Introduction
Diabetic nephropathy (DN) is the main cause of end-stage renal disease (ESRD) in developed countries, and it is a strong predictor of mortality in diabetic patients [
1,
2]. The occurrence and development of DN involves many factors, and the mechanism is complex. In the context of hyperglycemia, the overproduction of reactive oxygen species (ROS) and free radicals stimulates the endogenous antioxidant system, reduces glutathione levels and leads to oxidative stress [
3,
4]. Excessive intracellular oxidative stress caused by hyperglycemia can occur in mitochondria, which triggers DNA damage and eventually leads to apoptosis in renal cells [
5,
6]. In experimental DN, it has been demonstrated that resident renal tubular epithelial cells are lost through apoptosis, and renal tubular epithelial cell apoptosis has been suggested to be related to the progression of proteinuria [
7]. Therefore, inhibiting oxidative stress may serve as a potential therapeutic strategy for the treatment of DN.
Cellular nicotinamide adenine dinucleotide (NAD) is a metabolic cofactor that exists in oxidized (NAD+) or reduced (NADH) forms. NAD+ is a cofactor of a variety of enzymes, including sirtuins (Sirts), cyclic ADP (CADP)-ribose synthetase and poly (ADP-ribose) transferase (PARP) [
8,
9], and regulating NAD+ levels may play a therapeutic role by affecting NAD+ -dependent enzymes. Silencing information regulator 1 (Sirt1) is a Sirt family member that plays a critical role in many biological processes, including resisting oxidative stress and apoptosis and inhibiting inflammation [
10]. The Sirt1 activator resveratrol ameliorates renal cell apoptosis in streptozotocin-induced diabetic rats and HK-2 cells under hyperglycemic conditions [
11]. Similarly, resveratrol increased the deacetylase activity of Sirt1 and improved renal tubular oxidative stress damage induced by hyperglycemia [
12]. Therefore, modulating the activity and expression of Sirt1 plays a key role in preventing the progression of diabetic kidney injury.
NAD(P)H: quinone oxidoreductase 1 (NQO1) is a cytoplasmic antioxidant flavin that increases the levels of intracellular NAD+ by using NADH as an electron donor to catalyze the reduction of quinone to hydroquinone [
13,
14]. Notably, intracellular free NAD+ levels are decreased under various pathological conditions, including hypertension, arterial resting contraction, aging and diabetes [
15,
16]. Moreover, recent studies have shown that NQO1 is activated by β-lapachone and has many beneficial effects, such as improving obesity or hypertension, preventing arterial restenosis or health decline in aging mice and blocking salt-induced renal injury [
17‐
22]. Pharmacological activation of NQO1 alleviates cisplatin-induced renal oxidative stress and inflammation by increasing intracellular NAD+ levels [
23]. However, the role of NQO1 in oxidative stress and apoptosis in DN has not been elucidated.
In this study, we observed the expression of NQO1 in patients with DN and used type 2 diabetic mice (db/db mice) to investigate the effects of NQO1 overexpression on renal function, oxidative stress and apoptosis in diabetic kidneys. Furthermore, we explored the molecular mechanism by which NQO1 regulates oxidative stress and apoptosis in HK-2 cells cultured with high glucose.
Materials and methods
Antibodies and other reagents
Antibodies against NQO1 (11451-1-AP), Nox1 (17772-1-AP), Bax (50599-2-IG), Nox4 (14347-1-AP), Sirt1 (13161-1-AP) and β‐actin (20536-1-AP) were purchased from Proteintech (Chicago, IL, USA). 8-Hydroxy-2'-deoxyguanosine (8-OHdG) (ab48508) and Bcl-2 (ab32124) were purchased from Abcam (Cambridge, UK). The Cleaved Caspase-3 (9664) antibody was obtained from Cell Signaling Technology (Danvers, MA). The culture medium, fetal bovine serum (FBS) and Dulbecco's modified Eagle's medium (DMEM)-F12 were obtained from Gibco Company (Gaithersburg, MD). The plasmids for NQO1 pcDNA3.1(+) and control pcDNA3.1(+) were obtained from Gene Pharma (Shanghai, China). The transfection reagent FuGENE-HD was obtained from Promega (Madison, Wisconsin, USA). TRIzol was purchased from Invitrogen (Carlsbad, CA). Takara (Shiga, Japan) provided SYBR Premix Ex Taq II. EX527 was purchased from Selleckchem (Shanghai, China). A TUNEL FITC apoptosis detection kit was purchased from Vazyme Biotech Corporation (Nanjing, China). Adeno-associated virus serotype 9 (AAV9) was obtained from HanBio Technology (HH20191024HBYXL-AAV01, Shanghai, China).
