Background
6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase-4 (PFKFB4) is a bi-function enzyme [
1,
2]. On one hand, PFKFB4 synthesizes fructose 2,6-bisphosphate (F2,6-BP) to stimulate glycolysis, playing important roles in metabolic processes [
3]. On the other hand, PFKFB4 acts as a phosphatase to hydrolyze F2,6-BP into fructose-6-phosphate (F6P) and inorganic phosphate (Pi), functioning as a protein kinase to phosphorylate protein substrates. The dual function of PFKFB4 makes it involved in multiple biological processes such as cell cycle regulation, cell proliferation, autophagy, and transcriptional regulation [
2].
PFKFB4 has been reported to be involved in a variety of cancers including human bladder cancer, gastric cancer, colon cancer, breast cancer and other malignant tumors [
2,
4‐
6]. It was found that PFKFB4 was overexpressed under hypoxia in gastric and pancreatic cancer cells and contributed to cancer cells proliferation and survival [
5]. Recent studies have shown that metabolic enzyme PFKFB4 plays important roles in malignant breast tumors. High expression of PFKFB4 was associated with poor prognosis of operable breast cancer [
7]. PFKFB4 phosphorylated and activated transcriptional coactivator SRC-3 to promote aggressive breast cancers [
2]. Epithelial and endothelial tyrosine kinase (Etk) interaction with PFKFB4 modulated chemoresistance of small-cell lung cancer (SCLC) by regulating autophagy [
8]. Studies indicated that PFKFB4 was essential for tumors progression. Mechanistically, during neural crest late specification, AKT signaling mediates PFKFB4 function, which was essential for premigratory and migratory neural crest formation [
9]. PFKFB4 was critical for the survival of acute monocytic leukemia (AMoL) cells, serving as a downstream target of MLL through the putative E2F6 binding site in the promoter of the PFKFB4 gene, which might be a potent therapeutic target in AMoL [
10]. However, the exact function and regulatory mechanism of PFKFB4 in lung adenocarcinoma (LUAD) is less understood.
The enzyme co-activator associated arginine methyltransferase 1 (CARM1), also known as protein arginine methyltransferase 4 (PRMT 4), has been reported to play critical roles in embryonic development and multiple cancers [
11‐
14]. Early Studies have shown that CARM1 is often highly expressed in human cancers, including breast, ovarian, prostate, colorectal cancer and so on [
15‐
17]. Recent studies have reported that CARM1 was related to tumor progression and metastasis. CARM1 and USP7-dependent LSD1 stabilization promotes invasion and metastasis of breast cancer cells [
18]. CARM1 is essential for myeloid leukemogenesis and knockdown of CARM1 impairs cell-cycle progression and promotes myeloid differentiation [
19]. It was reported that CARM1 could promote non-small cell lung cancer progression by upregulating CCNE2 expression [
20]. These findings suggest that CARM1 functions as an oncogene in human cancers.
In present study we found that PFKFB4 and SRC protein family was aberrantly overexpressed at mRNA level analyzed from the ENCORI Pan-Cancer Analysis Platform. Further studies showed that PFKFB4 interacted with SRC-2 and phosphorylated SRC-2 at Ser487. Phosphorylated SRC-2 transcriptionally up-regulated CARM1 expression. Functionally, PFKFB4 promoted LUAD cell proliferation, cell migration and invasion by regulating phosphorylated SRC-2 mediated CARM1 expression. These findings revealed a pivotal role of PFKFB4 in LUAD progression by phosphorylation activation of SRC-2, thus upregulating CARM1 expression.
Methods
The expression profile of PFKFB4 and SRC family at mRNA level in lung adenocarcinoma tissues was analyzed from UALCAN Platform (
http://ualcan.path.uab.edu/index.html) which is a comprehensive, user-friendly, and interactive web resource for analyzing cancer OMICS data.
