Skip to main content
Erschienen in: BMC Medical Genetics 1/2016

Open Access 01.10.2016 | Review

Identification of novel genetic variations affecting osteoarthritis patients

verfasst von: Mamdooh Abdullah Gari, Mohammed AlKaff, Haneen S. Alsehli, Ashraf Dallol, Abdullah Gari, Muhammad Abu-Elmagd, Roaa Kadam, Mohammed F. Abuzinadah, Mazin Gari, Adel M. Abuzenadah, Kalamegam Gauthaman, Heba Alkhatabi, Mohammed M. Abbas

Erschienen in: BMC Medical Genetics | Sonderheft 1/2016

Abstract

Background

Osteoarthritis (OA) is a progressive joint disease characterized by gradual degradation of extracellular matrix (ECM) components in the cartilage and bone. The ECM of cartilage is a highly specified structure that is mainly composed of type II collagen and provides tensile strength to the tissue via aggrecan and proteoglycans. However, changes in the ECM composition and structure can lead to loss of collagen type II and network integrity. Several risk factors have been correlated with OA including age, genetic predisposition, hereditary factors, obesity, mechanical injuries, and joint trauma. Certain genetic association studies have identified several genes associated with OA using genome-wide association studies (GWASs).

Results

We identified several novel genetic variants affecting genes that function in several candidate causative pathways including immune responses, inflammatory and cartilage degradation such as SELP, SPN, and COL6A6.

Conclusions

The approach of whole-exome sequencing can be a promising method to identify genetic mutations that can influence the OA disease.
Abkürzungen
OA
Osteoarthritis
ECM
Extracellular matrix
SNPs
Single nucleotide polymorphisms

Background

Osteoarthritis (OA) of the knee, which is characterized by gradual degradation of articular cartilage and subchondral bone, is the most common joint disease occurring worldwide [1, 2]. Approximately 27 million individuals in the USA alone are estimated to be diagnosed with OA which affects about 10% of adults over age 55 years old [2, 3]. Various risk factors have been associated with OA including genetic predisposition, obesity, gender, mechanical injuries, physical workload, and joint trauma. However, age is the most common factor and affects especially the weight bearing joints, which is often under mechanical stress [4]. The progression of OA is a consequence of mechanical, biological, biochemical, and molecular factor interactions. What correlation? This correlation can disturb the normal series of synthesis and degradation of articular cartilage chondrocytes and extracellular matrix (ECM) components, and subchondral bone [5, 6]. In normal cartilage ECM there is a balance between synthesis and degradation that sustain dynamic equilibrium which can be disrupted if microenvironment changes in the ECM composition and structure result in type II collagen loss [7].
Inflammatory stimuli are associated with cartilage ECM changes in OA and play an essential role in the pathogenesis of synovium inflammation and cartilage degeneration through inducing the catabolic activities of chondrocytes [8, 9]. These Inflammatory factors and cytokines include interleukins family (IL) (IL-1, IL-4, IL-6, IL-17, IL-18), and tumor necrosis factor- ∝ (TNF- ∝) [1014]. For instance, the inflammatory cytokine IL-1β is highly expressed in OA stimulating the expression of matrix degradation enzymes including MMP-1, MMP-3, and MMP-13 in chondrocytes and inhibiting ECM synthesis by decreasing the expression SOX9 [15, 16]. This response ultimately decreases the expression of collagen type II and aggrecan in articular cartilage that lead to reducing the production of chondrogenic ECM [7].
The genetic predisposition to OA is not fully understood. A number of family studies have investigated the genetic nature of OA. Familial mutations were identified in the type II collagen gene (COL2A1) [17]. Mutations affecting collagen IX gene, and COL9A1 have been linked to OA of the hip [18]. Recently, various genetic association studies have identified several genes associated with OA using genome-wide association studies (GWASs). These genes include GDF5, DUS4L, Ch7q22, MCF2L, and GNL3 [1922]. However, the genetic association between single nucleotide polymorphisms and OA disease remain controversial.
In this study, a pilot whole-exome sequencing analysis was performed on osteoarthritis cases in order to identify candidate gene mutations associated with OA in Saudi Arabia.

Methods

Patients

Peripheral blood was obtained from five end-stage osteoarthritis patients with age range of 46–70 years old. The collection of these samples were approved by the King Abdulaziz University Hospital’s ethical committee (No.11–557). Informed consent was collected from all donors prior to participation in this study.