Animals and treatments
Eight-week-old male C57BL/KsJ db/db mice and littermate control db/m mice (n = 8) were obtained from Nanjing University (Nanjing, China). The mice were kept in a temperature-controlled room at 22 ± 2 °C with a light/dark cycle of 12 h, and standard food and water were freely available. All experiments were approved by the Institutional Animal Care and Use Committee of Hebei Medical University. The db/db mice were randomly divided into three groups: db/db group (n = 8), db/db + AAV-Control group (AAV empty vector-treated db/db mice, n = 8), db/db + AAV-NQO1 group (AAV-NQO1-treated db/db mice, n = 8). To assess the effect of NQO1 overexpression on diabetic kidneys, db/db mice were treated with an NQO1 overexpression AAV9 vector. A total of 50 μL of 1 × 10
11 infective units of AAV-Control or AAV-NQO1 was injected into three sites in the renal cortex of each kidney of db/db mice and after 12 weeks, the mice were sacrificed at the age of 20 weeks [
24‐
26]. Subsequently, 24-h urine, blood samples and renal cortex tissues were collected for analysis.
Human renal biopsies
Human renal biopsies were collected from the Second Hospital of Hebei Medical University. The research protocol for human tissues is consistent with the principles of the Helsinki Declaration and was approved by the Clinical Research Ethics Committee of Hebei Medical University. Informed consent was obtained from patients according to approved guidelines. In this study, 15 kidney biopsies from patients were collected, including 10 samples from patients with type 2 diabetes mellitus with nephropathy and 5 normal renal tissue samples from distal kidney resection because of the presence of localized tumors. Renal biopsies were performed in the DN group to rule out the possibility of other renal diseases.
Cell culture and transfection
HK-2 cells (American Type Culture Collection, Manassas, VA, USA) were cultured in DMEM-F12 (3:1) supplemented with 10% FBS, 100 U/mL penicillin, and 100 U/mL streptomycin in a 95% air and 5% CO2 atmosphere at 37 °C. After the cells reached 40–50% confluence, they were pre-treated with serum-free medium for 12 h and then transfected with NQO1 pcDNA3.1(+) or control pcDNA3.1(+) plasmid with FuGENE-HD transfection reagent in HG medium for 48 h. HK-2 cells were stimulated with normal glucose (NG, 5.6 mmol/L), high glucose (HG, 30 mmol/L), NG plus mannitol (M, 24.4 mmol/L), HG plus control pcDNA3.1(+) (HG + C), HG plus NQO1 pcDNA3.1(+) (HG + NQO1 O/E), and HG plus NQO1 pcDNA3.1(+) and EX527 (HG + NQO1 O/E + EX527; 1 μM) for 48 h.
Western blot analysis
Total proteins (30–50 µg) were isolated from renal tissue and HK-2 cells with RIPA buffer (Solarbio, Beijing, China) containing a protease-phosphatase inhibitor mixture. The proteins were collected by centrifugation at 12,000 r at 4 °C for 20 min, and the concentration was determined by a BCA protein analysis kit (Solarbio, Beijing, China). For immunoblotting, equal amounts of protein were resolved by SDS-PAGE, transferred onto polyvinylidene fluoride (PVDF) membranes (Burlington Millipore, MA, USA) and sealed with 5% skim milk at 37 °C for 1 h. Then, the blots were incubated at 4 °C overnight with primary antibodies against NQO1, Bax, Bcl-2, Nox1, Nox4, Cleaved Caspase-3, Sirt1 and β-actin. Incubation with secondary antibodies was performed at 37 °C for 1 h. After the blots were washed with TBS with Tween-20 (TBST), the bands were detected by an ECL reagent and scanned using a GE-Amersham Imager 600 (General Electric Company, USA). Band densitometry was assessed by National Institutes of Health (NIH) ImageJ 1.50 software.
