Introduction
Felid herpesvirus 1 (FHV-1) is a member of the genus
Varicellovirus in the family
Herpesviridae and subfamily
Alphaherpesvirinae [
1]. FHV-1 infection causes feline viral rhinotracheitis (FVR), which is clinically characterized by upper respiratory infections, and also abortion [
2,
3]. It is also an important cause of ocular lesions in cats. FHV-1 mainly infects kittens, but can also infect other felines, including tigers and leopards [
4‐
6]. After infection, viral replication in the acute phase of the disease occurs predominantly in the mucosae of the nasal septum, turbinates, nasopharynx, and tonsils. Other tissues, including the conjunctivae, mandibular lymph nodes, and upper trachea, are also often involved [
7]. The incidence rate of the disease after infection in cats is up to 100%, but the fatality rate varies greatly in cats of different ages. Adult cats generally do not die, but the mortality rate in kittens can reach 50%. Infected animals are latently infected for life and repeatedly infected under certain stimuli [
8,
9]. Since it was first isolated by Crandell and Maurer in 1958 [
2], FHV-1 has spread worldwide and is the most clinically significant pathogen causing respiratory infections in cats.
FHV-1 is a double-stranded linear DNA virus, around 126–134 kbp in size, with an overall G + C content of 45–50% [
10,
11]. The genomic organization of FHV-1 strains is similar to that of other varicelloviruses. Basically, the FHV-1 genome consists of two unique segments, the unique long (UL) and unique short (US) regions. The US region of the genome is flanked by a pair of identical but inverted sequences, designated the ‘internal repeat short’ (IRS) and ‘terminal repeat short’ (TRS) regions [
12]. The functions of 60 proteins have been annotated, and about 23 virus-specific proteins and immunogenic glycoproteins have been identified [
13]. Fifty-six genes have been mapped to the UL region of the FHV-1 genome, mainly encoding the capsid glycoprotein B (gB), gC, gK, gL, gM, gN, the myristylated tegument protein CIRC, ribonucleotide reductase (RR), and thymidine kinase (TK). The US region mainly encodes membrane gD, gE, gG, gI, and protein kinase PK [
14‐
16]. Mijnes et al. used the vaccinia virus vTF7-3 expression system to study the biosynthesis of FHV-1 gE and gI proteins [
16]. The gE/gI complex is rapidly transported to the endoplasmic reticulum (ER). gI was mainly found in the ER and cell membrane with immunofluorescence detection. An FHV-1 mutant lacking the gI gene did not encode the mature gE protein. It is speculated that gE remained in the ER, which may be related to the lack of a molecular chaperone, and only when it is combined with gI does it have transport activity [
17]. Sussman et al. constructed another recombinant FHV-1 that lacked the C-terminus of the gI gene and the 5′ coding region and the 5′ transcriptional control region of the gE gene, and this recombinant virus replicated slowly. The viral titers of the recombinant FHV-1 were approximately tenfold lower than that of the parent. The deletion of gE from FHV-1 is likely to affect its cell-to-cell transmission. After the nasal or subcutaneous injection of the recombinant virus FHV-1, cats were challenged with virulent FHV-1, and showed only mild clinical symptoms [
18]. Lee et al. reported that the virulence of FHV-1 was reduced after the TK gene was knocked out, indicating that TK is associated with the pathogenicity of the virus in cats [
19].
Inactivated and live modified vaccines against FHV-1 are commercially available and have been relatively successful in controlling FVR [
20]. At present, the FHV-1 vaccines suitable for cats mainly include an inactivated vaccine and a modified attenuated vaccine. Although the attenuated vaccine induces higher antibody levels, it can cause latent FHV-1 infections in vaccinated cats and recurrent disease. An inactivated
Feline calicivirus (FCV)–
Feline panleulopenia virus (FPV)–FHV vaccine is currently the most widely used and effective vaccine, but the protection afforded by this trivalent vaccine is generally lowest against the FHV-1 component [
14,
20,
21]. Importantly, this commercial vaccine only reduces the clinical signs of the disease, but does not prevent infection, virus shedding, or the establishment of latency or reactivation [
2,
9]. To protect cats from FHV-1, the development of safe, effective, and economical vaccines is essential. The research and development of gene deletion/insertion vaccines is key to the resolution of this problem. Attempts have been made to improve FHV-1 vaccines with genetic engineering, and a number of FHV-1 deletion/insertion mutants have been developed, including TK deletion mutants. Some of these have incorporated other deletions, including of the FCV capsid gene [
22,
23] and gI–gE genes [
18], and a gI insertion [
24,
25]. In general, these deletion/insertion mutants are less virulent in cats and offer some protection against FVR, especially when administered via the oronasal route [
26]. Although no FHV-1-vectored vaccine has yet progressed to commercial use in cats, these vaccines have some utility as potential marker vaccines.