Whole- exome sequencing

Genomic DNA was extracted from peripheral blood samples of five OA cases using QIAamp DNA blood mini kit according to the manufacture procedure (Qiagen Inc, USA). Briefly, three micrograms of genomic DNA were fragmented using the Covaris S2 system. Exome capture was performed using the Agilent’s SureSelect Whole-Exome Enrichment kit (v4). Fragment libraries were prepared from the captured exomes for sequencing on the SOLiD 5500 platform (Applied Biosystems). Fragments were sequenced in single reads of 50 bp. Reads were aligned to the UCSC hg19 reference sequence of the human genome using the LifeScope analysis pipeline which was also utilized for variants identification and annotation.

PCR amplification and sanger sequencing

DNA was amplified using custom oligonucleotides primers listed in Table 1. Polymerase chain reaction reactions (PCR) was performed to amplify the selected primers. The PCR reactions were conducted using Go Taq Green Master Mix (Promega, USA). The reactions conditions were performed at one denaturation cycle at 95o C for 15 min followed by 35 cycles of denaturation at 95o C for 30 s, and annealing at 52o C for 30 s and extension at 72o C for 30 s. The final step was done at 72o C for 10 min. To perform Sanger sequencing, purification of PCR products using ethanol precipitation were required prior to the cycle sequencing reaction. Purified PCR products were labeled with BigDye Terminator kit v3.1 (ABI Biosystem, USA) for cycle sequencing according to the manufacture procedure. After the second purification for the PCR products, the sequencing analysis was performed on the automated sequencer from Applied Biosystems 3500 DNA Analyzer.
Table 1
Primers used for validation of the single nucleotide variations identified by whole-exome sequencing
Gene
Forward primer (5′→3′)
Reverse primer (5′→3′)
SELP
CCTGTGTAACACAATGCG
CTACAGCTCCTACTACTG
FIGNL1
ATGGTAGCAATGTCAGCAG
GAAGATCGTATCCTAGTGG
SPN
CTCGTGCTGAGCAGAGGC
CATCCTCACTGGCCACCAG
USP36
CTCGTGCTGAGCAGAGGC
CTCACTGGCCACCAGTGG
TNRC6B
TCTGGCAGAGAACAGGCTC
CACCTGTTATTGTTGTCC
HSPG2
GACTCTGCTATGCCATGTC
CACAGGTGGTCAGCGACAC
SUSD5
AGGTGTCTGCTTGACAGTG
CTAGTTACTCCTGATCAGC
ITGA8
GGAAGGCTAATAACGATCAG
GGTTAGTAACGTGTGTTCTC
PXN
CATCCAAGAGACTCTCCAC
CCATCTGCTGACCTCTAG
NLRP6
AGCAACTGGAGCTTCGTG
GTGGCGCTCGATGTCGCGC
COL2A1
CTTAGTCCAGAGACTGCG
GGCCTGACAGGTCAGCTG
COL6A6
CATCGGTGCTGCACTCAG
CTGTGGTACAGATGTTGCG
GAS6
GGCACGCAGCAGATGCAG
CCCAGGCTGGTAGCTGAG

