Background
Esophageal cancer (EC) ranks as the eighth most prevalent cancer globally [
1]. Multiple risk factors are reported to contribute its occurrence and development, including cigarette smoking, alcohol consumption, obesity, and low fruit/vegetable intake [
2]. Currently, standard treatment modalities for patients with EC include surgery, radiation therapy, and chemotherapy [
3]. Despite substantial advances in diagnosis and treatment, EC has overall poor prognosis, with overall 5-year survival rates ranging between 15 and 25% [
4]. 5-fluorouracil (5-FU) is widely considered to be the most effective chemotherapeutic agent for treatment for EC [
5]. However, esophageal tumors frequently develop resistance to 5-FU, especially in recurrence cases [
6]. Therefore, there is a need to identify novel molecular targets that can facilitate the promotion of chemosensitivity of EC cells to 5-FU.
LncRNAs are a group of non-protein-coding transcripts with nucleotides lengths of 200 or more and are reported as dysregulated in tumor initiation and progression, including EC [
7]. LncRNA HOX transcript antisense RNA (HOTAIR), an inhibitor of the HOXD genes, is secreted from the HOXC locus [
8]. LncRNA HOTAIR, a typical lncRNA, has been implicated in the development of esophageal squamous cell carcinoma (ESCC) [
9]. In particular, HOTAIR is understood to be capable of regulating cell invasiveness, migration, and apoptosis in ESCC, and thus has been proposed as a novel biomarker relevant to its diagnosis and prognosis [
10]. Notably, Yan et al. have suggested that upregulation of HOTAIR is associated with chemoresistance [
11]. Previous studies have revealed that alterations in DNA methylation are innate to various human cancers, including EC [
12,
13]. HOTAIR is known to regulate gene expression through epigenetic modifications, including DNA methylation [
14].
In addition, methylenetetrahydrofolate reductase (MTHFR), involved in 5-methyltetrahydrofolate synthesis and homocysteine remethylation, may affect the occurrence and development of cancer by directly regulating DNA methylation [
15]. The role of MTHFR in EC has also been demonstrated [
16]. Notably, MTHFR has been shown to affect 5-FU based chemotherapy in colorectal cancer [
17]. However, the role of lncRNA HOTAIR-mediated methylation of the MTHFR promoter in the chemosensitivity of EC cells to 5-FU remains largely enigmatic. Thus, the aim of the present study was to investigate the possible effects of lncRNA HOTAIR on the chemosensitivity of EC cells to 5-FU via a potential regulation of MTHFR methylation.
Methods
Ethics statement
The study protocol was approved by the Ethics Committee of the Cancer Hospital of Shantou University Medical College. Written informed consent was obtained from all patients prior to enrollment. All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animal by International Committees. Every effort was made to minimize the numbers and suffering of the included animals.
Study subjects
A total of 70 EC tissue samples and adjacent normal tissues were collected from patients (43 patients < 50 years old and 27 patients ≥50 years old) diagnosed with non-specific invasive EC at the Cancer Hospital of Shantou University Medical College from April 2017 to March 2019. All included EC tissues were diagnosed pathologically as ESCC. Morphological observations and diagnosis of all cases were made by more than two deputy pathologists according to World Health Organization (WHO) classification criteria [
18]. There were 47 cases with EC at grade I + II and 23 cases with EC at grade III. Tumor staging was conducted according to American Joint Committee on Cancer (AJCC) 8th Edition TNM Staging Form [
19]. The patients were classified into the TNM stage of I + II (58) and the TNM stage of IIIa (12). All patients showed no lymph node metastasis (LNM), and received neither radiotherapy nor chemotherapy prior to surgery.
