Molecular changes to tendons after collagenase-induced acute tendon injury in a senescence-accelerated mouse model

All the animal procedures were performed under the approval and guidance of the Animal Care and Use Committee at our institution.As an aging animal model, we used senescence-accelerated mouse prone (SAMP) mice, which are a widely used aging muscle model. The SAM model has been developed at Kyoto University since 1970 through the selective inbreeding of the AKR/J strain of mice, donated by the Jackson Laboratory in 1968, based on a graded score for senescence, life span, and pathologic phenotype [7]. The SAM strain has a short life span and strain-specific pathological features and is an established experimental animal model for age-associated disease research in systematically designed studies [8]. As a control, we used SAMR (senescence-accelerated mouse resistant) mice to represent a senescence-resistant inbred strain. Among several SAM subtypes, SAMP6 is used as a murine model of senile osteoporosis as it has low bone mass in the vertebra, tibia, and femur [9]. Since the strain has been widely used in orthopedic research, the SAMP6 strain was used as an aged acute tendon injury model. In a 32 weeks old SAMP6 mouse, a reduction in the number of fibroblasts and the diameter of the tendon collagen fibers was reported [10]. We used 40-week-old SAMP6 and SAMR1 male mice (n = 24 for each strain). The mean body weight of the SAMR1 and SAMP6 mice was 36.6 ± 1.86 (34.2–39.9) g and 45.7 ± 4.53 (39.5–53.6) g, respectively. Male mice were used in this study since previous studies indicated estrogen levels in female mice play a crucial role in tendon metabolism and alter the production of various growth factors [11]. SAMP6 and SAMR1 mice were purchased from Japan SLC (Shizuoka, Japan). They were housed in standard laboratory conditions (12-h light:12-h dark cycle, room air temperature 22–24 °C, two mice per cage) and had free access to tap water and food pellets.

Twenty four SAMR1 mice and twenty four SAMP6 mice were used in the study. After anesthesia using isoflurane (Wako, Osaka, Japan), 0.3 mg of collagenase I from Clostridium histolyticum (Sigma Aldrich, Ca., USA) was dissolved in 20 μL of phosphate buffered saline and injected into the mid-portion of the left Achilles tendon of all mice using a 30-gauge needle [12, 13]. The contralateral limb was injected 20 μL of phosphate buffered saline and used as a control. Free cage activity was allowed after injection. All the animals survived until they were sacrificed. At two weeks after injection, all mice were euthanized with an overdose of isoflurane (Wako, Osaka, Japan) and intraperitoneal injection of pentobarbital sodium (Kyoritsu Seiyaku, Tokyo, Japan). The Achilles tendon was harvested to analyze gene expression and histological evaluation.

The Achilles tendons were carefully isolated from contaminating connective tissue and minced. Total RNA was extracted from the tendons using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) with homogenizer then reverse transcribed to produce single-stranded cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed in duplicate with cDNA samples using a fast real-time PCR system and SYBR Green reagents to analyze mRNA expression of interleukin-6 (IL-6), tenomodulin, type III collagen, MMP-9, TIMP-1, and TIMP − 2. The results were normalized to mRNA levels of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and were expressed relative to their levels in normal culture levels using the 2^{(−∆∆ CT)} method (n = 16 in each group).

The oligonucleotide primer sequences used for real-time PCR amplification were as follows:

IL-6, 5′- TAGTCCTTCCTACCCCAATTTCC -3′ (forward) and 5′- TTGGTCCTTAGCCACTCCTTC -3′ (reverse); tenomodulin, 5′- TGTACTGGATCAATCCCACTCT -3′ (forward) and 5′-GCTCATTCTGGTCAATCCCCT -3′ (reverse); type I collagen, 5-CCA GCG AAG AAC TCA TAC AGC-3′ (forward) and 5′- GGA CAC CCC TTC TAC GTT GT-3′ (reverse); type III collagen, 5′- TGG AGA CAG GTC AGA CCT G-3′ (forward) and 5′- TAT TCG ATG ACT GTC TTG CC-3′ (reverse); MMP-9, 5′- TGAATCAGCTGGCTTTTGTG -3′ (forward) and 5′- ACCTTCCAGTAGGGGCAACT -3′ (reverse); TIMP-1, 5′- GCAACTCGGACCTGGTCATAA -3′ (forward) and 5′- CGGCCCGTGATGAGAAACT -3′ (reverse); TIMP-2, 5′- TCAGAGCCAAAGCAGTGAGC -3′ (forward) and 5′- GCCGTGTAGATAAACTCGATGTC -3′ (reverse); and GAPDH, 5′- GGT GGT CTC CTC TGA CTT CAA CA-3′ (forward) and 5′- GTT GCT GTA GCC AAA TTC GTT GT-3′ (reverse).