Results

Whole-exome sequencing of 5 OA patients revealed several novel mutations that are predicted to be damaging to protein function (SIFT). Identified variants were prioritized according to their ontology grouping in ECM and/or inflammation (Table 2). A novel c.381G > T, p.Asn127Lys mutation in the gene selectin P (SELP) has not been reported in dbSNP, 1000 Genomes project or the ExAC project. We have validated this mutation by Sanger sequencing and confirmed its existence in the heterozygous state in one patient (Fig. 1). Another novel mutation was identified in the collagen type VI alpha 6 (COL6A6) gene in another OA patient. This heterozygous c.2263T > C, p.Ile1137Thr change was also validated by Sanger sequencing. Other single nucleotide variants were identified that had no minor allele frequency reported by dbSNP. However, they were also found by the ExAC project albeit at a very low frequency (Fig. 1). These genes were identified that impact cartilages extracellular matrix (ECM) organization and cartilage development including heparan sulfate proteoglycan2 (HSPG2), sushi domain containing 5 (SUSD5), integrin subunit alpha 8 (ITGA8), paxillin (PXN), collagen type II alpha 1 (COL2A1), and fidgetin-like 1 (FIGNL1). Moreover, our results revealed some mutations associated in the inflammatory response and immune response such as pyrin domain containing 6 (NLRP6) and growth arrest specific 6 (GAS6); ubiquitin specific peptidase 36 (UPS36), sialophorin (SPN), and trinucleotide repeat containing 6B (TNRC6B) respectively (Table 2).
Table 2
Single nucleotide variants identified in our whole-exome screen of OA patients and validated by Sanger sequencing
Gene
Chromosome position
AA change
Nucleotide change
Protein ID
dbSNP
ExAC frequency
HSPG2
1,22154535,G,A
p.Arg4174Cys
c.4391C > T
ENSP00000363827
rs199899258
0.00005066
SUSD5
3,33194727,G,A
p.Thr466Met
c.629C > T
ENSP00000308727
rs377664152
0.00009122
ITGA8
10,15628601,G,A
p.Ala785Val
c.1063C > T
ENSP00000367316
rs371802080
0.0000248
PXN
12,120660505,T,C
p.Tyr181Cys
c.605A > G
ENSP00000267257
rs371118243
0.0001199
COL2A1
12,48371204,G,A
p.Arg1058Cys
c.1487C > T
ENSP00000369889
rs148350640
0.00002493
COL6A6
3,130293232,T,C
p.Ile1137Thr
c.2263T > C
ENSP00000351310
rs200274210
0.006855
FIGNL1
7,50513244,A,G
p.Met581Thr
c.674T > C
ENSP00000349356
rs200453649
0.000173
USP36
17,76803235,T,C
p.Arg631Gly
c.1123A > G
ENSP00000441214
rs112843316
0.000082
SPN
16,29676061,C,T
p.Arg338Cys
c.400C > T
ENSP00000353238
rs200681097
0.000485
TNRC6B
22,40661502,G,T
p.Gly423Val
c.1833G > T
ENSP00000401946
rs201057205
0.0003241
SELP
1,169586366,G,T
p.Asn127Lys
c.381G > T
ENSP00000263686
NA
NA
NLRP6
11,281256,G,T
p.Ala508Ser
c.892G > T
ENSP00000309767
rs373174851
0.000101
GAS6
13,114535300,G,A
p.Pro415Leu
c.721C > T
ENSP00000349962
NA
0.0000353

Discussion

To identify the predisposition genetic factors and the association of these candidate genes with the disease, we conducted a pilot whole-exome sequencing on 5 OA patients from Saudi Arabia. The result of the exome sequence analysis identified several nucleotide variants affecting candidate genes that could likely contribute in OA susceptibility and involved in crucial pathways including cartilage degradation and development, inflammatory, and immune response [5].
The finding of mutations in these genes functionally interrelated to cartilage ECM organization and cartilage signaling pathway may have functional consequences. One of the identified mutations in this study is the p.Arg4174Cys mutation found in the HSPG2 gene. This gene plays multiple roles in the extracellular matrix organization involved in cartilage development, endochondral bone morphogenesis, and chondroitin sulfate metabolic process. Additionally, it is responsible for glycosaminoglycan (GAG) biosynthetic and catabolic process that maintains the expression and aggregation of mature chondrogenic markers [23]. SUSD5 harbors the p.Thr466Met mutation in one OA patient from our cohort. This gene influences the hyaluronic acid binding, a core component in articular cartilage [24]. Another mutation was identified is the p.Ala785Val mutation in ITGA8, and the p.Tyr181Cys mutation in PXN gene. Both ITGA8 and PXN genes are important in cellular matrix adhesion, ECM organization, and transforming growth factor beta receptor regulation [25, 26]. Most importantly, SNPs variants in cartilage related genes that impacts cartilage development, cartilage condensation, ECM and collagen fibril organization, and collagen catabolic process has been associated in our OA patients. That includes the p.Arg1058Cys mutation in COL2A1, and the p.Ile1137Thr mutation in COL6A6. In addition, the results of this study showed the p.Met581Thr mutation in FIGNL1 gene; a gene that influences the regulatory role in osteoblast proliferation and differentiation [27].
The result of this exome analysis revealed other mutations related to the inflammatory response such as NLRP6 and GAS6; and immune response such as USP36, SPN, and TNRC6B. The identified mutation in UPS36 gene is p.Arg631Gly. This gene is a known member of the ubiquitin specific protease family that regulates the immune signaling pathway [28]. The p.Arg338Cys mutation in SPN was also identified in our patients, and the influence of this gene can affect cellular defense responses and the regulation of the tumor necrosis factor (TNF) pathway [29]. The mutation found in TNRC6B gene is p.Gly423Val; this gene not only act in the innate immune response, but also regulates fibroblast growth factor receptor signaling pathway [30]. Furthermore, the results showed some other mutations involved in the inflammatory response. Interestingly, we identified a novel SNV variation in the SELP, p.Asn127Lys, which has not been reported previously. The function of SELP is to stimulate leukocytes adhesion in the site of injury, which could explain the presence of inflammatory markers IL family, and TNF in OA patients [31]. The p.Ala508Ser mutation in NLRP6 gene, and the p.Pro415Leu mutation in the GAS6 gene were identified in our screen; both genes regulates the inflammatory response [32, 33]. However, GAS6 specifically regulates tumor necrosis factor-mediated signaling pathway and macrophage cytokine production [33].