Preparation of 5-FU resistant EC cell lines
Cell lines in this study were tested for mycoplasma contamination prior to experiments. The EC cell lines KYSE150, EC109, and TE-1 and human normal esophageal epithelial cell line HEEC were purchased from American Type Culture Collection (ATCC) (VA, USA). All cell lines were added with RPMI 1640 medium (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) supplemented with 10% FBS and 100 U/mL penicillin -streptomycin and cultured in a 5% CO2 incubator at 37 °C. Next, the concentration gradient method was used to construct 5-FU resistant EC cell lines (TE-1/5-FU) for three times, where 5-FU concentrations used were from 1 to 20 μg/mL, respectively. After transduction for 190 days, the concentration 5 μg/mL of 5-FU that could stabilize the drug resistance of TE-1 cells was selected for subsequent analysis.
Cell grouping and treatment
TE-1/5-FU cells (4 × 105 cells/well) were inoculated in 6-well plates. Expression vectors containing the lncRNA HOTAIR or MTHFR, two shRNAs against lncRNA HOTAIR, and their respective negative controls (empty vector, scramble shRNA) were obtained from Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China) and delivered into TE-1/5-FU cells using the lipofectamin 2000 kit according to manufactures’ instructions. 5-Aza-CdR was used to inhibit DNA methylation in cells.
RNA isolation and quantification
Total RNA was extracted from tissues and cells using RNeasy Mini Kit (Qiagen Company, Hilden, Germany). The total RNA was reverse transcribed into cDNA using a PrimeScript RT kit (TaKaRa Biotechnology Co. Ltd., Dalian, China) according to the manufacturer’s protocol. Primer sequences of lncRNA HOTAIR, MTHFR-U, and MTHFR-M (Table
1) were designed and then synthesized by TaKaRa Biotechnology Co. Ltd. (Dalian, China). The ABI7500 quantitative PCR instrument (7500, ABI Company, Oyster Bay, NY, USA) was employed to conduct reverse transcription quantitative polymerase chain reaction (RT-qPCR). The 2
-ΔΔCt method was used to calculate the relative mRNA expression levels of the target genes.
Table 1
Primer sequences for RT-qPCR
lncRNA HOTAIR | F | GGAAAGATCCAAATGGGACCA |
R | CTAGGAATCAGCACGAAGCAAA |
MTHFR-U | F | GGCTGACCTGAAGCACTTGAA |
R | AGAAAAGCTGCGTGATGATGAA |
MTHFR-M | F | TGAAGGAGAAGGTGTCTGCGGGA |
R | AGGACGGTGCGGTGAGAGTG |
GAPDH | F | AGAAGGCTGGGGCTCATTTG |
R | AGGGGCCATCCACAGTCTTC |
Western blot analysis
TE-1 cells or tissue samples were lysed with radio immunoprecipitation assay (RIPA) peptide lysis buffer (BB-3209, Shanghai BestBio Co., Ltd., Shanghai, China) to extract the total protein. The proteins were separated with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for 1 h and then transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated with rabbit anti-human primary antibody MTHFR (1: 1000, ab203785, Abcam Inc., Cambridge, MA, USA) at 4 °C overnight with GAPDH (1: 500, ab8245, Abcam Inc., Cambridge, MA, USA) used as the internal reference gene. Next, the membrane was incubated with horseradish peroxidase (HRP)-labeled goat anti-rabbit immunoglobulin G (IgG) (1: 20000; ab205718, Abcam Inc., Cambridge, MA, USA). Protein blots were visualized by ECL-associated fluorography (Merck Millipore, Billerica, MA, USA).
Dual luciferase reporter gene assay
The MTHFR dual luciferase reporter gene vector and mutants with lncRNA HOTAIR binding site mutation (MTHFR-WT and MTHFR-MUT) were each constructed. These two reporter plasmids were co-transfected into cells that overexpressed lncRNA HOTAIR and NC plasmids. The Dual-Luciferase Reporter Assay System from Genecopoeia (D0010, Beijing Solarbio Science & Technology Co. Ltd., Beijing, China) was employed to detect the luciferase activity of MTHFR promoter region induced by lncRNA HOTAIR in EC cells. The fluorescence intensity was measured using the GLomax20/20 Luminometer (Promega Corporation, Madison, WI, USA).