The clustered regularly interspaced short palindromic repeat (CRISPR)-guided manipulation of herpesvirus genomes has recently been developed, and is an efficient method of genome engineering that is likely to be used increasingly in the future [
27]. The CRISP/CRISP-associated protein 9 (Cas9) system is a robust and highly efficient tool for gene editing that precisely manipulates specific genomic loci [
28,
29]. Gene editing in recombinants by transfecting the CRISPR/Cas9 system is efficient, convenient, and rapid [
30,
31].
In this study, a TK-deletion mutant (∆TK), a gI/gE-deletion mutant (∆gI/gE), and a gIgE/TK-deletion mutant (∆gI/gE/TK) were constructed with CRISPR/Cas9 from FHV-1 strain WX19, which was isolated in Wuxi in 2019 (unpublished). We evaluated the immunogenic effects of these deletion mutants in cats towards developing a new feline herpesvirus vaccine candidate.
Materials and methods
Cells and viruses
Crandell Reese feline kidney (CRFK) cells were cultured in Eagle’s minimum essential medium (EMEM, Wisent, China) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco, USA), streptomycin (100 µg/mL), and penicillin (100 IU/mL), and incubated under 5% CO2 at 37 °C.
Feline herpesvirus type 1 strain WX19 (FHV WX19) is an (unpublished) field isolate from a young cat with severe rhinotracheitis. To propagate the virus, CRFK cells were infected with it at multiplicity of infection (MOI) of 0.1, and the cell culture supernatant was harvested for titration when a 90% cytopathic effect (CPE) was observed.
Western blotting
Protein samples were separated on 12% gels and transferred to nitrocellulose membranes (GE Healthcare) with a semidry transfer cell (Bio-Rad Laboratories). The membranes were blocked with 5% nonfat milk in Tris-buffered saline (TBS)–Tween buffer (150 mM NaCl, 20 mM Tris, and 0.05% Tween 20, pH 7.3) for 2 h at room temperature, and then incubated with the following antibodies: anti-green fluorescent protein (GFP) mouse Mab (1:1000; Abcam), anti-mCHERRY mouse Mab (1:1000; Abclonal), anti-gI mouse Mab (1:1000; produced in-house), anti-gE mouse Mab (1:1000; produced in-house), anti-gB rabbit Mab (1:1000; produced in-house), anti-TK rabbit Mab (1:1000; produced in-house), and anti-actin mouse Mab (1:2000; CW). After the membranes were washed five times for 10 min each, they were incubated with a goat anti-mouse IgG secondary antibody conjugated with horseradish peroxidase (1:10,000; Sigma) for 1 h at room temperature. The blots were analyzed with enhanced chemiluminescence (Thermo Fisher Scientific) using an automatic chemiluminescence imager (Tanon).
Construction of recombinant transfer vectors and single guide RNA (sgRNA) plasmids
The sgRNAs were designed according to http//crispr.mit.edu and targeted the, gI-, gE-and TK-encoding open reading frames (ORFs). The sequences of the sgRNAs are listed in Table
1. The lentiCRISPR v2 plasmid (Addgene) was digested with
BsmBI. Primers (Table
1) were designed to amplify the gI/gE and TK homologous arms of FHV strain WX19 with PCR.