Conclusions

OA is a progressive joint disease characterized by gradual degradation of (ECM) components in the cartilage and bone. Several risk factors have been associated with OA such as genetic predisposition and molecular factors. In this study, a pilot whole-exome sequencing was performed and we identified several genes candidate genes associated with OA in Saudi Arabia that function in various causative pathways including immune response, inflammatory and cartilage degradation. Despite the small sample size of this group, a hypothesis could be formulated that states the importance of personalized genetic screening of OA patients in order to understand the individual’s genetic makeup potentially responsible for susceptibility towards OA.

Acknowledgment

We would like to acknowledge the financial support provided by the Sheikh Salem Bin Mahfouz Scientific Chair for Treatment of Osteoarthritis by Stem Cells. The Center of Innovation in Personalized Medicine (CIPM), Stem Cell Lab at Center of Excellence for Genomic Medicine Research and the Orthopedics Stem Cell Research Lab (CEGMR) at King Abdulaziz University Hospital for supporting this study.

Declaration

This article has been published as part of BMC Medical Genetics Volume 17 Supplement 1, 2016: Proceedings of the 3rd International Genomic Medicine Conference: medical genetics. The full contents of the supplement are available online at http://​bmcmedgenet.​biomedcentral.​com/​articles/​supplements/​volume-17-supplement-1.

Funding

This study was funded by the Sheikh Salem Bin Mahfouz Scientific Chair for Treatment of Osteoarthritis by Stem Cells. Publication fees for this article are paid by the Center of Excellence in Genomic Medicine Research (CEGMR), King Abdulaziz University, Jeddah, Kingdom of Saudi Arabia.

Availability of data and materials

Not applicable.