RNA isolation, sequencing and expression analysis
A549 cells which were acquired from Shanghai Chinese Academy of Sciences Cell Bank (Shanghai, China) were transfected with SRC-2 #1 siRNA, SRC-2 #2 siRNA or control siRNA, respectively. Cells were harvested after transfection 72 h. Total RNA was extracted from cells with Trizol reagent (Invitrogen, Carlsbad, CA, USA). RNA purity was analyzed using NanoDrop (Quawell UV–visible spectrophotometer) and Agilent 2100 Bioanalyzer (Santa Clara, CA, USA). Afterwards, transcriptome sequencing was performed on the Illumina HiSeq™ 2500 (NxGenBio Life Sciences, New Delhi) platform. Clean reads were got by filtering for low-quality then assembled. The contigs were organized based on the overlap regions to get transcript sequences. Fold change with an absolute value of log2 ratio ≥ 5 was set as the threshold to obtain the transcripts of which expression was significant difference.
Cell culture and cell transfection
NCI-H1975, A549 and 293 T cell lines were acquired from Shanghai Chinese Academy of Sciences Cell Bank (Shanghai, China). The lung adenocarcinoma cell line NCI-H1975 was cultured in RPMI1640 medium (Invitrogen, USA) and A549 was cultured in F12K (Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA) and 100 μg/ml streptomycin and 100 IU/ml penicillin (Invitrogen, USA). 293 T cells were cultured in DMEM medium (Invitrogen, USA) supplemented with 10% FBS and 1% penicillin/streptomycin. All cells were cultured at 37 °C with 5% CO
2. The transfection experiments were performed using Lipofectamine 2000 Reagent (Invitrogen, USA). The wildtype plasmids were purchased from OriGene (Rockville, MD, USA). SRC-2 S487A was constructed by site-directed mutation. The sequences of shRNA against PFKFB4 and siRNAs against SRC-2 were shown in Table
1.
Table 1
Sequences for shRNA and siRNA
PFKFB4 | CCGGGACGTGGTCAAGACCTACAAACTCGAGTTTGTAGGTCTTGACCACGTCTTTTTG |
siRNA | Sequences (5′–3′) |
SRC-2 #1 | Guide: UUCUAUAUAUUUAUUUUCCUG |
Passenger: GGAAAAUAAAUAUAUAGAAGA |
SRC-2 #2 | Guide: ACGAUUACGUUUUUCAGUGUU |
Passenger: CACUGAAAAACGUAAUCGUGA |
293 T cells were co-transfected with pLKO shRNA constructs, PAX2, MD2 helper plasmids using Lipofectamine 2000 Reagent (Invitrogen, USA). Following transfection, the lentivirus supernatants were collected. A549 and NCI-H1975 were infected for 3 days and selected in the presence of puromycin (1 μg/ml) for at least one week.
Cell Counting Kit (CCK-8) assay
Cell proliferation was measured using cell counting kit-8 (CCK-8; Dojindo Molecular Technologies, Rockville, MD, USA). Cells were transfected as indicated. Cells were seeded into 96-well plates at a density of 3 × 103 cells/well. CCK-8 reagent was added into the wells at indicated time points and incubated at 37 °C for 2 h. The absorbance was measured at 450 nm in a microplate reader (Promega, Madison, WI, USA).
Transwell migration/invasion assay
For migration analysis, cells transfected after 48 h were seeded into the top compartment of the Transwell chamber (8-μm pore size; BD Biosciences, San Jose, CA, USA) in a 24-well plate at a proper density. DMEM medium containing 10% FBS was added to the bottom chamber. When cultured for 24 h, cells on the upper surface of the membrane were scraped. Cells which went through the membrane were fixed with 4% paraformaldehyde and stained with DAPI. The images were captured using the microscope. For invasion analysis, the upper Transwell chamber was coated with matrigel. The following steps were conducted as the migration assay. Cells going through the matrigel were collected and counted. Each experiment was performed in triplicate.