RNA-fluorescence in situ hybridization (FISH) assay
The website
http://lncatlas.crg.eu/ was employed to predict the localization of lncRNA HOTAIR in TE-1 EC cells, which was identified using a FISH kit (Roche Diagnostics GmbH, Mannheim, Germany). The cells were incubated with a digoxin-labeled lncRNA HOTAIR probe (Sigma, St. Louis (MO, USA), followed by staining with 4′, 6-diamidino-2-phenylindole (DAPI) (Sigma, St. Louis, MO, USA). Then, the cells were washed with cold PBS and photographed using a confocal laser scanning microscope (FV1000, Olympus, Tokyo, Japan).
RNA-binding protein immunoprecipitation (RIP) assay
Cell lysates were incubated with protein-G agarose beads pre-coated with anti-DNMT1 (ab13537, Abcam, Cambridge, UK), anti-DNMT3a (, ab2850, Abcam, Cambridge, UK), anti-DNMT3b (ab2851, Abcam, Cambridge, UK) or normal rabbit IgG. The resultant complexes were then incubated with 150 μL proteinase K buffer to extract protein. Total RNA was extracted using the TRIZOL method and used for RT-qPCR.
Methylation-specific PCR (MSP) assay
Frozen EC tissues and adjacent normal tissues were obtained. DNA was extracted using the ammonia-chloroform extraction method and modified with sodium bisulfite. The modified DNA was purified using a DNA Purification Kit (Promega, Madison, WI, USA), and amplified with bisulfite-modified DNA as a template. Primers for MTHFR MSP-M and MTHFR MSP-U were synthesized by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China). The PCR reaction conditions were 35 cycles of pre-denaturation at 95 °C for 10 min, denaturation at 94 °C for 1 min, annealing at 60 °C for 50 s, and extension at 72 °C for 10 min. The MSP results were determined as described in a previous study [
20].
Chromatin immunoprecipitation (ChIP) assay
A ChIP kit (Merck Millipore, Billerica, MA, USA) was used to detect the enrichment of DNMT1, DNMT3a, and DNMT3b within the MTHFR promoter region. TE-1 cells were treated with formaldehyde for 10 min to generate DNA-protein cross-links. Cell lysates were sonicated to generate chromatin fragments of 200–300 bp and immunoprecipitated with DNMT1 (ab13537, Abcam, Cambridge, UK), DNMT3a (ab2850, Abcam, Cambridge, UK), DNMT3b (ab2851, Abcam, Cambridge, UK), IgG as a negative control, or RNA polymerase ii antibody as a positive control. The Protein Agarose/Sepharose was used to precipitate the endogenous DNA-protein complexes, followed by de-crosslinking at 65 °C overnight. MTHFR promoter-specific primer sequences (Table
1) were used for detecting the binding of DNMT1, DNMT3a, and DNMT3b with the MTHFR promoter region.
5-ethynyl-2′-deoxyuridine (EdU) labeling assay
EC cells were seeded into 96-well plates (1.6 × 105 cells/well), and experimental procedures were conducted according to the instructions of EdU kit (C10310, Guangzhou RiboBio Co., Ltd., Guangdong, China). Briefly, each well was added with 50 μM EdU (100 μL) at 37 °C for 4 h, followed by fixation in 4% formaldehyde at room temperature for 15 min. Next, the cells were treated with 0.2% Triton X-100 at room temperature for 5 min and 100 μL Apollo® mixture (C10338–2, Guangzhou RiboBio Co., Ltd., Guangdong, China) for 30 min, and then cultured with 100 μL Hoechst33342 (Guangzhou RiboBio Co., Ltd., Guangdong, China). DAPI was added for 30 min in order to label the cell nuclei. Cells were observed and imaged using a fluorescence microscope (Olympus, Tokyo, Japan). The Image-Pro Plus (IPP) 6.0 software (Media Cybernetics, Bethesda, MD, USA) was utilized to count the EdU-positive cells (red).