RNA extraction and quantitative RT-qPCR analysis
Using TRIzol reagent (Invitrogen), total RNA was extracted from kidney tissues or HK-2 cells, and cDNA was prepared using a reverse transcription kit (Promega, Madison, WI, USA) according to the instructions. Real-time PCR was performed using SYBR Premix Ex Taq II on an Agilent Mx3000P qPCR System (Agilent, CA), and GAPDH served as an internal control [
27,
28]. The primers used were as follows: NQO1 (human), F: ATGTATGACAAAGGACCCTTCC and R: TCCCTTGCAGAGAGTACATGG; Sirt1 (human), F: CAGTGTCATGGTTCCTTTGC and R: CACCGAGGAACTACCTGAT; GAPDH (human), F: CTGACTTCAACAGCGACACC and R: TGCTGTAGCCAAATTCGTTGT; NQO1 (mouse), F: AGGATGGGAGGTACTCGAATC and R: TGCTAGAGATGACTCGGAAGG; Sirt1 (mouse), F: TCAGAGTTGCCACCAACAC and R: TACTGGAACCAACAGCCTTA; and GAPDH (mouse), F: CGGAGTCAACGGATTTGGTCGTAT and R: AGCCTTCTCCATGGTGGTGAAGAC. The relative expression of each target gene was calculated by the 2
−ΔΔCT method.
Immunohistochemistry
Kidney tissues were fixed in 4% paraformaldehyde and embedded in paraffin. The tissue sections (4 μm) were deparaffinized with xylene and rehydrated with gradient alcohol. Internal peroxidase activity was inactivated using 3% hydrogen peroxide in 100% methanol for 20 min at room temperature after antigen retrieval for 5 min at 121 °C using 10 mM citrate buffer (pH 6.0). Next, the sections were incubated with 10% normal goat serum for 30 min at room temperature to block nonspecific antibody binding and were incubated with primary antibodies against NQO1, Bax, Bcl-2, cleaved caspase-3, Nox1, Nox4, 8-OHdG and Sirt1 overnight at 4 °C. After being washed with phosphate-buffered saline (PBS), the slices were incubated with biotinylated secondary antibodies and horseradish peroxidase-conjugated streptavidin at 37 °C for 30 min. Labeling was visualized with diaminobenzidine (DAB) at room temperature for 1–2 min to produce a brown color, and the sections were counterstained with hematoxylin. Finally, the images were captured with an Olympus microscope (Olympus, BX71, Tokyo, Japan). The average integrated optical density was quantified by Image-Pro Plus 6.0 (Media Cybernetics) software to indicate protein expression.
Periodic acid-Schiff and Masson trichrome staining
Renal tissue sections (4 μm) were subjected to periodic acid-Schiff (PAS) staining to identify glycogen deposition and Masson trichrome staining to identify collagen deposition. Semiquantitative indicators were used to assess the extent of glomerular mesangial dilatation and sclerosis [
29]. In short, 10 nonoverlapping regions in each kidney section were randomly selected for examination. The grading of each glomerulus in a single section ranged from 0 to 4, with 0 representing no lesion and 1, 2, 3 and 4 representing the expansion or hardening of mesangial matrix, involving 25%, 25% to 50%, 50% to 75% or > 75% of glomerular tuft area, respectively. Collagen-positive areas in the kidney were measured by NIH ImageJ 1.50 software.
Immunofluorescence analysis
HK-2 cells were grown on slides in a six-well chamber, fixed with 4% paraformaldehyde for 40 min at 4 °C and stabilized with 0.15% Triton X-100 for 10 min at room temperature. After 30 min goat serum blocking at 37 °C, HK-2 cells were incubated with antibodies against NQO1 (1:150), Sirt1 (1:150), Bcl-2 (1:200), Cleaved Caspase-3 (1:200), Nox1 (1:100), Nox4 (1:200) and Bax (1:150) overnight at 4 °C. The cells were incubated with FITC-labeled secondary antibodies (1:150) for 1 h at 37 °C. Then, the slides were washed with PBS three times, and cell nuclei were stained with DAPI for 10 min. Finally, the slides were observed under a confocal microscope (Leica, Germany). ImageJ 1.50 software from the NIH was used to evaluate the collected images.
