Skip to main content
Erschienen in: Journal of Experimental & Clinical Cancer Research 1/2020

Open Access 01.12.2020 | Research

LncRNA HOTAIR-mediated MTHFR methylation inhibits 5-fluorouracil sensitivity in esophageal cancer cells

verfasst von: Shuyao Zhang, Fuchun Zheng, Liqun Zhang, Zuojun Huang, Xiaoshan Huang, Zhen Pan, Shuang Chen, Chenchen Xu, Yi Jiang, Shuyi Gu, Chengkuan Zhao, Qiuzhen Zhang, Ganggang Shi

Erschienen in: Journal of Experimental & Clinical Cancer Research | Ausgabe 1/2020

Abstract

Background

Esophageal cancer (EC) represents one of the most aggressive digestive neoplasms globally, with marked geographical variations in morbidity and mortality. Chemoprevention is a promising approach for cancer therapy, while acquired chemoresistance is a major obstacle impeding the success of 5-fluorouracil (5-FU)-based chemotherapy in EC, with the mechanisms underlying resistance not well-understood. In the present study, we focus on exploring the role of long non-coding RNA (lncRNA) HOTAIR in EC progression and sensitivity of EC cells to 5-FU.

Methods

Paired cancerous and pre-cancerous tissues surgically resected from EC patients were collected in this study. Promoter methylation of the MTHFR was assessed by methylation-specific PCR. RIP and ChIP assays were adopted to examine the interaction of DNA methyltransferases (DNMTs) with lncRNA HOTAIR and MTHFR, respectively. EC cells resistant to 5-FU were induced by step-wise continuous increasing concentrations of 5-FU. The sensitivity of EC cells to 5-FU in vivo was evaluated in nude mice treated with xenografts of EC cells followed by injection with 5-FU (i.p.).

Results

We found reciprocal expression patterns of lncRNA HOTAIR and MTHFR in EC tissues and human EC cells. Interference with lncRNA HOTAIR enhanced 5-FU-induced apoptosis, exhibited anti-proliferative activity, and reduced promoter methylation of the MTHFR in EC cells. Besides, overexpression of MTHFR attenuated the acquired chemoresistance induced by overexpression of lncRNA HOTAIR in EC cells. At last, enhanced chemosensitivity was observed in vivo once nude mice xenografted with lncRNA HOTAIR-depleted EC cells.

Conclusion

Together, our study proposes that pharmacologic targeting of lncRNA HOTAIR sensitizes EC cells to 5-FU-based chemotherapy by attenuating the promoter hypermethylation of the MTHFR in EC.
Hinweise
Shuyao Zhang, Fuchun Zheng, Liqun Zhang and Zuojun Huang contributed equally to this work.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
EC
Esophageal cancer
5-FU
5-fluorouracil
lncRNAs
long non-coding RNAs
DNMTs
DNA methyltransferases
MTHFR
Methylenetetrahydrofolate reductase
HOTAIR
HOX transcript antisense RNA

Background

Esophageal cancer (EC) ranks as the eighth most prevalent cancer globally [1]. Multiple risk factors are reported to contribute its occurrence and development, including cigarette smoking, alcohol consumption, obesity, and low fruit/vegetable intake [2]. Currently, standard treatment modalities for patients with EC include surgery, radiation therapy, and chemotherapy [3]. Despite substantial advances in diagnosis and treatment, EC has overall poor prognosis, with overall 5-year survival rates ranging between 15 and 25% [4]. 5-fluorouracil (5-FU) is widely considered to be the most effective chemotherapeutic agent for treatment for EC [5]. However, esophageal tumors frequently develop resistance to 5-FU, especially in recurrence cases [6]. Therefore, there is a need to identify novel molecular targets that can facilitate the promotion of chemosensitivity of EC cells to 5-FU.
LncRNAs are a group of non-protein-coding transcripts with nucleotides lengths of 200 or more and are reported as dysregulated in tumor initiation and progression, including EC [7]. LncRNA HOX transcript antisense RNA (HOTAIR), an inhibitor of the HOXD genes, is secreted from the HOXC locus [8]. LncRNA HOTAIR, a typical lncRNA, has been implicated in the development of esophageal squamous cell carcinoma (ESCC) [9]. In particular, HOTAIR is understood to be capable of regulating cell invasiveness, migration, and apoptosis in ESCC, and thus has been proposed as a novel biomarker relevant to its diagnosis and prognosis [10]. Notably, Yan et al. have suggested that upregulation of HOTAIR is associated with chemoresistance [11]. Previous studies have revealed that alterations in DNA methylation are innate to various human cancers, including EC [12, 13]. HOTAIR is known to regulate gene expression through epigenetic modifications, including DNA methylation [14].
In addition, methylenetetrahydrofolate reductase (MTHFR), involved in 5-methyltetrahydrofolate synthesis and homocysteine remethylation, may affect the occurrence and development of cancer by directly regulating DNA methylation [15]. The role of MTHFR in EC has also been demonstrated [16]. Notably, MTHFR has been shown to affect 5-FU based chemotherapy in colorectal cancer [17]. However, the role of lncRNA HOTAIR-mediated methylation of the MTHFR promoter in the chemosensitivity of EC cells to 5-FU remains largely enigmatic. Thus, the aim of the present study was to investigate the possible effects of lncRNA HOTAIR on the chemosensitivity of EC cells to 5-FU via a potential regulation of MTHFR methylation.

Methods

Ethics statement

The study protocol was approved by the Ethics Committee of the Cancer Hospital of Shantou University Medical College. Written informed consent was obtained from all patients prior to enrollment. All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animal by International Committees. Every effort was made to minimize the numbers and suffering of the included animals.

Study subjects

A total of 70 EC tissue samples and adjacent normal tissues were collected from patients (43 patients < 50 years old and 27 patients ≥50 years old) diagnosed with non-specific invasive EC at the Cancer Hospital of Shantou University Medical College from April 2017 to March 2019. All included EC tissues were diagnosed pathologically as ESCC. Morphological observations and diagnosis of all cases were made by more than two deputy pathologists according to World Health Organization (WHO) classification criteria [18]. There were 47 cases with EC at grade I + II and 23 cases with EC at grade III. Tumor staging was conducted according to American Joint Committee on Cancer (AJCC) 8th Edition TNM Staging Form [19]. The patients were classified into the TNM stage of I + II (58) and the TNM stage of IIIa (12). All patients showed no lymph node metastasis (LNM), and received neither radiotherapy nor chemotherapy prior to surgery.