Cell counting kit-8 (CCK-8) assay
When cell confluence reached about 80%, the cells were washed with PBS twice, and trypsinized (at 0.25%) to prepare a single cell suspension. After counting, these cells were inoculated into 96-well plates (3 × 103 ~ 6 × 103 cells/well) at 200 μL of suspension per well. Six wells were used as replicates of each condition. After incubation for 24 h, 48 h, and 72 h, samples were removed and incubated with 10 μL CCK-8 (VP757, DOJINDO, Kumamoto, Kyushu, Japan) for 2 h. The optical density (OD) value was measured at a wavelength of 450 nm using a microplate reader (BIOBASE-EL10A, Jinan Boxin Biotechnology Co., Ltd., Jinan, China). The cell viability curve was plotted with time-duration of incubation on the X-axis and OD value on the Y-axis. All experiments were repeated three times and the IC50 value was determined, which referred to the drug concentration required for cell survival. The IC50 value was calculated by the least square method using FORECAST function in EXCEL software.
Flow cytometry
Propidium (PI) staining was adopted to assess the cell cycle of EC cells. Briefly, 48 h after transfection, cells were washed 3 times with cold PBS, centrifuged, and the supernatant was discarded. The cell concentration was adjusted to approximately 1 × 105 cells/mL after cells were resuspended in PBS, and added with 1 mL of pre-cooled 75% ethanol (− 20 °C) to fix cells at 4 °C for 1 h, followed by centrifugation. The ice ethanol and the supernatant were discarded, and cells were added with 100 μL of RNase A in the dark, water bathed for 30 min 37 °C, and then added with 400 μL of PI (Sigma). The cells were then incubated in dark conditions at 4 °C for 30 min, and the cell cycle was determined using flow cytometry at 488 nm.
The apoptosis of EC cells was detected using an Annexin V-fluorescein isothiocyanate (FITC)/PI double staining kit (556,547, SHANGHAI SOLJA TECHNOLOGY CO., LTD., Shanghai, China). In brief, the cell suspension was incubated with 5 μL Annexin V-FITC for 15 min, followed by incubation with 5 μL PI for 5 min. FITC was detected at wavelengths of 480 nm and 530 nm and PI was detected at a wavelength of more than 575 nm using a flow cytometer (Cube6, Partec, Inc., IL, USA).
Tumor xenografts in nude mice
A total of 48 nude mice of specific pathogen free (SPF) grade (aging 4 weeks and weighing 14–16 g) were obtained from the Medical Discovery Leader Co., Ltd. (Beijing China). A total of 2 × 106 cells were mixed with 50 μL Matrigel Matrix (1: 1) and inoculated subcutaneously into the armpit of the nude mice. After 28 days, anesthesia was induced, and the nude mice were euthanized using 3% Sodium pentobarbital (1 ml/100 g, P3761, Sigma-Aldrich Chemical Company, St Louis, MO, USA), and the tumor tissues were obtained for further analysis.
Immunohistochemistry
The expression of MTHFR was detected using peroxidase-labeled streptavidin peroxidase (SP). The paraffin samples of mouse tissues were sectioned in a continuous manner into 5 μm sections. After routine dehydration, immunohistochemistry was carried out according to routine protocol. Briefly, after treatment with 3% hydrogen peroxide at room temperature for 10 min to block endogenous peroxidase, normal non-immune animal serum was added for 10 min. The sections were treated with primary antibody rabbit anti human MTHFR (ab203785, 1: 1000, Abcam, Cambridge, UK), followed by overnight incubation at 4 °C, added with 1: 500 diluted secondary antibody (goat anti rabbit IgG) labeled with biotin, incubated at 37 °C for 20 min, and added with 50 μl streptavidin-peroxidase solution, followed by incubation at room temperature for 10 min. The sections were visualized with diaminobesidine for 5–10 min and counter-stained with hematoxylin, followed by dehydration, permeabilization, and mounting. The sections were observed under a microscope, and PBS served as NC.
