiated. Each cycle consisted of denaturation at 94°C for 15 sec, annealing at 60°C for 25 sec, and elongation at 72°C for 20 sec. In total, 55 cycles were performed. Mouse β-actin was amplified as the control for normalizing the quantities of transcripts of each of the genes mentioned above. The differences in expression for
HIF-1α,
TNF-α,
IL-1β and
iNOS between the control and treated cells were calculated by normalizing with the
β-actin gene expression according to the following formula [
21]:
Table 1
Sequence of specific primers used for quantitative real-time PCR
TLR4
| Forward | ctacctggaatgggaggaca |
Reverse | cttagcagccatgtgttcca |
HIF-1α
| Forward | gcagcaggaattggaacatt |
Reverse | gcatgctaaatcggagggta |
TNF-α
| Forward | cgtcagccgatttgctatct |
Reverse | cggactccgcaaagtctaag |
IL-1β
| Forward | gcccatcctctgtgactcat |
Reverse | aggccacaggtattttgtcg |
iNOS
| Forward | gcttgtctctgggtcctctg |
Reverse | ctcactgggacagcacagaa |
NF-κB
| Forward | gcgtacacattctggggagt |
Reverse | ccgaagcaggagctatcaac |
Western blotting analysis
Culture medium was removed from the culture plate, and cells were washed twice with ice-cold PBS. Cells were lysed with lysis buffer, mechanically scraped off with a rubber scraper and centrifuged at 13,000 rpm for 25 minutes. Protein concentration of samples was then determined by using a protein assay kit (Bio-Rad, Hercules, CA, USA, catalogue number 500–0002). Next, 20 μg of the protein sample was loaded and separated on 10% sodium dodecyl sulfate-polyacrylamide gels. The proteins embedded in the gel were then transferred to polyvinylidene difluoride membranes using a semidry electrophoretic transfer cell (Bio-Rad). The membranes were washed with TBS-0.1% Tween buffer and then incubated with 5% nonfat dry skim milk for 30 minutes at room temperature. Next, they were incubated with anti-mouse TLR4 (1:1000; Santa Cruz Biotechnology, catalogue number sc-293072), anti-mouse HIF-1α (1:1000), anti-rabbit TNF-α (1:1000), anti-rabbit IL-1β (1:1000), anti-rabbit NF-κB/p65 (1:1500), and anti-mouse β-actin (dilution 1:10,000; Sigma-Aldrich, catalogue number A5441) overnight on a shaker at 4°C. After three washes with TBS-0.1% Tween, the membranes were incubated with horseradish peroxidase-conjugated secondary antibody for 1 h. The proteins were detected with a chemiluminescence detection system according to the manufacturer’s instruction (Supersignal West Pico Horseradish Peroxidase Detection Kit; Pierce Biotechnology, Rockford, IL, USA, catalogue number 34077) and developed on the film. The band intensity was quantified in Image J software (National Institutes of Health, NIH, USA). All experiments were repeated at least in triplicate.
Assay of TNF-α and IL-1β concentration in primary microglia by ELISA
The levels of TNF-α and IL-1β in the supernatant of primary cultured microglia after hypoxia and TLR4 neutralization were determined with TNF-α ELISA kit (IBL, Hamburg, Germany, catalogue number BE45471) and IL-1β ELISA kit (IBL, catalogue number 27193). The ELISA measurements were performed according to the manufacturer’s instructions.
Measurement of reactive oxygen species by flow cytometry
Intracelluar ROS production in BV-2 cells of different groups was evaluated by detecting the fluorescence intensity of 2′, 7′-dichlorofluorescene, the oxidized product of the fluoroprobe 5-(and 6)-chloromethyl-2′, 7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Molecular Probes, Invitrogen, catalogue number C6827) according to the manufacturer’s instruction. The amount of ROS production was considered to be directly proportional to fluorescence intensity given as cell counts and fluorescence intensity at the y-axis in the flow cytometry.
Nitric oxide concentration measurement
BV-2 cells were treated as described above and the supernatant was collected. NO concentration was measured by NO colorimetric BioAssay™ Kit (US Biological, Swampscott, MA, USA, catalogue number K262-200), according to the manufacturer’s instruction.