Table 1
Primer sequences used in this study
TK L arm | F: AAGCTTGCATGCCTGCAGGTCGACGGTTAACGGACGATCTGTGAT | TK L arm amplification |
R: CCCCGTAATTGATTACTATTAATAACTACGTCTGATCTGTGTATGAT |
TK R arm | F: TAAAGCATTTTTTTCACTGCACATTAGTGGTGTTCCCT | TK R arm amplification |
R: TACCCGGGGATCCTCTAGAGAGCATTCCATCGGCCAGTAATGTATTAG |
gI/gE L arm | F: AAGCTTGCATGCCTGCAGGTCGACGTGGTGGTGTGTGGCATATTA | gI L arm amplification |
R: GATTACTATTAATAACTACTCCAACCTATTTTATGATGG |
gI/gE R arm | F: ATTGTAAGCGTTAATATTTTGCTACTTTGAACGTATCGCATC | gE R arm amplification |
R: TACCCGGGGATCCTCTAGAGAGCGGCAGCCGCGGTTTATCTA |
GFP | F: CCATCATAAAATAGGTTGGAGTCCTGCGTTATCCCCTGATTC | GFP amplification |
R: GATGCGATACGTTCAAAGTAGCAAAATATTAACGCTTACAAT |
mCherry | F: GTTTCATCATACACAGATCAGACGTAGTTATTAATAGTAATCAATTACGGGG | mCherry amplification |
R: AGGGAACACCACTAATGTGCAGTGAAAAAAATGCTTTATTTGTG |
sgRNA-TK1 | F: CACCGAGACTACGCCAGTATAGCAT | TK sgRNA cloning |
R: AAACATGCTATACTGGCGTAGTCTC |
sgRNA-TK2 | F: CACCGGGCGGCGGCACATTCATCAG | TK sgRNA cloning |
R: AAACCTGATGAATGTGCCGCCGCCC |
sgRNA-gI/gE1 | F: CACCGACACTCAAAAGAGTGAACGT | gI sgRNA cloning |
R: AAACACGTTCACTCTTTTGAGTGTC |
sgRNA-gI/gE2 | F: CACCGGTATGTTTCGTGGTGTCTCCG | gE sgRNA cloning |
R: AAACCGGAGACACCACGAAACATACC |
TK-check | F: CATACACAGATCAGACG | Recombinant virus amplification |
R: AGGGAACACCACTAATGT |
gI/gE-check | F: CCATCATAAAATAGGTTGGAG |
R: GATGCGATACGTTCAAAGTAG |
To replace the gI/E genes of FHV WX19 with the enhanced GFP (eGFP) gene by homologous recombination, we first constructed an expression cassette with the left arm (Larm1) amplified from the FHV WX19 genomic DNA, the eGFP ORF flanked by the Cytomegalovirus (CMV) early gene promoter and a polyA signal amplified from peGFP-C3 (Clontech), and the right arm (Rarm1) amplified from the FHV WX19 genomic DNA. The three fragments, Larm1, eGFP, and Rarm1, were joined together by homologous recombination. The final fragment was cloned into pMD-19T (TakaRa) after sequence verification, and the product was designated pT–eGFP. The mCherry-encoding sequence was amplified from pmCherry-C1 (Clontech) and cloned into pMD-19T in the same way, and the product was designated pT–mCherry. In this study, PCR primer synthesis and DNA sequencing were performed by TsingKe Biotech Co. Ltd (Beijing, China).
Generation of recombinant viruses
To generate the recombinant FHVs (FHV ∆TK mCherry or FHV ∆gIgE eGFP), CRFK cells were cotransfected with 1 µg of Cas9 plasmid sgRNA-gI/gE or sgRNA-TK, respectively, and 2 µg of plasmid pT–eGFP or pT–mCherry, respectively, using Lipofectamine 3000 (Thermo Fisher Scientific) for 18 h. After cotransfection, the cells were infected with FHV strain WX19 at an MOI of 0.1. The cells were maintained in an incubator under 5% CO2 at 37 °C until a 90% CPE was observed, and were then collected and subjected to three freeze–thaw cycles. The recombinant FHV was purified from the cell lysates with plaque purification in CRFK cells overlain with 1% low-melting-point agarose and 1% FBS in EMEM. After seven rounds of purification, the plaques were counted under fluorescent microscopy. The recombinant FHV ∆gIgE/TK eGFP-mCherry was constructed in the same way from purified FHV ∆TK mCherry and FHV ∆gIgE eGFP.
One-step growth curves
CRFK cells were seeded in 96-well plates at 105 cells per well in 1 mL of EMEM 1 day before viral infection. The virus (MOI 1) was allowed to adsorb to the cells at 37 °C for 1 h, the inoculum was removed, and the cells were washed three times with 0.01 M phosphate-buffered saline (PBS; pH 7.2). The cells were maintained in EMEM containing 1% FBS under 5% CO2 at 37 °C in an incubator. At the indicated intervals, the cell supernatants were collected for virus titration.