ROS analysis
Mitochondrial ROS were measured by MitoSox red (Invitrogen). Cells were cultured in a six-well chamber for 48 h and subsequently incubated with MitoSox red at a final concentration of 5 μM in the dark for 30 min at 37 °C. Then, the cells were washed three times with Hank’s balanced salt solution (HBSS), and images were acquired using a confocal microscope (Leica, Germany). The fluorescence intensity of mitochondrial ROS was quantified using Image-Pro Plus 6.0 software (Media Cybernetics). For flow cytometry, DCFH-DA (Invitrogen) was used to assess intracellular ROS levels. HK‐2 cells were treated with 10 μM DCFH-DA for 30 min in a dark incubator at 37 °C. After being washed with PBS, the ROS levels were measured by a flow cytometer (FACS Aria, BD Biosciences, CA, USA).
TUNEL assay
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) in renal tissues and cultured HK‐2 cells was measured by an apoptosis detection kit (Vazyme, China). Fluorescence images were obtained by a confocal microscope (Leica, Germany). TUNEL-positive apoptotic cells were counted in six different fields (×400) for each sample and then averaged.
Sirt1 activity assay
The activity of Sirt1 in renal tissue and HK-2 cells was determined using a fluorometric Sirt1 assay kit (Sigma–Aldrich) [
30]. In brief, samples were incubated with 10 μL of Sirt1 substrate solution in the presence or absence of NAD+. Samples were incubated at 37 °C for 1 h. Next, 5 μL of developing buffer was added to each well, and samples were incubated at 37 °C for 10 min. The fluorescence intensities were measured using a microplate fluorometer (excitation wavelength = 360 nm, emission wavelength = 450 nm).
Determination of the NAD+/NADH ratio
NAD+/NADH was measured using the NAD+/NADH assay kit (Beyotime, China) according to the manufacturer’s instructions. In brief, the tissues or cells were homogenized in 200 μL of NAD+/NADH extraction buffer. After neutralization, the total amount of intracellular NAD+ and NADH was measured. After being heated at 60 °C for 30 min, intracellular NADH levels were measured, and the optical density was determined at 450 nm.
Statistical analysis
The data are expressed as the mean ± SD. Student’s t test was used to analyze two groups, and one-way ANOVA was used to analyze no less than three groups. A value of P < 0.05 indicated that the results were statistically significant.
Discussion
DN is a serious microvascular complication of diabetes and the main cause of chronic renal disease and ESRD [
31,
32]. The pathogenesis of DN is a complex process involving multiple factors and many molecular mechanisms. Although glomerular injury is the focus of kidney injury, studies have shown that renal tubular damage plays an important role in the development of nephropathy (including DN). In our current study, we found that NQO1 was reduced in the kidneys of patients with type 2 diabetes mellitus with nephropathy and db/db mice, especially in renal tubules. Our results showed that NQO1 overexpression significantly attenuated renal oxidative stress and apoptosis and improved renal function in db/db mice. In addition, the in vitro results demonstrated that NQO1-mediated Sirt1 attenuated oxidative stress and apoptosis in HK-2 cells exposed to HG conditions.
NQO1 is an antioxidant enzyme downstream of the nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathway. In our current study, we found that NQO1 was downregulated in diabetic renal tubular cells. Consistent with this finding, the expression of NQO1 in diabetic kidneys was reduced, and the upregulation of Nrf2/NQO1 could reduce diabetic kidney damage [
33,
34]. Interestingly, a recent study reported that NQO1 expression was increased in the podocytes of diabetic mice stimulated with streptozotocin (STZ) for 8 weeks, while NQO1 deletion exacerbated diabetic kidney damage [
35]. These studies indicated that the expression of NQO1 may fluctuate during different periods of DN. In summary, NQO1 may be a potential protective factor against DN.
Hyperglycemia promotes apoptosis in various types of cells in DN, including proximal tubular epithelial cells, but the mechanism is not fully clear [
36]. Studies have shown that reducing renal tubulate epithelial cell apoptosis can improve related indicators of renal function, such as BUN and UACR, further preventing the occurrence and development of DN [
37]. In the present study, the in vivo and in vitro results showed that NQO1 overexpression decreased Bax and Cleaved Caspase-3 expression and increased the expression of Bcl-2 in db/db mice and HK-2 cells cultured with HG. Consistent with this finding, the TUNEL results showed that NQO1 overexpression reduced renal cell apoptosis. Next, we evaluated the effect of NQO1 overexpression on renal function in db/db mice. The results showed that AAV-NQO1 treatment dramatically decreased UACR and BUN levels and improved renal function in db/db mice. Interestingly, similar results showed that in other renal disease models, such as ischemia–reperfusion injury (IRI) and cisplatin-induced acute renal injury, NQO1 blocks renal tubular cell apoptosis and improves renal function [
38,
39]. These findings indicate that NQO1 overexpression can relieve renal damage in DN by inhibiting the apoptosis of renal tubular epithelial cells.