Immunoprecipitation
Cells were harvested with lysis buffer with protease and phosphatase inhibitor cocktail (Millipore). Lysates were precleared with Protein A/G Agarose beads (Pierce) at 4 °C for 1 h, after washed then incubated with antibodies against Myc (Cell signaling Technology, #2276), or HA (Abcam, ab18181), or PFKFB4 (GeneX Health) respectively at 4 °C overnight. Preblocked agarose beads added to the lysates mixture were incubated at 4 °C for another 1 h. The immunocomplexes were eluted for western blot analysis.
Western blot
Proteins were extracted using lysis buffer and separated by 10% SDS-PAGE (Invitrogen) and blotted onto Polyvinylidene Fluoride (PVDF) membranes. Membranes were incubated with primary antibodies at 4 °C overnight. Then membranes were incubated with the secondary antibodies at room temperature for one hour. Proteins were detected using the enhanced chemiluminescence (ECL) kit (Millipore, Burlington, MA, USA). The antibodies against SRC-2 phospho Ser469, phospho Ser487, phospho Ser493, phospho Ser499 and phospho Ser736 were prepared from GeneX Health Co,. Ltd.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from cells using Trizol reagent (Invitrogen). RNA was reversely transcribed into cDNA using PrimeScript RT Master Mix (TaKaRa, Dalian, China). The cDNA was subjected on Real-time polymerase chain reaction (PCR) analysis using the SYBR qPCR-detection-Kit (TaKaRA, Dalian, China) on the Real-time PCR System (ABI7500, ABI, Oyster Bay, NY, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. The sequences of the primers used for RT-PCR were listed in Table
2.
Table 2
Primers sequences for qRT-PCR
CARM1 | F: 5′-TTGATGTTGGCTGTGGCTCTGG-3′ |
R: 5′-ATGGGCTCCGAGATGATGATGTCC-3′ |
MMP24 | F:5′-CTCTGGCCAGTGCTCACC-3′ |
R:5′- CCCATAATTCCCTGCCCCAC-3′ |
MAP7 | F:5′-CAGTGCGAAGCGAAACAGC-3′ |
R:5′-TGTTTCTCCCGTTCCTCACG-3′ |
ZFP91 | F:5′-GCATGGGACAGCTCAGACTT-3′ |
R:5′-GTTGGACGATCGGGTTGGAA-3′ |
ANKH | F:5′-CATCGGAGTGGACTTTGCCT-3′ |
R:5′-GATCAGGAAGGGCATACCCAG-3′ |
LASP1 | F:5′-CCCAAGCAGTCCTTCACCAT-3′ |
R:5′-AGGAATCACAAGCTGTCGCA-3′ |
ATG2A | F:5′-TGCCAATCTGCTGTGAGAGG-3′ |
R:5′-ACGCACTCACGGAGCTTAAA-3′ |
HSPA8 | F:5′-CCCCATCATCACCAAGCTGT-3′ |
R:5′-CTCCACCACCAGGAAATCCC-3′ |
ULK1 | F:5′-CCTGAGGAGACCCTCATGGA-3′ |
R:5′-CACAGCTTGCACTTGGTGAC-3′ |
CCNG2 | F:5′-AACAAAAACAAGGGGCTCGG-3′ |
R:5′-ATCATTCTCCGGGGTAGCCT-3′ |
GAPDH | F: 5′-CTCTGATTTGGTCGTATTGGG-3′ |
R: 5′-TGGAAGATGGTGATGGGATT-3′ |
Statistical analysis
All data were analyzed using GraphPad Prism5 software (GraphPad Software, San Diego, CA). Results were presented as the mean ± SD. Statistical significance was determined by the Student’s t-test.
Conclusions
To sum up, our results demonstrate that PFKFB4 promoted LUAD progression dependent on SRC-2 transcriptional activity. Phosphorylation of SRC-2 at S487 increased its transcriptional activity and upregulated CARM1 expression, thus promoting lung adenocarcinoma cells proliferation, migration and invasion. Our findings uncover the function and molecular mechanism of PFKFB4-SRC-2 signaling in LUAD progression, providing a new sight into therapy and treatment on LUAD.