Authors’ contributions

MAG, AMA, MAE, AD and MMA participated in the study design. MA, MAG, AG, MG and HSA performed data collection, DNA extraction and sequencing studies. KG, HA, RK, MAE and AD analyzed data, interpreted the results and drafted the manuscript. MAG, AMA, MMA, and MFA participated in critical review, editing and finalization of manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.
Not applicable.
This study was approved by the Research Committee of the Biomedical Ethics Unit, Faculty of Medicine, King Abdulaziz University, Jeddah, Saudi Arabia. Participants in the study provided their consent prior to sample collection.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Lane NE, Brandt K, Hawker G, Peeva E, Schreyer E, Tsuji W, Hochberg MC. OARSI-FDA initiative: defining the disease state of osteoarthritis. Osteoarthr Cartil. 2011;19(5):478–82.CrossRefPubMed Lane NE, Brandt K, Hawker G, Peeva E, Schreyer E, Tsuji W, Hochberg MC. OARSI-FDA initiative: defining the disease state of osteoarthritis. Osteoarthr Cartil. 2011;19(5):478–82.CrossRefPubMed
2.
Zurück zum Zitat Sandell LJ. Etiology of osteoarthritis: genetics and synovial joint development. Nat Rev Rheumatol. 2012;8(2):77–89.CrossRefPubMed Sandell LJ. Etiology of osteoarthritis: genetics and synovial joint development. Nat Rev Rheumatol. 2012;8(2):77–89.CrossRefPubMed
3.
Zurück zum Zitat Luo SX, Li S, Zhang XH, Zhang JJ, Long GH, Dong GF, Su W, Deng Y, Liu Y, Zhao JM, et al. Genetic polymorphisms of interleukin-16 and risk of knee osteoarthritis. PLoS One. 2015;10(5), e0123442.CrossRefPubMedPubMedCentral Luo SX, Li S, Zhang XH, Zhang JJ, Long GH, Dong GF, Su W, Deng Y, Liu Y, Zhao JM, et al. Genetic polymorphisms of interleukin-16 and risk of knee osteoarthritis. PLoS One. 2015;10(5), e0123442.CrossRefPubMedPubMedCentral
4.
6.
Zurück zum Zitat van der Kraan PM. Understanding developmental mechanisms in the context of osteoarthritis. Curr Rheumatol Rep. 2013;15(6):333.CrossRefPubMed van der Kraan PM. Understanding developmental mechanisms in the context of osteoarthritis. Curr Rheumatol Rep. 2013;15(6):333.CrossRefPubMed
7.
Zurück zum Zitat Maldonado M, Nam J. The role of changes in extracellular matrix of cartilage in the presence of inflammation on the pathology of osteoarthritis. Biomed Res Int. 2013;2013:284873.CrossRefPubMedPubMedCentral Maldonado M, Nam J. The role of changes in extracellular matrix of cartilage in the presence of inflammation on the pathology of osteoarthritis. Biomed Res Int. 2013;2013:284873.CrossRefPubMedPubMedCentral
8.
9.
Zurück zum Zitat Goldring SR, Goldring MB. The role of cytokines in cartilage matrix degeneration in osteoarthritis. Clin Orthop Relat Res. 2004(427 Suppl):S27–36. Goldring SR, Goldring MB. The role of cytokines in cartilage matrix degeneration in osteoarthritis. Clin Orthop Relat Res. 2004(427 Suppl):S27–36.
10.
Zurück zum Zitat Han L, Lee HS, Yoon JH, Choi WS, Park YG, Nam SW, Lee JY, Park WS. Association of IL-17A and IL-17F single nucleotide polymorphisms with susceptibility to osteoarthritis in a Korean population. Gene. 2014;533(1):119–22.CrossRefPubMed Han L, Lee HS, Yoon JH, Choi WS, Park YG, Nam SW, Lee JY, Park WS. Association of IL-17A and IL-17F single nucleotide polymorphisms with susceptibility to osteoarthritis in a Korean population. Gene. 2014;533(1):119–22.CrossRefPubMed
11.
Zurück zum Zitat Hulin-Curtis SL, Bidwell JL, Perry MJ. Evaluation of IL18 and IL18R1 polymorphisms: genetic susceptibility to knee osteoarthritis. Int J Immunogenet. 2012;39(2):106–9.CrossRefPubMed Hulin-Curtis SL, Bidwell JL, Perry MJ. Evaluation of IL18 and IL18R1 polymorphisms: genetic susceptibility to knee osteoarthritis. Int J Immunogenet. 2012;39(2):106–9.CrossRefPubMed