Oxidative stress is a key risk factor for many diseases, and antioxidant therapy is very important, including in DN [
40‐
42]. Massive accumulation of ROS can promote renal tubular cell apoptosis and aggravate renal injury [
43]. Nox isozymes have been proven to mediate the production of ROS via receptors and participate in the physiological processes of cell growth, differentiation, apoptosis and fibrosis [
44]. NQO1 is a widely distributed flavoprotein that depends on FAD, and it functions as an antioxidant enzyme [
45]. In our study, we found that Nox1, Nox4 and 8-OHdG expression was downregulated in db/db mice after treatment with AAV-NQO1. In addition, overexpressing NQO1 reduced ROS production and the protein levels of Nox1 and Nox4 in HG-exposed HK-2 cells. Similarly, previous studies have shown that NQO1 activation could inhibit ROS generation, which is related to Nox proteins in kidney injury induced by salt and cisplatin [
22,
39]. These results indicate that NQO1 may have a renal protective effect against DN by inhibiting cell apoptosis through antioxidant effects.
NAD+ is the basic molecule of metabolism and redox signaling. The balance between NAD+ and NADH may be seriously disturbed because of diabetes mellitus and its complications. Many studies have shown that in various animal disease models, including cardiomyopathy [
9], hearing impairment [
46] and small intestinal injury [
47], maintaining the balance of intracellular NAD+ is critical for cell survival. Activation of NQO1 can increase intracellular NAD+ , which may be a potential target for the treatment of various diseases. In the present study, we found that the NQO1 overexpression reversed the decrease in intracellular NAD+ levels caused by hyperglycemia.
Sirt1 is an NAD+ -dependent deacetylase that belongs to the Sirt family [
48]. Previous studies have shown that overnutrition, such as diabetes, usually produces excessive NADH, and a decrease in NAD+ content often leads to a decrease in Sirt1 expression [
49,
50]. Therefore, increasing the expression of Sirt1 in tissues extracted from diabetic animals has been considered a method to treat diabetes and its complications [
51,
52]. In the current study, we demonstrated that NQO1 overexpression significantly increased the expression and activity of Sirt1 in vivo and in vitro. Our previous research indicated that SRT1720 can activate Sirt1 to reduce oxidative stress and renal fibrosis in DN [
53]. Based on these research results, we hypothesize that NQO1 may activate Sirt1 to play a renal protective role by upregulating NAD+ levels. To verify the potential molecular mechanism of NQO1-mediated renal protection, we applied the Sirt1 inhibitor EX527 to HK-2 cells transfected with NQO1 pcDNA3.1(+) under HG conditions. The results showed that EX527 administration obviously enhanced ROS generation and the expression levels of Nox1 and Nox4 in HK-2 cells that were treated with NQO1 pcDNA3.1(+) under HG conditions. In addition, similar evidence has shown that dunnione ameliorates cisplatin-induced hearing loss by blocking oxidative stress, and this effect is mediated by the regulation of PARP-1 and Sirt1 through NQO1-mediated NADH oxidation [
54]. Moreover, EX527 administration significantly upregulated the Bax/Bcl-2 ratio and Cleaved Caspase-3 expression in HK-2 cells transfected with NQO1 pcDNA3.1(+) under HG conditions. EX527 reversed the antiapoptotic and antioxidant effects of NQO1 overexpression on HK-2 cells cultured with HG, suggesting that NQO1 improves oxidative stress and apoptosis by regulating Sirt1 in DN.
In conclusion, our results showed that NQO1 overexpression improved oxidative stress and apoptosis in diabetic mouse kidneys and HG-cultured HK-2 cells. In addition, we found that the overexpression of NQO1 upregulated the NAD+/NADH ratio and Sirt1 expression, while inhibiting Sirt1 reversed the protective effect of NQO1 overexpression on HG-cultured HK-2 cells. These findings suggest that the protective effect of NQO1 may be achieved by activating sirt1 through the regulation of NAD+/NADH (Fig.
9B). Our findings reveal that NQO1 may be a potential target for the treatment of DN.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.