Discussion
PFKFB4 is one of isoenzymes of PFK2 (i.e., PFKFB1, PFKFB2, PFKFB3, and PFKFB4) which is a well-known bifunctional enzyme owning kinase and phosphatase activities [
21]. Previous studies have showed that PFKFB4 acted as a key sugar-phosphate metabolite to stimulate glycolysis in various biological processes [
3]. In recent years, PFKFB4, acting as a protein kinase, has been found to play a vital role in many cancers including glioblastoma [
22], bladder cancer [
23], gastric cancer and pancreatic cancer [
24], breast cancer [
2] and so on. Studies showed that loss of PFKFB4 in brain cancer stem-like cells promoted cell death while inhibited lactate secretion, which was essential for the maintain of the brain cancer stem-cells stemness [
22]. PFKFB4 was required for peroxisome proliferator-activating receptor γ (PPARγ)-stimulated glycolysis in hepatocellular carcinoma [
25]. However, the importance and exact mechanism of PFKFB4 in lung adenocarcinoma progression is lack of research. In our study, we found that PFKFB4 was overexpressed in lung adenocarcinoma tissues and cell lines (A549 and NCI-H1975) and further revealed the regulatory mechanism of PFKFB4 in LUAD cell proliferation, migration and invasion.
Interaction of PFKFB4 with steroid receptor coactivator-3 (SRC-3) protein has been found as a key regulatory mechanism in breast tumor. Phosphorylated SRC-3 transcriptionally upregulates transketolase expression to promote breast tumor growth and metastasis to the lung [
2]. SRC-3, as a transcriptional coregulatory is deregulated in many tumors, which belongs to the SRCs (SRC-1, SRC-2 and SRC-3) family. Studies have shown that SRCs family especially SRC-2 and SRC-3 is involved in normal biological processes and carcinogenesis. For example, SRC-3 activation promoted tumor growth of pancreatic ductal adenocarcinoma [
26]. SRC-2-mediated coactivation of anti-tumorigenic target genes suppresses MYC-induced liver cancer [
27]. SRC-2 inhibition severely attenuated the survival, growth, and metastasis of prostate cancer [
28]. Based on the previous studies, we wondered whether PFKFB4 regulated LUAD progression via SRCs family protein. We found that the expression of SRC family protein was also elevated in LUAD tumor tissues via the ENCORI Pan-Cancer Analysis Platform. Furthermore, we identified that SRC-2 interacted with PFKFB4 in vitro and in vivo. PFKFB4 phosphorylated SRC-2 at Ser487, of which site was related to its transcriptional activity.
CARM1 which locates at 19p13.2 is also known as the protein arginine methyltransferase 4 (PRMT4) [
13]. It is reported that CARM1 acts as an oncogene in human cancers including ovarian, breast and lung cancers [
16,
17,
29]. In present study, we also investigated the exact mechanism of PFKFB4-SRC-2 on LUAD progression. CARM1 was down-regulated extremely in SRC-2-knockdown LUAD cells by transcriptome screen. Knockdown of SRC-2 inhibited CARM1 expression while ectopic CARM1 co-overexpression could reverse the blockade. These findings indicated that CARM1 was transcriptionally regulated by SRC-2 in LUAD cells. What’s more, it is better to perform a luciferase reporter assay containing CARM1 promoter region to further verify the transcription activity of SRC-2. This work would be done in further research.
Our results showed that knockdown of PFKFB4 suppressed lung adenocarcinoma cells proliferation, migration and invasion could be restored by SRC-2 WT overexpression but not SRC-2 S487A, indicating that PFKFB4 promoted LUAD progression dependent on SRC-2 transcriptional activity. Phosphorylation of SRC-2 at S487 increased its transcriptional activity and upregulated CARM1 expression, thus promoting lung adenocarcinoma cells proliferation, migration and invasion. Taken together, our research uncovered the function and molecular mechanism of PFKFB4-SRC-2 signaling in LUAD progression, providing a new sight into therapy and treatment on LUAD.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.