Preparation of 5-FU resistant EC cell lines

Cell lines in this study were tested for mycoplasma contamination prior to experiments. The EC cell lines KYSE150, EC109, and TE-1 and human normal esophageal epithelial cell line HEEC were purchased from American Type Culture Collection (ATCC) (VA, USA). All cell lines were added with RPMI 1640 medium (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) supplemented with 10% FBS and 100 U/mL penicillin -streptomycin and cultured in a 5% CO2 incubator at 37 °C. Next, the concentration gradient method was used to construct 5-FU resistant EC cell lines (TE-1/5-FU) for three times, where 5-FU concentrations used were from 1 to 20 μg/mL, respectively. After transduction for 190 days, the concentration 5 μg/mL of 5-FU that could stabilize the drug resistance of TE-1 cells was selected for subsequent analysis.

Cell grouping and treatment

TE-1/5-FU cells (4 × 105 cells/well) were inoculated in 6-well plates. Expression vectors containing the lncRNA HOTAIR or MTHFR, two shRNAs against lncRNA HOTAIR, and their respective negative controls (empty vector, scramble shRNA) were obtained from Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China) and delivered into TE-1/5-FU cells using the lipofectamin 2000 kit according to manufactures’ instructions. 5-Aza-CdR was used to inhibit DNA methylation in cells.

RNA isolation and quantification

Total RNA was extracted from tissues and cells using RNeasy Mini Kit (Qiagen Company, Hilden, Germany). The total RNA was reverse transcribed into cDNA using a PrimeScript RT kit (TaKaRa Biotechnology Co. Ltd., Dalian, China) according to the manufacturer’s protocol. Primer sequences of lncRNA HOTAIR, MTHFR-U, and MTHFR-M (Table 1) were designed and then synthesized by TaKaRa Biotechnology Co. Ltd. (Dalian, China). The ABI7500 quantitative PCR instrument (7500, ABI Company, Oyster Bay, NY, USA) was employed to conduct reverse transcription quantitative polymerase chain reaction (RT-qPCR). The 2-ΔΔCt method was used to calculate the relative mRNA expression levels of the target genes.
Table 1
Primer sequences for RT-qPCR
Genes
 
Sequences (5′-3′)
lncRNA HOTAIR
F
GGAAAGATCCAAATGGGACCA
R
CTAGGAATCAGCACGAAGCAAA
MTHFR-U
F
GGCTGACCTGAAGCACTTGAA
R
AGAAAAGCTGCGTGATGATGAA
MTHFR-M
F
TGAAGGAGAAGGTGTCTGCGGGA
R
AGGACGGTGCGGTGAGAGTG
GAPDH
F
AGAAGGCTGGGGCTCATTTG
R
AGGGGCCATCCACAGTCTTC
F forward, R reverse

Western blot analysis

TE-1 cells or tissue samples were lysed with radio immunoprecipitation assay (RIPA) peptide lysis buffer (BB-3209, Shanghai BestBio Co., Ltd., Shanghai, China) to extract the total protein. The proteins were separated with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for 1 h and then transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated with rabbit anti-human primary antibody MTHFR (1: 1000, ab203785, Abcam Inc., Cambridge, MA, USA) at 4 °C overnight with GAPDH (1: 500, ab8245, Abcam Inc., Cambridge, MA, USA) used as the internal reference gene. Next, the membrane was incubated with horseradish peroxidase (HRP)-labeled goat anti-rabbit immunoglobulin G (IgG) (1: 20000; ab205718, Abcam Inc., Cambridge, MA, USA). Protein blots were visualized by ECL-associated fluorography (Merck Millipore, Billerica, MA, USA).

Dual luciferase reporter gene assay

The MTHFR dual luciferase reporter gene vector and mutants with lncRNA HOTAIR binding site mutation (MTHFR-WT and MTHFR-MUT) were each constructed. These two reporter plasmids were co-transfected into cells that overexpressed lncRNA HOTAIR and NC plasmids. The Dual-Luciferase Reporter Assay System from Genecopoeia (D0010, Beijing Solarbio Science & Technology Co. Ltd., Beijing, China) was employed to detect the luciferase activity of MTHFR promoter region induced by lncRNA HOTAIR in EC cells. The fluorescence intensity was measured using the GLomax20/20 Luminometer (Promega Corporation, Madison, WI, USA).

RNA-fluorescence in situ hybridization (FISH) assay

The website http://​lncatlas.​crg.​eu/​ was employed to predict the localization of lncRNA HOTAIR in TE-1 EC cells, which was identified using a FISH kit (Roche Diagnostics GmbH, Mannheim, Germany). The cells were incubated with a digoxin-labeled lncRNA HOTAIR probe (Sigma, St. Louis (MO, USA), followed by staining with 4′, 6-diamidino-2-phenylindole (DAPI) (Sigma, St. Louis, MO, USA). Then, the cells were washed with cold PBS and photographed using a confocal laser scanning microscope (FV1000, Olympus, Tokyo, Japan).

RNA-binding protein immunoprecipitation (RIP) assay

Cell lysates were incubated with protein-G agarose beads pre-coated with anti-DNMT1 (ab13537, Abcam, Cambridge, UK), anti-DNMT3a (, ab2850, Abcam, Cambridge, UK), anti-DNMT3b (ab2851, Abcam, Cambridge, UK) or normal rabbit IgG. The resultant complexes were then incubated with 150 μL proteinase K buffer to extract protein. Total RNA was extracted using the TRIZOL method and used for RT-qPCR.

Methylation-specific PCR (MSP) assay

Frozen EC tissues and adjacent normal tissues were obtained. DNA was extracted using the ammonia-chloroform extraction method and modified with sodium bisulfite. The modified DNA was purified using a DNA Purification Kit (Promega, Madison, WI, USA), and amplified with bisulfite-modified DNA as a template. Primers for MTHFR MSP-M and MTHFR MSP-U were synthesized by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China). The PCR reaction conditions were 35 cycles of pre-denaturation at 95 °C for 10 min, denaturation at 94 °C for 1 min, annealing at 60 °C for 50 s, and extension at 72 °C for 10 min. The MSP results were determined as described in a previous study [20].