Phosphorylated-NF-κB p65 protein level analysis
After siRNA transfection, the cell pellets were collected and then the total protein in control and treated BV-2 cells was extracted. The protein concentration was measured by Pierce BCA protein Assay Kit (Pierce Biotechnology). Phospho-NF-κB/p65 protein level analysis was carried out using PathScan Phospho-NF-κB/p65 (Ser536) Sandwich ELISA Kit (Cell signaling, Danvers, MA, USA, catalogue number 7173) according to the manufacturer’s instruction.
Statistical analyses
The data were presented as mean ± SD. The statistical significance of differences between control, hypoxic and treatment groups was calculated using Student’s t-test and one-way analysis of variance (ANOVA). Statistical significance was determined by *P <0.05 and **P <0.01.
Discussion
Microglial cells are the primary immune effector cells in the brain and play a pivotal role in the neuroinflammatory processes associated with a variety of neurological and pathological disorders [
23]. We have reported that microglia are involved in hypoxic injuries in the developing brain, affecting both neurons and oligodendrocytes [
1,
6,
24]. Hence, a fuller understanding of the underlying molecular mechanisms of microglial activation under such conditions would be desirable for the design of a novel therapeutic strategy for the management of hypoxic damage.
It is well documented that TLR4 in microglia is a key player of neuroinflammation in several neurodegenerative and CNS trauma diseases [
12‐
14,
25]. The data presented herein provide the first evidence of the role of microglial TLR4 in a neonatal rat model of hypoxic injury. It is unequivocal from the present results that TLR4 signaling participates in the microglial activation in the hypoxic developing brain. TLR4 immunoexpression was localized in microglia in the neonatal rat corpus callosum and cerebellum and was increased in hypoxia.
In vitro studies further demonstrated that TLR4 expression in hypoxic microglia was dependent on HIF-1α and more importantly, that TLR4 mediates the production of inflammatory mediators through the NF-κB pathway. The effect of TLR4 as demonstrated
in vitro was further confirmed
in vivo by TLR4 inhibition with its specific inhibitor, namely, CLI-095. It is therefore suggested that this TLR4 pathway activation contributes to the neonatal brain damage resulting from hypoxic exposure.
Hypoxia results in changes in the signaling pathways and gene expression related to physiological as well as pathological responses. We have shown that TLR4 in microglia was overexpressed in the cerebrum and cerebellum of neonatal rats after hypoxic treatment. Very interestingly, many
in vivo experimental and clinical studies have similarly reported that TLR4 expression is elevated in cells and tissues in hypoxia-related disease. The levels of TLR4 mRNA and protein have been found to be increased in murine hearts after myocardial ischemic injury, and in human hearts derived from patients with dilated cardiomyopathy and myocarditis [
26,
27]. In addition, TLR4 expression is significantly increased in Kupffer cells in rat liver grafts, and in tubular epithelial cells and infiltrating leucocytes within the kidney following ischemia [
28,
29]. Here, we have shown that TLR4 protein expression in primary microglia subjected to hypoxic exposure for 24 h was increased. In BV-2 cells, TLR4 protein overexpression was sustained with long-term hypoxic exposure from 4 to 12 h compared with the significant increase in mRNA expression from 2 to 6 h hypoxia exposure (data not shown). Consistent with our result, the increase in TLR4 protein expression in BV-2 microglial cells or primary microglial cultures is also reported with exposure to an extremely low concentration of oxygen (O
2 tension <0.2%) for 8 or 24 h [
17]. Hypoxic stress induced either by a low oxygen tension or CoCl
2 can also enhance TLR4 expression in macrophages [
16]. However, some studies report that relatively long-term hypoxia for 48 to 72 h diminishes TLR4 expression as a result of mitochondrial generation of ROS in human umbilical vein endothelial cells [
30]. It would appear, therefore, from the above studies that differences in duration of hypoxic exposure and the type of cells investigated may account for the discrepancy in TLR4 expression over time.