12.
Zurück zum Zitat Kaarvatn MH, Jotanovic Z, Mihelic R, Etokebe GE, Mulac-Jericevic B, Tijanic T, Balen S, Sestan B, Dembic Z. Associations of the interleukin-1 gene locus polymorphisms with risk to hip and knee osteoarthritis: gender and subpopulation differences. Scand J Immunol. 2013;77(2):151–61.CrossRefPubMed Kaarvatn MH, Jotanovic Z, Mihelic R, Etokebe GE, Mulac-Jericevic B, Tijanic T, Balen S, Sestan B, Dembic Z. Associations of the interleukin-1 gene locus polymorphisms with risk to hip and knee osteoarthritis: gender and subpopulation differences. Scand J Immunol. 2013;77(2):151–61.CrossRefPubMed
13.
Zurück zum Zitat Kaewkiattiyot S, Honsawek S, Vejchapipat P, Chongsrisawat V, Poovorawan Y. Association of X-prolyl aminopeptidase 1 rs17095355 polymorphism with biliary atresia in Thai children. Hepatol Res. 2011;41(12):1249–52.CrossRefPubMed Kaewkiattiyot S, Honsawek S, Vejchapipat P, Chongsrisawat V, Poovorawan Y. Association of X-prolyl aminopeptidase 1 rs17095355 polymorphism with biliary atresia in Thai children. Hepatol Res. 2011;41(12):1249–52.CrossRefPubMed
14.
Zurück zum Zitat Yigit S, Inanir A, Tekcan A, Tural E, Ozturk GT, Kismali G, Karakus N. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis. Gene. 2014;537(1):6–9.CrossRefPubMed Yigit S, Inanir A, Tekcan A, Tural E, Ozturk GT, Kismali G, Karakus N. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis. Gene. 2014;537(1):6–9.CrossRefPubMed
15.
Zurück zum Zitat Dai L, Zhang X, Hu X, Zhou C, Ao Y. Silencing of microRNA-101 prevents IL-1beta-induced extracellular matrix degradation in chondrocytes. Arthritis Res Ther. 2012;14(6):R268.CrossRefPubMedPubMedCentral Dai L, Zhang X, Hu X, Zhou C, Ao Y. Silencing of microRNA-101 prevents IL-1beta-induced extracellular matrix degradation in chondrocytes. Arthritis Res Ther. 2012;14(6):R268.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Tung JT, Arnold CE, Alexander LH, Yuzbasiyan-Gurkan V, Venta PJ, Richardson DW, Caron JP. Evaluation of the influence of prostaglandin E2 on recombinant equine interleukin-1beta-stimulated matrix metalloproteinases 1, 3, and 13 and tissue inhibitor of matrix metalloproteinase 1 expression in equine chondrocyte cultures. Am J Vet Res. 2002;63(7):987–93.CrossRefPubMed Tung JT, Arnold CE, Alexander LH, Yuzbasiyan-Gurkan V, Venta PJ, Richardson DW, Caron JP. Evaluation of the influence of prostaglandin E2 on recombinant equine interleukin-1beta-stimulated matrix metalloproteinases 1, 3, and 13 and tissue inhibitor of matrix metalloproteinase 1 expression in equine chondrocyte cultures. Am J Vet Res. 2002;63(7):987–93.CrossRefPubMed
17.
Zurück zum Zitat Knowlton RG, Katzenstein PL, Moskowitz RW, Weaver EJ, Malemud CJ, Pathria MN, Jimenez SA, Prockop DJ. Genetic linkage of a polymorphism in the type II procollagen gene (COL2A1) to primary osteoarthritis associated with mild chondrodysplasia. N Engl J Med. 1990;322(8):526–30.CrossRefPubMed Knowlton RG, Katzenstein PL, Moskowitz RW, Weaver EJ, Malemud CJ, Pathria MN, Jimenez SA, Prockop DJ. Genetic linkage of a polymorphism in the type II procollagen gene (COL2A1) to primary osteoarthritis associated with mild chondrodysplasia. N Engl J Med. 1990;322(8):526–30.CrossRefPubMed
18.
Zurück zum Zitat Bateman JF. Genetic aspects of osteoarthritis. Semin Arthritis Rheum. 2005;34(6 Suppl 2):15–8.PubMed Bateman JF. Genetic aspects of osteoarthritis. Semin Arthritis Rheum. 2005;34(6 Suppl 2):15–8.PubMed
19.