Viral challenge of cats
Sixteen 3-month-old, prescreened FHV-1-seronegative cats were randomly divided into four groups of four cats each. Three groups of cats were intranasally (IN) immunized with 1 mL of FHV ∆TK mCherry, FHV ∆gIgE eGFP, or FHV ∆gIgE/TK eGFP–mCherry (10
6 TCID
50/100 µL). The cats were boosted IN and subcutaneously (SC) with 1 mL of recombinant FHV (10
6 TCID
50/100 µL) at 28 days postimmunization (dpi). The cats in the fourth group were not immunized, as the control. All groups were challenged IN with virulent FHV strain WX19 (1 × 10
5 TCID
50/100 µL) 3 weeks after the booster vaccination (49 dpi). The clinical signs were recorded daily for up to 63 days. The scoring method used to quantify the clinical symptoms of FHV-1-related disease has been described in a previous study ([
26]; see Table
1). Nasal secretions were collected with Dacron swabs every 2 days after the first immunization. Blood samples were collected separately from each cat before vaccination every 7 days. The sera were stored at − 20 °C before antibody testing. The cats were observed daily for 2 months. All the animal experiments were approved by and performed in compliance with the institutional animal care and use guidelines of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences.
Virus isolation
Nasal swab eluates were filter-sterilized with Millex® syringe filter units (Millipore, Bedford, MA, USA), with an average pore diameter of 0.45 µm. For the standard virus isolation assay, 2.5 × 104 CRFK cells and 50 µL of filtrate were added to duplicate wells of a 96-well microtiter plate. The plates were incubated for 3 days at 37 °C under 5% CO2 and the presence or absence of a characteristic CPE was evaluated to determine whether the samples were positive or negative.
Virus-neutralizing antibody testing
The sera were heat-inactivated at 56 °C for 30 min and then a series of two-fold dilutions was prepared. FHV WX19 (200 TCID50/100 µL) was mixed with the samples with an equal volume. After incubation at 37 °C for 1 h, 1 × 104 CRFK cells were added to each well and incubated for 3 days at 37 °C under 5% CO2. Each sample was tested in duplicate.
Gross pathology and histological examination
Samples of nasal mucosa, tonsil, trachea, lung, retropharyngeal lymph node, heart, brain, liver, kidney, and spleen were collected, fixed in 10% buffered formalin, embedded in paraffin, sectioned, and routinely stained with hematoxylin and eosin. All sections were examined by a pathologist to evaluate any pathological changes.
Statistical analysis
Before analysis of the data, the normality of repeated measures and the homogeneity of variance were tested with the Shapiro–Wilk test and Levene’s test, respectively (GraphPad Prism Software v6). For VN antibody titers, the data was log transformed to normalize the data, Student’s t test and one-Way ANOV test was used for analysis (GraphPad Prism Software v6). P < 0.05 was deemed to indicate significant differences, and P < 0.01 was deemed to indicate highly significant differences.
Discussion
FHV-1 has been a subject of research into feline vector vaccines for the last century [
22,
32]. In recent years, the CRISPR/Cas9 technology has been widely used for virus editing and vaccine development [
33,
34]. Safe gene-deficient viruses can be generated with the CRISPR/Cas9 technology to stimulate a more comprehensive immune response with the combination of both SC and mucosal routes of administration. Gene-deleted viruses have been used extensively to vaccinate against
Pseudorabies virus [
35‐
37],
Bovine herpesvirus 1, and
Equid herpesvirus 1 [
38,
39].
FHV-1 is currently diagnosed in approximately 50–75% of feline viral upper respiratory infections and has become an important source of infection in cats [
2,
14]. Traditional vaccines for FHV-1 are not very effective, reducing the severity of the clinical signs, but conferring only limited or short-term protection, and do not prevent FHV-1 infection [
40].