Chromatin immunoprecipitation (ChIP) assay

A ChIP kit (Merck Millipore, Billerica, MA, USA) was used to detect the enrichment of DNMT1, DNMT3a, and DNMT3b within the MTHFR promoter region. TE-1 cells were treated with formaldehyde for 10 min to generate DNA-protein cross-links. Cell lysates were sonicated to generate chromatin fragments of 200–300 bp and immunoprecipitated with DNMT1 (ab13537, Abcam, Cambridge, UK), DNMT3a (ab2850, Abcam, Cambridge, UK), DNMT3b (ab2851, Abcam, Cambridge, UK), IgG as a negative control, or RNA polymerase ii antibody as a positive control. The Protein Agarose/Sepharose was used to precipitate the endogenous DNA-protein complexes, followed by de-crosslinking at 65 °C overnight. MTHFR promoter-specific primer sequences (Table 1) were used for detecting the binding of DNMT1, DNMT3a, and DNMT3b with the MTHFR promoter region.

5-ethynyl-2′-deoxyuridine (EdU) labeling assay

EC cells were seeded into 96-well plates (1.6 × 105 cells/well), and experimental procedures were conducted according to the instructions of EdU kit (C10310, Guangzhou RiboBio Co., Ltd., Guangdong, China). Briefly, each well was added with 50 μM EdU (100 μL) at 37 °C for 4 h, followed by fixation in 4% formaldehyde at room temperature for 15 min. Next, the cells were treated with 0.2% Triton X-100 at room temperature for 5 min and 100 μL Apollo® mixture (C10338–2, Guangzhou RiboBio Co., Ltd., Guangdong, China) for 30 min, and then cultured with 100 μL Hoechst33342 (Guangzhou RiboBio Co., Ltd., Guangdong, China). DAPI was added for 30 min in order to label the cell nuclei. Cells were observed and imaged using a fluorescence microscope (Olympus, Tokyo, Japan). The Image-Pro Plus (IPP) 6.0 software (Media Cybernetics, Bethesda, MD, USA) was utilized to count the EdU-positive cells (red).

Cell counting kit-8 (CCK-8) assay

When cell confluence reached about 80%, the cells were washed with PBS twice, and trypsinized (at 0.25%) to prepare a single cell suspension. After counting, these cells were inoculated into 96-well plates (3 × 103 ~ 6 × 103 cells/well) at 200 μL of suspension per well. Six wells were used as replicates of each condition. After incubation for 24 h, 48 h, and 72 h, samples were removed and incubated with 10 μL CCK-8 (VP757, DOJINDO, Kumamoto, Kyushu, Japan) for 2 h. The optical density (OD) value was measured at a wavelength of 450 nm using a microplate reader (BIOBASE-EL10A, Jinan Boxin Biotechnology Co., Ltd., Jinan, China). The cell viability curve was plotted with time-duration of incubation on the X-axis and OD value on the Y-axis. All experiments were repeated three times and the IC50 value was determined, which referred to the drug concentration required for cell survival. The IC50 value was calculated by the least square method using FORECAST function in EXCEL software.

Flow cytometry

Propidium (PI) staining was adopted to assess the cell cycle of EC cells. Briefly, 48 h after transfection, cells were washed 3 times with cold PBS, centrifuged, and the supernatant was discarded. The cell concentration was adjusted to approximately 1 × 105 cells/mL after cells were resuspended in PBS, and added with 1 mL of pre-cooled 75% ethanol (− 20 °C) to fix cells at 4 °C for 1 h, followed by centrifugation. The ice ethanol and the supernatant were discarded, and cells were added with 100 μL of RNase A in the dark, water bathed for 30 min 37 °C, and then added with 400 μL of PI (Sigma). The cells were then incubated in dark conditions at 4 °C for 30 min, and the cell cycle was determined using flow cytometry at 488 nm.
The apoptosis of EC cells was detected using an Annexin V-fluorescein isothiocyanate (FITC)/PI double staining kit (556,547, SHANGHAI SOLJA TECHNOLOGY CO., LTD., Shanghai, China). In brief, the cell suspension was incubated with 5 μL Annexin V-FITC for 15 min, followed by incubation with 5 μL PI for 5 min. FITC was detected at wavelengths of 480 nm and 530 nm and PI was detected at a wavelength of more than 575 nm using a flow cytometer (Cube6, Partec, Inc., IL, USA).

Tumor xenografts in nude mice

A total of 48 nude mice of specific pathogen free (SPF) grade (aging 4 weeks and weighing 14–16 g) were obtained from the Medical Discovery Leader Co., Ltd. (Beijing China). A total of 2 × 106 cells were mixed with 50 μL Matrigel Matrix (1: 1) and inoculated subcutaneously into the armpit of the nude mice. After 28 days, anesthesia was induced, and the nude mice were euthanized using 3% Sodium pentobarbital (1 ml/100 g, P3761, Sigma-Aldrich Chemical Company, St Louis, MO, USA), and the tumor tissues were obtained for further analysis.

Immunohistochemistry

The expression of MTHFR was detected using peroxidase-labeled streptavidin peroxidase (SP). The paraffin samples of mouse tissues were sectioned in a continuous manner into 5 μm sections. After routine dehydration, immunohistochemistry was carried out according to routine protocol. Briefly, after treatment with 3% hydrogen peroxide at room temperature for 10 min to block endogenous peroxidase, normal non-immune animal serum was added for 10 min. The sections were treated with primary antibody rabbit anti human MTHFR (ab203785, 1: 1000, Abcam, Cambridge, UK), followed by overnight incubation at 4 °C, added with 1: 500 diluted secondary antibody (goat anti rabbit IgG) labeled with biotin, incubated at 37 °C for 20 min, and added with 50 μl streptavidin-peroxidase solution, followed by incubation at room temperature for 10 min. The sections were visualized with diaminobesidine for 5–10 min and counter-stained with hematoxylin, followed by dehydration, permeabilization, and mounting. The sections were observed under a microscope, and PBS served as NC.

Statistical analysis

All data was analyzed using SPSS 22.0 software (IBM Corp., Armonk, NY, USA). The measurement data was expressed as mean ± standard deviation of three independent tests. The independent sample t-test was used to compare measurement data between two groups including gene expression between EC tissues and adjacent normal tissues. Comparison among multiple groups was conducted using one-way analysis of variance (ANOVA), followed by Tukey’s post hoc test. Repeated measures ANOVA was used to compare tumor volume among groups, followed by Tukey’s post hoc test. p value < 0.05 was indicative of statistical significance.

Results

Web-available microarray analysis indicated involvement of HOTAIR and MTHFR in EC

The EC-related gene expression dataset GSE100942 was used to predict HOTAIR expression in EC. Results showed that HOTAIR was highly expressed in EC (Fig. 1a), which was consistent with previous reports. EC-related data in the TCGA database was analyzed using ‘Ualcan’ database, and the resultant survival curve showed that HOTAIR expression was significantly correlated with survival in EC (p < 0.05) (Fig. 1b). MTHFR expression data were obtained from another EC-related gene expression dataset GSE100942, which showed that MTHFR was poorly expressed in EC (Fig. 1c). The co-expression analysis of lncRNA HOTAIR and MTHFR gene by MEM showed highly significant co-expression (p < 0.001) (Fig. 1d).