Statistical analysis
All data was analyzed using SPSS 22.0 software (IBM Corp., Armonk, NY, USA). The measurement data was expressed as mean ± standard deviation of three independent tests. The independent sample t-test was used to compare measurement data between two groups including gene expression between EC tissues and adjacent normal tissues. Comparison among multiple groups was conducted using one-way analysis of variance (ANOVA), followed by Tukey’s post hoc test. Repeated measures ANOVA was used to compare tumor volume among groups, followed by Tukey’s post hoc test. p value < 0.05 was indicative of statistical significance.
Discussion
EC, affecting more than 450,000 people, remains the sixth leading cause of cancer-related death worldwide [
4]. Despite progressive improvements in the arena of chemotherapy of EC, resistance to chemotherapy remains a stumbling block [
5]. In recent years, an lncRNA, HOTAIR, has been reported to exert an anticarcinogenic effect on EC [
10]. The aim of the present study was to determine the modulatory effects of silencing of HOTAIR on the cellular chemosensitivity of EC in relation to 5-FU mediated via the regulation of MTHFR methylation.
Initially, the data obtained in the present study demonstrated that HOTAIR was upregulated in EC tissues, particularly in EC tissues resistant to 5-FU. Accumulating data have similarly indicated that many lncRNAs are aberrantly expressed in various human cancers, including EC [
21]. A number of lncRNAs, including HOTAIR, are reported as highly expressed in EC tissues and cells [
7]. The results of the current study displayed that silencing of HOTAIR promoted chemosensitivity to 5-FU and apoptosis while repressing cell proliferation and tumor growth in EC. In general, lncRNAs have been shown to be key mediators in chemoresistance, and lncRNA LINC00261 has been reported to significantly modulate the chemoresistance observed in 5-FU in human EC [
22]. Lu et al. have similarly shown that 5-FU could repress proliferation and induce the apoptosis of EC cells [
5]. Interestingly, the depletion of HOTAIR has been noted to inhibit 5-FU resistance in colorectal cancer, suppress cell viability and induce G1-phase arrest of colorectal cancer cells [
23]. Overexpression of HOTAIR is associated with the elevation of cell proliferation, migration, and invasion in EC, facilitating its progression and development [
9]. Other co-workers have also confirmed that depletion of lncRNA HOTAIR contributes to the inhibition of cell proliferation and tumor metastasis and facilitation of apoptosis in ESCC [
8,
24], corresponding with the findings of the present study. Taken together, there exists significant evidence indicating that HOTAIR is able to promote the chemosensitivity of EC cells to 5-FU by inhibiting proliferation and increasing the apoptosis of EC cells.
The present study also demonstrated that MTHFR was poorly expressed in EC tissues and cells, and elevated MTHFR enhanced chemosensitivity of EC cells to 5-FU with exhibition of lower methylation levels at the MTHFR promoter region. It has been confirmed that MTHFR is of great significance in the progression and development of EC [
16]. At present, 5-FU is regarded to be the most common chemotherapeutic treatment option in colorectal cancer, and systemic exposure to 5-FU is reported as generally regulated by MTHFR [
25]. A recent study has demonstrated that MTHFR could induce the sensitivity of colorectal cancer cells to 5-FU [
17]. Our results imply that silencing of HOTAIR elevated MTHFR expression by decreasing MTHFR methylation. DNA methylation has been said to exert its influence on the chemosensitivity of cancers by regulating expression of genes associated with cell cycle and apoptosis [
26]. The MTHFR is reported to play anti-tumor roles in human cancers through hypomethylation of DNA [
27]. HOTAIR is also proved to regulate DNA methylation [
14], although the targeting relationship between HOTAIR and MTHFR has not been documented earlier. Based on our findings and existing evidence, we suggest that HOTAIR expression is negatively correlated with MTHFR expression via DNA methylation. Overall, the current study has demonstrated that downregulation of HOTAIR increased MTHFR expression by decreasing MTHFR methylation, leading to an elevation in the chemosensitivity of EC cells to 5-FU.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.