It is widely demonstrated that exogenous ligands to TLR4 such as lipopolysaccharide (LPS) and endogenous ligands to TLR4, such as members of the heat shock protein family and proteoglycans, can lead to the induction of proinflammatory cytokines [
20,
31]. Intracerebral injection of LPS into the developing periventricular white matter of immature rodents results in the loss of oligodendrocytes, hypomyelination and formation of periventricular cysts through the action of TLR4 [
32]. Hence, a hypothesis that TLR4 mediates the production of proinflammatory cytokines, which in turn, contributes to damage in the developing brain after hypoxia, was formed. To test this hypothesis, we adopted siRNA transfection and antibody neutralization in BV-2 cells and primary cultured microglia, separately, in the present study. We show here that inhibition of TLR4 expression in microglia effectively suppressed the overexpression of inflammatory factors elicited by hypoxic stress. This suggests that increased microglial TLR4 activation correlates with the production of inflammatory factors after hypoxic stress, even in the absence of exogenous TLR4 ligands such as LPS. A similar function of TLR4 has also been reported in microglia stimulated with other factors. For example, we have reported previously that TLR4 signaling mediated the inflammation in microglia that was stimulated with saturated fatty acid [
33]. It has also been reported that TLR4 is upregulated in ethanol-induced microglial activation and response, suggesting that the activation of microglial TLR4 signaling could trigger the release of inflammatory mediators, which in turn could induce white matter abnormalities and neuronal dysfunctions [
13]. Accumulating evidence has shown a general participation of TLR4 in the neuroinflammatory process and brain damage of different pathological factors, suggesting that TLR4 exacerbates brain damage in neuroinflammatory diseases. In contrast, studies with TLR4 mutation mice indicate that microglia are activated via TLR4 signaling to reduce β-amyloid deposits and preserve cognitive functions from β-amyloid-mediated neurotoxicity [
12]. In this case, activation of microglia through TLR4 appears to be neuroprotective in Alzheimer’s disease. Therefore, whether TLR4 is neuroprotective or neurotoxic in neuroinflammatory disorders may vary with different pathological conditions and the different stages of these diseases. TLR4 activation appears to be tightly controlled, in order to regulate the switch between its different roles in immune surveillance or neuroinflammatory propagation. The present results tend to support the theory that TLR4 promotes the production of major inflammatory mediators such as TNF-α, IL-1β, iNOS, ROS and NO, which have been implicated in oligodendrocyte and neuronal death, thus, suggesting its detrimental role in hypoxic neonatal brain injury.
The identification of factors responsible for the induction of TLR4 expression in microglia under hypoxia has remained elusive. HIF-1 has been reported to mediate the TLR4 expression in macrophages under hypoxic conditions [
16]. This has prompted us to determine the role of HIF-1 in TLR4 expression in hypoxic microglia. HIF-1 is a major transcription factor activated during hypoxia in pathological conditions and it plays critical roles in inducing hypoxia-related gene expression and cellular responses. HIF-1 is a heterodimeric protein that consists of HIF-1β and HIF-1α, among which HIF-1β is constitutively expressed while HIF-1α expression is tightly regulated by oxygen [
34,
35]. Therefore, the overall activity of HIF-1 is dictated by the intracellular HIF-1α level. In this study, a hypoxia model was first achieved in BV-2 cells by placing the cells in a chamber filled with a gas mixture of 3% O
2, 5% CO
2 and 92% N
2 for 0.5 h or more followed by assessing the HIF-1α protein expression. Remarkably, there was no significant difference in HIF-1α mRNA expression level between the hypoxic and control cells. On the other hand, HIF-1α protein expression was significantly increased in hypoxia. It has been reported that HIF-1α is degraded rapidly by the hydroxylation of prolyl hydroxylase, and the enzymatic activity of prolyl hydroxylase is oxygen-dependent. Under hypoxic conditions, the enzymatic activity of prolyl hydroxylase is significantly reduced, resulting in the increase in HIF-1α [
36,
37]. Our findings of increased HIF-1α protein expression in hypoxic BV-2 cells is in accordance with the mechanism of HIF-1α increase in hypoxic conditions. A major finding in this study was that TLR4 expression was regulated by HIF-1α in hypoxic microglia. This is evidenced by the fact that TLR4 expression decreased on neutralization of HIF-1α with its antibody. Indeed, several recent studies support the notion of the link between HIF-1α and TLR4. Studies in macrophages found that TLR4 expression is upregulated via HIF-1α in response to hypoxic stress. Interestingly, some studies also found that LPS, a ligand of TLR4 can induce accumulation and DNA-binding activity of HIF-1α protein in murine microglial cells [
38], macrophage-differentiated cells [
39] and macrophages [
40]. In other words, LPS can raise the level of HIF-1α in a TLR4-dependent fashion, suggesting that TLR4 may act conversely to regulate HIF-1α expression. Positive correlation between TLR4 and HIF-1α has also been found in pancreatic ductal adenocarcinoma cells indicating that there may exist a crosstalk between the TLR4 signal pathway and the HIF-1 signal pathway, which may act synergistically to promote the progression of pancreatic ductal adenocarcinoma [
41]. We have demonstrated the role of HIF-1α in TLR4 expression in hypoxic microglia; but it remains to be elucidated whether the two act synergistically.