LncRNA HOTAIR was upregulated in EC tissues and cells

The TCGA database revealed that HOTAIR was highly expressed in EC (Fig. 2a). The EC tissues and adjacent normal tissues from 70 patients were used to determine HOTAIR expression using RT-qPCR, which was correspondingly found to be significantly higher in EC tissues than in adjacent normal tissues (p < 0.05) (Fig. 2b). Furthermore, RT-qPCR displayed increased HOTAIR expression in EC cell lines EC109, KYSE150, and TE-1 in comparison to HEEC cells (p < 0.05) (Fig. 2c). The website ‘Lncatlas’ predicted that lncRNA HOTAIR was located in the nucleus (Fig. 2d), which was further verified using FISH (Fig. 2e). These results indicated that HOTAIR expression was elevated in EC tissues and cells and it was mainly located in the nucleus.

Silencing of HOTAIR promoted chemosensitivity to 5-FU

In order to study the effect of lncRNA HOTAIR on drug-resistant cell lines, we used CCK-8 assay to test the sensitivity of cell lines to 5-FU, which showed that compared with KYSE150 and EC109 cell lines, the TE-1 cell line was the most resistant to 5-FU (p < 0.05) (Fig. 3a). Thus, TE-1 cells were selected to construct TE-1/5-FU resistant strain. 5-FU at higher concentration (from 1 μg/mL to 20 μg/mL) gradually decreased the cell surviving rate (Fig. 3b). We further used CCK-8 assay to compare the surviving rate of TE-1 cell line and TE-1/5-FU cell line at a 5-FU concentration of 5 μg/mL, and found that the surviving rate of TE-1/5-FU cell line was significantly increased relative to that of TE-1 cell line (p < 0.05) (Fig. 3c). To identify the relationship of lncRNA HOTAIR to drug resistance in EC, we determined HOTAIR expression in the TE-1 cell line and in the TE-1/5-FU cell line. HOTAIR exhibited significantly higher expression in the TE-1/5-FU cell line (p < 0.05) (Fig. 3d). Next, TE-1/5-FU cells were treated with oe-NC, sh-NC, oe-lncRNA HOTAIR, sh1-lncRNA HOTAIR, and sh2-lncRNA HOTAIR plasmids to determine the effects of knockdown or overexpression of lncRNA HOTAIR on chemosensitivity. The findings revealed that as compared with the TE-1/5-FU cells treated with sh-NC plasmids (Fig. 3e), HOTAIR expression was decreased in TE-1/5-FU cells treated with sh1-lncRNA HOTAIR and sh2-lncRNA HOTAIR plasmids, with a more pronounced decline upon treatment with sh1-lncRNA HOTAIR (p < 0.05). Thus, TE-1/5-FU cells treated with sh1-lncRNA HOTAIR were selected for further experiments. HOTAIR expression was increased in TE-1/5-FU cells treated with overexpressed lncRNA HOTAIR. In addition, CCK-8 assay displayed that the depletion of lncRNA HOTAIR inhibited cell viability (p < 0.05) (Fig. 3f) and reduced IC50, which suggested that depletion of lncRNA HOTAIR promoted sensitivity and inhibited the chemoresistance of TE-1/5-FU cells to 5-FU (p < 0.05) (Fig. 3g). EdU assay and flow cytometry showed that silencing of lncRNA HOTAIR suppressed TE-1/5-FU cell proliferation and enhanced apoptosis (p < 0.05) (Fig. 3h, i), while restored lncRNA HOTAIR exerted the opposite effects. Next, we adopted PI staining using flow cytometry to verify the cell cycle of EC cells, which identified more cells at the G0/G1 phase but fewer cells in the S phase upon silencing lncRNA HOTAIR, whereas an opposite trend was observed in response to lncRNA HOTAIR overexpression (p < 0.05) (Fig. 3j). Thus, the findings implied that downregulation of HOTAIR promoted chemosensitivity to 5-FU and apoptosis and suppressed the proliferation of EC cells.

HOTAIR promoted DNA methylation of MTHFR promoter

In order to further study downstream regulatory mechanisms of lncRNA HOTAIR, RT-qPCR was adopted, which displayed that the MTHFR mRNA level was lower in EC tissues than that in adjacent normal tissues (p < 0.05) (Fig. 4a). MethPrimer software was utilized to predict the 4200 bp nucleotide sequence of the MTHFR promoter region and to analyze the CpG islands in its promoter region. The results confirmed that there were CpG islands in the promoter region of the MTHFR gene (Fig. 4b), indicating that MTHFR expression was reduced owing to methylation of its promoter region. In order to prove whether methylation occurred in the promoter region of the MTHFR gene in EC tissues, we detected the methylation level of CpG islands in the promoter region of MTHFR gene in 70 EC tissues and adjacent normal tissues using MSP. The results demonstrated that the methylation level of MTHFR promoter region was higher in EC tissues [methylation rate was 68.6% (48/70)] than that in adjacent normal tissues [methylation rate was 21.4% (15/70)] (p < 0.05) (Fig. 4c). These results suggest that the high methylation level of MTHFR led to reduction of MTHFR expression in EC.
Subsequently, we speculated whether methylation of the MTHFR promoter region was regulated by HOTAIR. In order to analyze the correlation between methylation level of MTHFR promoter region and lncRNA HOTAIR, a Blast comparison was applied to identify possible binding sites between the lncRNA HOTAIR and MTHFR promoter regions. The results showed that there were base complementary binding sites between the lncRNA HOTAIR and MTHFR promoter regions (Fig. 4d). Dual luciferase reporter gene assay displayed that the luciferase activity of MTHFR-WT was reduced in the presence of HOTAIR as compared to that of MTHFR-MUT (p < 0.05) (Fig. 4e), suggesting that HOTAIR can bind to the promoter region of the MTHFR gene, which was consistent with bioinformatic prediction. Further, RIP was employed to determine the enrichment of HOTAIR in relation to DNA methyltransferases DNMT1, DNMT3a and DNMT3b. The TE-1/5-FU cells overexpressing HOTAIR showed marked enrichment of HOTAIR onto the methyltransferases (Fig. 4f). In addition, CHIP was performed to determine enrichment of methyltransferases within the MTHFR promoter region, which showed that the methyltransferases were remarkably enriched in the MTHFR promoter region in TE-1/5-FU cells overexpressing HOTAIR (Fig. 4g).
In addition, MSP was utilized to assess the methylation level in the CpG site of the MTHFR promoter region in TE-1 cells with restored or depleted HOTAIR. The results indicated that the CpG sites of the MTHFR promoter region had high methylation in TE-1 cells with elevated HOTAIR (Fig. 4h), and MTHFR expression decreased (Fig. 4i-k), whereas the level of methylation was decreased following the downregulation of HOTAIR, (Fig. 4h) along with elevated levels of MTHFR (Fig. 4i-k). To further study the regulating mechanisms of HOTAIR and MTHFR, demethylation of the MTHFR promoter region was conducted using DNA methyltransferase inhibitor 5-Aza-CdR. MSP results illustrated that in TE-1 cells treated with overexpressed HOTAIR and DMSO, the MTHFR methylation level was elevated (Fig. 4h), and MTHFR expression decreased (Fig. 4i-k). Upon 5-Aza-CdR addition, the enrichment of the methyltransferases was reduced within the MTHFR promoter region in TE-1 cells (Fig. 4h), and MTHFR expression increased (Fig. 4i-k). The results revealed that the methylation level of the CpG site within the MTHFR promoter region was closely correlated with the expression of HOTAIR. In sum, the effect of HOTAIR on the methylation level of the MTHFR promoter region was exerted through DNA methyltransferases.