Herpesviridae genomes are ideal viral vectors, with the advantages of both the safety of an inactivated vaccine and the immunological efficacy and low cost of a live vaccine, while inducing broad humoral and cellular immunity in the treated organism [
34,
41,
42]. The virulence of FHV-1 is significantly reduced by the deletion of the appropriate virulence genes, gI, gE, PK, or TK [
15,
43]. In a previous study, C7301d/TK was constructed by deleting the TK gene, and significant protection was observed after challenge with the parental FHV-1 strain C7301, which was inoculated multiple times with recombinant C7301d/TK by different routes. However, high titers of the challenge virus were excreted from the target organs [
38]. The recombinant strain FHVβ-galgIgE was constructed by deleting the FHV-1 gI and gE genes. The IN and SC inoculation routes were compared and the ability of the recombinant to confer protective immunity and prevent viral shedding after challenge was assessed. Cats inoculated with high doses of strain FHVβ-galgIgE in nasal drops showed only mild clinical signs and developed strong immunity after challenge with the wild-type virus [
18].
In the present study, a TK-deletion mutant (ΔTK), a gIgE-deletion mutant (ΔgI/gE), and a gI/gE/TK-deletion mutant (ΔgI/gE/TK) were prepared with the CRISPR/Cas9 technology by deleting the gI, gE, and/or TK genes from FHV-1 strain WX19. Studies have shown that simultaneous vaccination via the SC and IN routes provides better protection against the clinical signs of FHV-1 infection and viral shedding than are observed in kittens 1 week after SC vaccination [
26]. In the present study, the ΔgI/gE and ΔgI/gE/TK groups showed good safety profiles after two mucosal and one SC booster immunization. Only 50% of the ΔgI/gE and ΔgI/gE/TK groups showed mild clinical signs before challenge, whereas 100% of the test cats in the ∆TK group showed clinical signs. This indicates that the ΔgI/gE and ΔgI/gE/TK recombinants were safer than the ∆TK recombinant. In contrast, only 2/4 kittens in the ΔgI/gE group showed sneezing after challenge, whereas 4/4 kittens in the ΔTK group showed sneezing and watery eyes. However, only 1/4 kittens in the ΔgI/gE/TK vaccine group showed sneezing. Moreover, only one cat in the ΔgI/gE/TK group had a fever lasting for 1 day after challenge. In contrast, 2/4 of the cats in the ΔgI/gE group showed occasional fever lasting 2 days after the challenge, although no live virus was isolated from the noses of this group. In contrast, 3/4 of the cats in the ΔTK group had occasional febrile reactions lasting 2–3 days after challenge, and live virus was isolated from the noses of all cats in this group.
In alphaherpesvirus infections, the cell-mediated immune response is more important than humoral immunity [
44]. However, the cellular immune response can only be measured with sophisticated laboratory methods [
44,
45]. It has been shown that serum antibody testing is not useful in predicting the protection conferred against FHV infection [
46] because FHV-1 vaccines act by inducing neutralizing antibodies and cellular immunity [
47,
48].
An FHV-1 vaccine administered IN provides early protection by triggering local FHV-1-specific immunoglobulin M (IgM) and IgA and can induce the same or a higher humoral immune response [
26,
49]. In a challenge model of FHV-1-infected kittens, the simultaneous IN and SC administration of an FHV-1 vaccine was superior to its SC administration alone. Furthermore, kittens vaccinated simultaneously via the IN and SC routes showed better protection against clinical signs of FHV-1 infection and less viral shedding than those vaccinated via one route only [
26]. The mechanisms involved in the synergy of coimmunization are unknown, but this synergy explains the prevention of clinical signs and viral shedding in the test groups after challenge. However, the clinical signs and viral shedding were significantly greater in the ΔTK group than in the ΔgI/gE and ΔgI/gE/TK groups.
In the ΔgI/gE and ΔgI/gE/TK groups, the lack of the circulating memory B-cell subsets that produce antibodies that recognize gI and gE may have affected the complement-dependent and complement-independent virus-neutralizing antibody levels [
50]. This also explains why the ΔgI/gE and ΔgI/gE/TK groups had lower virus-neutralizing antibody levels after challenge than the ΔTK group. However, 3/4 of the cats in the TK group displayed fever after challenge, an indicator of an ongoing systemic immune response that is usually associated with the development of virus-neutralizing antibodies after immunization [
19,
20,
26]. This suggests that the ΔTK group had relatively high virus-neutralizing antibody levels.
In summary, in this study, we undertook comprehensive safety and efficacy assessments of three test vaccine candidates (gI/gE-, TK-, and gI/gE/TK-deletion mutants of FHV-1) with an immunization program that included IN immunization followed by SC immunization. The parameters evaluated in this study included the safety of the recombinant constructs, their induction of immune responses, and the protection they conferred against challenge with a clinical FHV-1 isolate.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.