Zurück zum Zitat Day-Williams AG, Southam L, Panoutsopoulou K, Rayner NW, Esko T, Estrada K, Helgadottir HT, Hofman A, Ingvarsson T, Jonsson H, et al. A variant in MCF2L is associated with osteoarthritis. Am J Hum Genet. 2011;89(3):446–50.CrossRefPubMedPubMedCentral Day-Williams AG, Southam L, Panoutsopoulou K, Rayner NW, Esko T, Estrada K, Helgadottir HT, Hofman A, Ingvarsson T, Jonsson H, et al. A variant in MCF2L is associated with osteoarthritis. Am J Hum Genet. 2011;89(3):446–50.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Evangelou E, Valdes AM, Kerkhof HJ, Styrkarsdottir U, Zhu Y, Meulenbelt I, Lories RJ, Karassa FB, Tylzanowski P, Bos SD, et al. Meta-analysis of genome-wide association studies confirms a susceptibility locus for knee osteoarthritis on chromosome 7q22. Ann Rheum Dis. 2011;70(2):349–55.CrossRefPubMed Evangelou E, Valdes AM, Kerkhof HJ, Styrkarsdottir U, Zhu Y, Meulenbelt I, Lories RJ, Karassa FB, Tylzanowski P, Bos SD, et al. Meta-analysis of genome-wide association studies confirms a susceptibility locus for knee osteoarthritis on chromosome 7q22. Ann Rheum Dis. 2011;70(2):349–55.CrossRefPubMed
21.
Zurück zum Zitat Kerkhof HJ, Lories RJ, Meulenbelt I, Jonsdottir I, Valdes AM, Arp P, Ingvarsson T, Jhamai M, Jonsson H, Stolk L, et al. A genome-wide association study identifies an osteoarthritis susceptibility locus on chromosome 7q22. Arthritis Rheum. 2010;62(2):499–510.PubMedPubMedCentral Kerkhof HJ, Lories RJ, Meulenbelt I, Jonsdottir I, Valdes AM, Arp P, Ingvarsson T, Jhamai M, Jonsson H, Stolk L, et al. A genome-wide association study identifies an osteoarthritis susceptibility locus on chromosome 7q22. Arthritis Rheum. 2010;62(2):499–510.PubMedPubMedCentral
22.
Zurück zum Zitat Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, et al. A functional polymorphism in the 5′ UTR of GDF5 is associated with susceptibility to osteoarthritis. Nat Genet. 2007;39(4):529–33.CrossRefPubMed Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, et al. A functional polymorphism in the 5′ UTR of GDF5 is associated with susceptibility to osteoarthritis. Nat Genet. 2007;39(4):529–33.CrossRefPubMed
23.
Zurück zum Zitat Brown AJ, Alicknavitch M, D’Souza SS, Daikoku T, Kirn-Safran CB, Marchetti D, Carson DD, Farach-Carson MC. Heparanase expression and activity influences chondrogenic and osteogenic processes during endochondral bone formation. Bone. 2008;43(4):689–99.CrossRefPubMedPubMedCentral Brown AJ, Alicknavitch M, D’Souza SS, Daikoku T, Kirn-Safran CB, Marchetti D, Carson DD, Farach-Carson MC. Heparanase expression and activity influences chondrogenic and osteogenic processes during endochondral bone formation. Bone. 2008;43(4):689–99.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Vicent S, Luis-Ravelo D, Anton I, Garcia-Tunon I, Borras-Cuesta F, Dotor J, De Las RJ, Lecanda F. A novel lung cancer signature mediates metastatic bone colonization by a dual mechanism. Cancer Res. 2008;68(7):2275–85.CrossRefPubMed Vicent S, Luis-Ravelo D, Anton I, Garcia-Tunon I, Borras-Cuesta F, Dotor J, De Las RJ, Lecanda F. A novel lung cancer signature mediates metastatic bone colonization by a dual mechanism. Cancer Res. 2008;68(7):2275–85.CrossRefPubMed
25.
Zurück zum Zitat Lu M, Munger JS, Steadele M, Busald C, Tellier M, Schnapp LM. Integrin alpha8beta1 mediates adhesion to LAP-TGFbeta1. J Cell Sci. 2002;115(Pt 23):4641–8.CrossRefPubMed Lu M, Munger JS, Steadele M, Busald C, Tellier M, Schnapp LM. Integrin alpha8beta1 mediates adhesion to LAP-TGFbeta1. J Cell Sci. 2002;115(Pt 23):4641–8.CrossRefPubMed
26.
27.
Zurück zum Zitat Park SJ, Kim SJ, Rhee Y, Byun JH, Kim SH, Kim MH, Lee EJ, Lim SK. Fidgetin-like 1 gene inhibited by basic fibroblast growth factor regulates the proliferation and differentiation of osteoblasts. J Bone Miner Res. 2007;22(6):889–96.CrossRefPubMed Park SJ, Kim SJ, Rhee Y, Byun JH, Kim SH, Kim MH, Lee EJ, Lim SK. Fidgetin-like 1 gene inhibited by basic fibroblast growth factor regulates the proliferation and differentiation of osteoblasts. J Bone Miner Res. 2007;22(6):889–96.CrossRefPubMed