MTHFR facilitated chemosensitivity of EC cells to 5-FU

It has been shown that MTHFR was poorly expressed in EC. In order to study the effect of MTHFR on the chemosensitivity of TE-1/5-FU cells to 5-FU, Western blot analysis was performed to measure the MTHFR protein levels in TE-1 cells and TE-1/5-FU cells, which suggested that HOTAIR exhibited a higher expression in TE-1/5-FU cells than in TE-1 cells (p < 0.05) (Fig. 5a). Next, TE-1/5-FU cells were treated with elevated MTHFR and/or lncRNA HOTAIR to verify the roles of MTHFR in chemosensitivity of EC cells to 5-FU. Western blot analysis revealed that MTHFR expression increased in TE-1/5-FU cells treated with overexpressed MTHFR, and decreased in TE-1/5-FU cells treated with overexpressed MTHFR and lncRNA HOTAIR (Fig. 5b). In addition, the CCK-8 assay displayed that upregulated MTHFR inhibited cell viability (p < 0.05) (Fig. 5c) and reduced IC50, and the effects of elevated HOTAIR could be reversed by overexpressed MTHFR, which suggested that upregulation of MTHFR promoted the chemosensitivity and inhibited the chemoresistance of TE-1/5-FU cells to 5-FU (p < 0.05) (Fig. 5d). EdU assay and flow cytometry showed that elevated MTHFR suppressed TE-1/5-FU cell proliferation and enhanced apoptosis (p < 0.05) (Fig. 5e, f), while the effects of elevated HOTAIR could be reversed by overexpressed MTHFR. Moreover, PI staining and flow cytometry results revealed that overexpression of MTHFR increased the cells at the G0/G1 phase, but reduced the cells in the S phase, indicating that the effects of elevated HOTAIR on EC cell cycle could be reversed by overexpressed MTHFR (p < 0.05) (Fig. 5g). These results confirmed that restoration of MTHFR facilitated chemosensitivity to 5-FU and apoptosis while suppressing the proliferation of EC cells.

Silencing of HOTAIR promoted chemosensitivity of EC cells to 5-FU in vivo

To further study the regulatory effects of lncRNA HOTAIR on chemosensitivity of EC cells in vivo, TE-1 cells treated with vectors containing sh-NC and sh-lncRNA HOTAIR, oe-NC, or oe-lncRNA HOTAIR were inoculated into nude mice. Twenty-eight days after TE-1 implantation, we examined whether silencing of lncRNA HOTAIR increased the sensitivity of EC cells to 5-FU. When the size of transplanted tumors was larger than 600 mm3, nude mice were intraperitoneally injected with 5-FU and DMSO (as control). The results implied that tumor volume and weight significantly reduced in nude mice injected with cells treated with sh-lncRNA HOTAIR and DMSO, and 5-FU treatment further inhibited tumor growth (p < 0.05). However, increased tumor volume and weight were observed in nude mice injected with cells treated with oe-lncRNA HOTAIR and DMSO, whereas no marked difference was identified upon 5-FU treatment (Fig. 6a-f). Immunohistochemistry showed that the positive rate of MTHFR in tumors was significantly increased by silencing of lncRNA HOTAIR (p < 0.05), and an opposite trend was observed upon overexpression of lncRNA HOTAIR (Fig. 6g-h). MSP results revealed that silencing of lncRNA HOTAIR inhibited MTHFR methylation in tumor tissues, and an opposite trend was observed upon overexpression of lncRNA HOTAIR (Fig. 6j-k). These findings illustrated that HOTAIR knockdown could upregulate MTHFR to promote chemosensitivity of EC cells to 5-FU in vivo.