NF-κB is a transcription factor known to regulate genes of a spectrum of processes such as inflammation, stress responses, innate, and acquired immunity [
42,
43]. Under normal physiological conditions NF-κB is localized in the cytoplasm in an inactive state bound to Inhibitor of nuclear factor-κB (IκB). Under pathological conditions IκB is phosphorylated and degraded, resulting in active NF-κB [
44]. Activated NF-κB is in turn phosphorylated and subsequently translocated to the nucleus where it regulates target gene expression. It has been reported that hypoxia induces rapid degradation of phosphorylated IκB and an increase in phosphorylated NF-κB in hypoxic microglia of neonatal rats [
45]. Activation of the NF-κB pathway through the TLR4 pathway has been reported not only in LPS-treated but also in non-TLR4 ligands, such as fatty acid-treated microglia [
17,
33]. The present results showed nuclear translocation of NF-κB in hypoxic BV-2 microglial cells, and more importantly, the translocation was prevented by TLR4 knockdown. Moreover, the increase in phosphorylated NF-κB expression, which was increased after hypoxic exposure, was inhibited after TLR4 knockdown. Results with primary cultured microglia are in accordance with the observations made in BV-2 cells. The present results suggest that TLR4 mediates the activation/nuclear translocation of NF-κB in microglia after hypoxia stress. In contrast, it has been reported that hypoxia suppressed LPS-induced NF-kB activation in microglia [
17]. It is suggested that the mechanism involved in cells treated with hypoxia alone may be different from LPS stimulation along with hypoxic exposure. Although our results have shown that NF-κB signaling represents one of the downstream pathways of TLR4-induced production of inflammatory factors, the possibility of involvement of other pathways such as mitogen-activated protein kinase (MAPK) [
46] and Notch pathways in hypoxia-induced inflammation (unpublished data for Notch pathway) should also be considered.
CLI-095, a specific inhibitor of TLR4, also called TAK 242, has been reported to specifically and effectively inhibit TLR4 signaling in different animal models [
47‐
50]. We have demonstrated the effect of TLR4 inhibition on microglial activation
in vivo and this has further confirmed the role of TLR4 in neonatal brain damage following hypoxia. Very interestingly, the protective effect observed with microglia in both the cerebrum and cerebellum indicates that TLR4 may mediate in damage in both oligodendrocytes and Purkinje neurons. Indeed, obvious reduction in apoptosis of oligodendrocytes and Purkinje neurons was found after TLR4 blockade in hypoxic rats (data not shown), although direct evidence for the contribution of the inhibition of the activation of microglia awaits further investigation. Notwithstanding, it can be confidently concluded from the present results that TLR4 inhibition can effectively inhibit release of inflammatory mediators by microglia in hypoxic neonatal rats.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
EAL designed the project. CK and AH contributed to the analysis of data and finalization of the manuscript. LY conducted all experiments and prepared the first draft of the manuscript. EMK, JL and STD participated in discussion and analysis of data as well as editing the manuscript. All authors have read and approved the final version of the manuscript.