28.
Zurück zum Zitat Engel E, Viargues P, Mortier M, Taillebourg E, Coute Y, Thevenon D, Fauvarque MO. Identifying USPs regulating immune signals in Drosophila: USP2 deubiquitinates Imd and promotes its degradation by interacting with the proteasome. Cell Commun Signal. 2014;12:41.PubMedPubMedCentral Engel E, Viargues P, Mortier M, Taillebourg E, Coute Y, Thevenon D, Fauvarque MO. Identifying USPs regulating immune signals in Drosophila: USP2 deubiquitinates Imd and promotes its degradation by interacting with the proteasome. Cell Commun Signal. 2014;12:41.PubMedPubMedCentral
29.
Zurück zum Zitat Fratazzi C, Manjunath N, Arbeit RD, Carini C, Gerken TA, Ardman B, Remold-O’Donnell E, Remold HG. A macrophage invasion mechanism for mycobacteria implicating the extracellular domain of CD43. J Exp Med. 2000;192(2):183.CrossRefPubMedPubMedCentral Fratazzi C, Manjunath N, Arbeit RD, Carini C, Gerken TA, Ardman B, Remold-O’Donnell E, Remold HG. A macrophage invasion mechanism for mycobacteria implicating the extracellular domain of CD43. J Exp Med. 2000;192(2):183.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Edwards TL, Michels KA, Hartmann KE, Velez Edwards DR. BET1L and TNRC6B associate with uterine fibroid risk among European Americans. Hum Genet. 2013;132(8):943–53.CrossRefPubMedPubMedCentral Edwards TL, Michels KA, Hartmann KE, Velez Edwards DR. BET1L and TNRC6B associate with uterine fibroid risk among European Americans. Hum Genet. 2013;132(8):943–53.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat Timasheva YR, Nasibullin TR, Imaeva EB, Erdman VV, Kruzliak P, Tuktarova IA, Nikolaeva IE, Mustafina OE. Polymorphisms of inflammatory markers and risk of essential hypertension in Tatars from Russia. Clin Exp Hypertens (New York, NY: 1993). 2015;37(5):398–403. Timasheva YR, Nasibullin TR, Imaeva EB, Erdman VV, Kruzliak P, Tuktarova IA, Nikolaeva IE, Mustafina OE. Polymorphisms of inflammatory markers and risk of essential hypertension in Tatars from Russia. Clin Exp Hypertens (New York, NY: 1993). 2015;37(5):398–403.
32.
Zurück zum Zitat Loeser RF, Varnum BC, Carlson CS, Goldring MB, Liu ET, Sadiev S, Kute TE, Wallin R. Human chondrocyte expression of growth-arrest-specific gene 6 and the tyrosine kinase receptor axl: potential role in autocrine signaling in cartilage. Arthritis Rheum. 1997;40(8):1455–65.CrossRefPubMed Loeser RF, Varnum BC, Carlson CS, Goldring MB, Liu ET, Sadiev S, Kute TE, Wallin R. Human chondrocyte expression of growth-arrest-specific gene 6 and the tyrosine kinase receptor axl: potential role in autocrine signaling in cartilage. Arthritis Rheum. 1997;40(8):1455–65.CrossRefPubMed
33.
Zurück zum Zitat Tschopp J, Martinon F, Burns K. NALPs: a novel protein family involved in inflammation. Nat Rev Mol Cell Biol. 2003;4(2):95–104.CrossRefPubMed Tschopp J, Martinon F, Burns K. NALPs: a novel protein family involved in inflammation. Nat Rev Mol Cell Biol. 2003;4(2):95–104.CrossRefPubMed
Metadaten
Titel
Identification of novel genetic variations affecting osteoarthritis patients
verfasst von
Mamdooh Abdullah Gari
Mohammed AlKaff
Haneen S. Alsehli
Ashraf Dallol
Abdullah Gari
Muhammad Abu-Elmagd
Roaa Kadam
Mohammed F. Abuzinadah
Mazin Gari
Adel M. Abuzenadah
Kalamegam Gauthaman
Heba Alkhatabi
Mohammed M. Abbas
Publikationsdatum
01.10.2016
Verlag
BioMed Central
Erschienen in
BMC Medical Genetics / Ausgabe Sonderheft 1/2016
Elektronische ISSN: 1471-2350
DOI
https://doi.org/10.1186/s12881-016-0330-2