Discussion

EC, affecting more than 450,000 people, remains the sixth leading cause of cancer-related death worldwide [4]. Despite progressive improvements in the arena of chemotherapy of EC, resistance to chemotherapy remains a stumbling block [5]. In recent years, an lncRNA, HOTAIR, has been reported to exert an anticarcinogenic effect on EC [10]. The aim of the present study was to determine the modulatory effects of silencing of HOTAIR on the cellular chemosensitivity of EC in relation to 5-FU mediated via the regulation of MTHFR methylation.
Initially, the data obtained in the present study demonstrated that HOTAIR was upregulated in EC tissues, particularly in EC tissues resistant to 5-FU. Accumulating data have similarly indicated that many lncRNAs are aberrantly expressed in various human cancers, including EC [21]. A number of lncRNAs, including HOTAIR, are reported as highly expressed in EC tissues and cells [7]. The results of the current study displayed that silencing of HOTAIR promoted chemosensitivity to 5-FU and apoptosis while repressing cell proliferation and tumor growth in EC. In general, lncRNAs have been shown to be key mediators in chemoresistance, and lncRNA LINC00261 has been reported to significantly modulate the chemoresistance observed in 5-FU in human EC [22]. Lu et al. have similarly shown that 5-FU could repress proliferation and induce the apoptosis of EC cells [5]. Interestingly, the depletion of HOTAIR has been noted to inhibit 5-FU resistance in colorectal cancer, suppress cell viability and induce G1-phase arrest of colorectal cancer cells [23]. Overexpression of HOTAIR is associated with the elevation of cell proliferation, migration, and invasion in EC, facilitating its progression and development [9]. Other co-workers have also confirmed that depletion of lncRNA HOTAIR contributes to the inhibition of cell proliferation and tumor metastasis and facilitation of apoptosis in ESCC [8, 24], corresponding with the findings of the present study. Taken together, there exists significant evidence indicating that HOTAIR is able to promote the chemosensitivity of EC cells to 5-FU by inhibiting proliferation and increasing the apoptosis of EC cells.
The present study also demonstrated that MTHFR was poorly expressed in EC tissues and cells, and elevated MTHFR enhanced chemosensitivity of EC cells to 5-FU with exhibition of lower methylation levels at the MTHFR promoter region. It has been confirmed that MTHFR is of great significance in the progression and development of EC [16]. At present, 5-FU is regarded to be the most common chemotherapeutic treatment option in colorectal cancer, and systemic exposure to 5-FU is reported as generally regulated by MTHFR [25]. A recent study has demonstrated that MTHFR could induce the sensitivity of colorectal cancer cells to 5-FU [17]. Our results imply that silencing of HOTAIR elevated MTHFR expression by decreasing MTHFR methylation. DNA methylation has been said to exert its influence on the chemosensitivity of cancers by regulating expression of genes associated with cell cycle and apoptosis [26]. The MTHFR is reported to play anti-tumor roles in human cancers through hypomethylation of DNA [27]. HOTAIR is also proved to regulate DNA methylation [14], although the targeting relationship between HOTAIR and MTHFR has not been documented earlier. Based on our findings and existing evidence, we suggest that HOTAIR expression is negatively correlated with MTHFR expression via DNA methylation. Overall, the current study has demonstrated that downregulation of HOTAIR increased MTHFR expression by decreasing MTHFR methylation, leading to an elevation in the chemosensitivity of EC cells to 5-FU.

Conclusion

In conclusion, silencing of lncRNA HOTAIR promotes the chemosensitivity of EC cells to 5-FU and leads to abnormal cell proliferation and apoptosis of EC cells via the regulation of MTHFR methylation (Fig. 7). This identification of HOTAIR knockdown via MTHFR in mediating the chemosensitivity of EC cells to 5-FU may advance an understanding of the molecular mechanisms underpinning EC, with the potential of serving as a prognostic marker during chemotherapeutic treatment of EC. Moreover, our results provided a novel glimpse of the mechanistic link between essential non-coding RNA HOTAIR and MTHFR, and proposed the negative regulatory axis between HOTAIR/MTHFR as a promising molecular target for EC intervention. Further studies are required, however, to fully understand the specific mechanisms of HOTAIR combined with MTHFR methylation on chemosensitivity to 5-FU treatment in EC.

Acknowledgements

We express our sincere gratitude to our colleagues for their suggestions and assistance.
The study protocol was approved by the Ethics Committee of the Cancer Hospital of Shantou University Medical College. Written informed consent was obtained from all patients prior to enrollment. All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animal by International Committees. Every effort was made to minimize the numbers and suffering of the included animals.
Not applicable.

Competing interests

The author declares no competing interest exists.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Li B, Xu WW, Han L, Chan KT, Tsao SW, Lee NPY, et al. MicroRNA-377 suppresses initiation and progression of esophageal cancer by inhibiting CD133 and VEGF. Oncogene. 2017;36(28):3986–4000.CrossRef Li B, Xu WW, Han L, Chan KT, Tsao SW, Lee NPY, et al. MicroRNA-377 suppresses initiation and progression of esophageal cancer by inhibiting CD133 and VEGF. Oncogene. 2017;36(28):3986–4000.CrossRef
2.
Zurück zum Zitat Hu Y, Correa AM, Hoque A, Guan B, Ye F, Huang J, et al. Prognostic significance of differentially expressed mirnas in esophageal cancer. Int J Cancer. 2011;128(1):132–43.CrossRef Hu Y, Correa AM, Hoque A, Guan B, Ye F, Huang J, et al. Prognostic significance of differentially expressed mirnas in esophageal cancer. Int J Cancer. 2011;128(1):132–43.CrossRef
3.
Zurück zum Zitat Liu J, Wang Z, Wu K, Li J, Chen W, Shen Y, et al. Paclitaxel or 5-fluorouracil/esophageal stent combinations as a novel approach for the treatment of esophageal cancer. Biomaterials. 2015;53:592–9.CrossRef Liu J, Wang Z, Wu K, Li J, Chen W, Shen Y, et al. Paclitaxel or 5-fluorouracil/esophageal stent combinations as a novel approach for the treatment of esophageal cancer. Biomaterials. 2015;53:592–9.CrossRef
4.
Zurück zum Zitat Lin EW, Karakasheva TA, Hicks PD, Bass AJ, Rustgi AK. The tumor microenvironment in esophageal cancer. Oncogene. 2016;35(41):5337–49.CrossRef Lin EW, Karakasheva TA, Hicks PD, Bass AJ, Rustgi AK. The tumor microenvironment in esophageal cancer. Oncogene. 2016;35(41):5337–49.CrossRef
5.
Zurück zum Zitat Chuang-Xin L, Wen-Yu W, Yao C, Xiao-Yan L, Yun Z. Quercetin enhances the effects of 5-fluorouracil-mediated growth inhibition and apoptosis of esophageal cancer cells by inhibiting nf-kappab. Oncol Lett. 2012;4(4):775–8.CrossRef Chuang-Xin L, Wen-Yu W, Yao C, Xiao-Yan L, Yun Z. Quercetin enhances the effects of 5-fluorouracil-mediated growth inhibition and apoptosis of esophageal cancer cells by inhibiting nf-kappab. Oncol Lett. 2012;4(4):775–8.CrossRef
6.
Zurück zum Zitat Jin YY, Chen QJ, Xu K, Ren HT, Bao X, Ma YN, et al. Involvement of microrna-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via regulation of pten. Mol Cell Biochem. 2016;422(1–2):161–70.CrossRef Jin YY, Chen QJ, Xu K, Ren HT, Bao X, Ma YN, et al. Involvement of microrna-141-3p in 5-fluorouracil and oxaliplatin chemo-resistance in esophageal cancer cells via regulation of pten. Mol Cell Biochem. 2016;422(1–2):161–70.CrossRef
7.
Zurück zum Zitat Liang Y, Chen X, Wu Y, Li J, Zhang S, Wang K, et al. Lncrna casc9 promotes esophageal squamous cell carcinoma metastasis through upregulating lamc2 expression by interacting with the creb-binding protein. Cell Death Differ. 2018;25(11):1980–95.CrossRef Liang Y, Chen X, Wu Y, Li J, Zhang S, Wang K, et al. Lncrna casc9 promotes esophageal squamous cell carcinoma metastasis through upregulating lamc2 expression by interacting with the creb-binding protein. Cell Death Differ. 2018;25(11):1980–95.CrossRef
8.
Zurück zum Zitat Lv XB, Lian GY, Wang HR, Song E, Yao H, Wang MH. Long noncoding rna hotair is a prognostic marker for esophageal squamous cell carcinoma progression and survival. PLoS One. 2013;8(5):e63516.CrossRef Lv XB, Lian GY, Wang HR, Song E, Yao H, Wang MH. Long noncoding rna hotair is a prognostic marker for esophageal squamous cell carcinoma progression and survival. PLoS One. 2013;8(5):e63516.CrossRef
9.
Zurück zum Zitat Xu F, Zhang J. Long non-coding rna hotair functions as mirna sponge to promote the epithelial to mesenchymal transition in esophageal cancer. Biomed Pharmacother. 2017;90:888–96.CrossRef Xu F, Zhang J. Long non-coding rna hotair functions as mirna sponge to promote the epithelial to mesenchymal transition in esophageal cancer. Biomed Pharmacother. 2017;90:888–96.CrossRef
10.
Zurück zum Zitat Chen FJ, Sun M, Li SQ, Wu QQ, Ji L, Liu ZL, et al. Upregulation of the long non-coding rna hotair promotes esophageal squamous cell carcinoma metastasis and poor prognosis. Mol Carcinog. 2013;52(11):908–15.CrossRef Chen FJ, Sun M, Li SQ, Wu QQ, Ji L, Liu ZL, et al. Upregulation of the long non-coding rna hotair promotes esophageal squamous cell carcinoma metastasis and poor prognosis. Mol Carcinog. 2013;52(11):908–15.CrossRef
11.
Zurück zum Zitat Yan J, Dang Y, Liu S, Zhang Y, Zhang G. Lncrna hotair promotes cisplatin resistance in gastric cancer by targeting mir-126 to activate the pi3k/akt/mrp1 genes. Tumour Biol. 2016;37(12):16345–55. Yan J, Dang Y, Liu S, Zhang Y, Zhang G. Lncrna hotair promotes cisplatin resistance in gastric cancer by targeting mir-126 to activate the pi3k/akt/mrp1 genes. Tumour Biol. 2016;37(12):16345–55.
12.
Zurück zum Zitat Reinert T, Modin C, Castano FM, Lamy P, Wojdacz TK, Hansen LL, et al. Comprehensive genome methylation analysis in bladder cancer: identification and validation of novel methylated genes and application of these as urinary tumor markers. Clin Cancer Res. 2011;17(17):5582–92.CrossRef Reinert T, Modin C, Castano FM, Lamy P, Wojdacz TK, Hansen LL, et al. Comprehensive genome methylation analysis in bladder cancer: identification and validation of novel methylated genes and application of these as urinary tumor markers. Clin Cancer Res. 2011;17(17):5582–92.CrossRef
13.
Zurück zum Zitat Huang FL, Yu SJ. Esophageal cancer: risk factors, genetic association, and treatment. Asian J Surg. 2018;41(3):210–5.CrossRef Huang FL, Yu SJ. Esophageal cancer: risk factors, genetic association, and treatment. Asian J Surg. 2018;41(3):210–5.CrossRef
14.
Zurück zum Zitat Cheng D, Deng J, Zhang B, He X, Meng Z, Li G, et al. Lncrna hotair epigenetically suppresses mir-122 expression in hepatocellular carcinoma via DNA methylation. EBioMedicine. 2018;36:159–70.CrossRef Cheng D, Deng J, Zhang B, He X, Meng Z, Li G, et al. Lncrna hotair epigenetically suppresses mir-122 expression in hepatocellular carcinoma via DNA methylation. EBioMedicine. 2018;36:159–70.CrossRef
15.
Zurück zum Zitat Tserga A, Binder AM, Michels KB. Impact of folic acid intake during pregnancy on genomic imprinting of igf2/h19 and 1-carbon metabolism. FASEB J. 2017;31(12):5149–58.CrossRef Tserga A, Binder AM, Michels KB. Impact of folic acid intake during pregnancy on genomic imprinting of igf2/h19 and 1-carbon metabolism. FASEB J. 2017;31(12):5149–58.CrossRef
16.
Zurück zum Zitat Tang W, Zhang S, Qiu H, Wang L, Sun B, Yin J, et al. Genetic variations in mthfr and esophageal squamous cell carcinoma susceptibility in chinese han population. Med Oncol. 2014;31(5):915.CrossRef Tang W, Zhang S, Qiu H, Wang L, Sun B, Yin J, et al. Genetic variations in mthfr and esophageal squamous cell carcinoma susceptibility in chinese han population. Med Oncol. 2014;31(5):915.CrossRef
17.
Zurück zum Zitat Pardini B, Kumar R, Naccarati A, Novotny J, Prasad RB, Forsti A, et al. 5-fluorouracil-based chemotherapy for colorectal cancer and mthfr/mtrr genotypes. Br J Clin Pharmacol. 2011;72(1):162–3.CrossRef Pardini B, Kumar R, Naccarati A, Novotny J, Prasad RB, Forsti A, et al. 5-fluorouracil-based chemotherapy for colorectal cancer and mthfr/mtrr genotypes. Br J Clin Pharmacol. 2011;72(1):162–3.CrossRef
18.
Zurück zum Zitat Lebeau A, Kriegsmann M, Burandt E, Sinn HP. Invasive breast cancer: the current who classification. Pathologe. 2014;35(1):7–17.CrossRef Lebeau A, Kriegsmann M, Burandt E, Sinn HP. Invasive breast cancer: the current who classification. Pathologe. 2014;35(1):7–17.CrossRef
19.
Zurück zum Zitat Kwan ML, Haque R, Lee VS, Joanie Chung WL, Avila CC, Clancy HA, et al. Validation of ajcc tnm staging for breast tumors diagnosed before 2004 in cancer registries. Cancer Causes Control. 2012;23(9):1587–91.CrossRef Kwan ML, Haque R, Lee VS, Joanie Chung WL, Avila CC, Clancy HA, et al. Validation of ajcc tnm staging for breast tumors diagnosed before 2004 in cancer registries. Cancer Causes Control. 2012;23(9):1587–91.CrossRef
20.
Zurück zum Zitat Lee JJ, Geli J, Larsson C, Wallin G, Karimi M, Zedenius J, et al. Gene-specific promoter hypermethylation without global hypomethylation in follicular thyroid cancer. Int J Oncol. 2008;33(4):861–9.PubMed Lee JJ, Geli J, Larsson C, Wallin G, Karimi M, Zedenius J, et al. Gene-specific promoter hypermethylation without global hypomethylation in follicular thyroid cancer. Int J Oncol. 2008;33(4):861–9.PubMed
21.
Zurück zum Zitat Pan Z, Mao W, Bao Y, Zhang M, Su X, Xu X. The long noncoding rna casc9 regulates migration and invasion in esophageal cancer. Cancer Med. 2016;5(9):2442–7.CrossRef Pan Z, Mao W, Bao Y, Zhang M, Su X, Xu X. The long noncoding rna casc9 regulates migration and invasion in esophageal cancer. Cancer Med. 2016;5(9):2442–7.CrossRef
22.
Zurück zum Zitat Lin K, Jiang H, Zhuang SS, Qin YS, Qiu GD, She YQ, et al. Long noncoding rna linc00261 induces chemosensitization to 5-fluorouracil by mediating methylation-dependent repression of dpyd in human esophageal cancer. FASEB J. 2019;33(2):1972–88.CrossRef Lin K, Jiang H, Zhuang SS, Qin YS, Qiu GD, She YQ, et al. Long noncoding rna linc00261 induces chemosensitization to 5-fluorouracil by mediating methylation-dependent repression of dpyd in human esophageal cancer. FASEB J. 2019;33(2):1972–88.CrossRef
23.
Zurück zum Zitat Li P, Zhang X, Wang L, Du L, Yang Y, Liu T, et al. Lncrna hotair contributes to 5fu resistance through suppressing mir-218 and activating nf-kappab/ts signaling in colorectal cancer. Mol Ther Nucleic Acids. 2017;8:356–69.CrossRef Li P, Zhang X, Wang L, Du L, Yang Y, Liu T, et al. Lncrna hotair contributes to 5fu resistance through suppressing mir-218 and activating nf-kappab/ts signaling in colorectal cancer. Mol Ther Nucleic Acids. 2017;8:356–69.CrossRef
24.
Zurück zum Zitat Li X, Wu Z, Mei Q, Li X, Guo M, Fu X, et al. Long non-coding rna hotair, a driver of malignancy, predicts negative prognosis and exhibits oncogenic activity in oesophageal squamous cell carcinoma. Br J Cancer. 2013;109(8):2266–78.CrossRef Li X, Wu Z, Mei Q, Li X, Guo M, Fu X, et al. Long non-coding rna hotair, a driver of malignancy, predicts negative prognosis and exhibits oncogenic activity in oesophageal squamous cell carcinoma. Br J Cancer. 2013;109(8):2266–78.CrossRef
25.
Zurück zum Zitat Nahid NA, Apu MNH, Islam MR, Shabnaz S, Chowdhury SM, Ahmed MU, et al. Dpyd*2a and mthfr c677t predict toxicity and efficacy, respectively, in patients on chemotherapy with 5-fluorouracil for colorectal cancer. Cancer Chemother Pharmacol. 2018;81(1):119–29.CrossRef Nahid NA, Apu MNH, Islam MR, Shabnaz S, Chowdhury SM, Ahmed MU, et al. Dpyd*2a and mthfr c677t predict toxicity and efficacy, respectively, in patients on chemotherapy with 5-fluorouracil for colorectal cancer. Cancer Chemother Pharmacol. 2018;81(1):119–29.CrossRef
26.
Zurück zum Zitat Suzuki M, Shinohara F, Nishimura K, Echigo S, Rikiishi H. Epigenetic regulation of chemosensitivity to 5-fluorouracil and cisplatin by zebularine in oral squamous cell carcinoma. Int J Oncol. 2007;31(6):1449–56.PubMed Suzuki M, Shinohara F, Nishimura K, Echigo S, Rikiishi H. Epigenetic regulation of chemosensitivity to 5-fluorouracil and cisplatin by zebularine in oral squamous cell carcinoma. Int J Oncol. 2007;31(6):1449–56.PubMed
27.
Zurück zum Zitat Tan X, Wang YY, Dai L, Liao XQ, Chen MW. Genetic polymorphism of mthfr a1298c and esophageal cancer susceptibility: a meta-analysis. Asian Pac J Cancer Prev. 2013;14(3):1951–5.CrossRef Tan X, Wang YY, Dai L, Liao XQ, Chen MW. Genetic polymorphism of mthfr a1298c and esophageal cancer susceptibility: a meta-analysis. Asian Pac J Cancer Prev. 2013;14(3):1951–5.CrossRef
Metadaten
Titel
LncRNA HOTAIR-mediated MTHFR methylation inhibits 5-fluorouracil sensitivity in esophageal cancer cells
verfasst von
Shuyao Zhang
Fuchun Zheng
Liqun Zhang
Zuojun Huang
Xiaoshan Huang
Zhen Pan
Shuang Chen
Chenchen Xu
Yi Jiang
Shuyi Gu
Chengkuan Zhao
Qiuzhen Zhang
Ganggang Shi
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
Journal of Experimental & Clinical Cancer Research / Ausgabe 1/2020
Elektronische ISSN: 1756-9966
DOI
https://doi.org/10.1186/s13046-020-01610-1

Weitere Artikel der Ausgabe 1/2020

Journal of Experimental & Clinical Cancer Research 1/2020 Zur Ausgabe

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

CUP-Syndrom: Künstliche Intelligenz kann Primärtumor finden

30.04.2024 Künstliche Intelligenz Nachrichten

Krebserkrankungen unbekannten Ursprungs (CUP) sind eine diagnostische Herausforderung. KI-Systeme können Pathologen dabei unterstützen, zytologische Bilder zu interpretieren, um den Primärtumor zu lokalisieren.

Sind Frauen die fähigeren Ärzte?

30.04.2024 Gendermedizin Nachrichten

Patienten, die von Ärztinnen behandelt werden, dürfen offenbar auf bessere Therapieergebnisse hoffen als Patienten von Ärzten. Besonders gilt das offenbar für weibliche Kranke, wie eine Studie zeigt.

Adjuvante Immuntherapie verlängert Leben bei RCC

25.04.2024 Nierenkarzinom Nachrichten

Nun gibt es auch Resultate zum Gesamtüberleben: Eine adjuvante Pembrolizumab-Therapie konnte in einer Phase-3-Studie das Leben von Menschen mit Nierenzellkarzinom deutlich verlängern. Die Sterberate war im Vergleich zu Placebo um 38% geringer.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.