Background
Nasopharyngeal carcinoma (NPC) is a malignant tumor of the head and neck, which is derived from epithelial cells located in the nasopharynx, accompanied by early distant metastasis and local invasion, and associated with a high incidence in southern China [
1]. Some theoretical evidence demonstrates that the tumorigenesis of NPC is associated with Epstein-Barr virus infection, tumor suppressors, oncogenes, and environmental factors [
2,
3]. Combined with chemotherapy technology, a comprehensive treatment plan based on intensity-modulated radiation therapy has achieved excellent local control of nasopharyngeal carcinoma [
4]. However, tumor invasion and distant metastasis are still major challenges for successful treatment. Further, the molecular mechanisms underlying tumor invasion and metastasis in NPC need to be completely clarified.
Increasing evidence has indicated that the process of epithelial–mesenchymal transition (EMT), characterized by loss of the epithelial marker E-cadherin and the gain of mesenchymal markers vimentin and N-cadherin, plays an important role in the development of tumor invasion and metastasis for cells of various cancers including NPC [
5‐
7]. Through EMT, epithelial cells lose cell polarity and adhesiveness and thus transform into mesenchymal cells, which might induce a cancer stem cell (CSC) phenotype in tumor cells [
8], leading to invasive and metastatic CSCs [
9,
10]. For example, Zhang et al. [
11] demonstrated that leucine-rich repeat-containing G protein-coupled receptor 5 (LGR5), a stem cell marker for colon cancer and gastric cancer, can promote EMT by activating the Wnt/beta-catenin pathway in glioma stem cells. These findings suggest a vital link between EMT and the stemness of tumor cells [
11,
12]. EMT and CSCs are key factors in cancer metastasis and invasion; however, the mechanism connecting EMT to stemness remains unclear. Therefore, it is imperative to investigate the molecular mechanisms that drive EMT and tumor-initiating capacity, which might have significant implications for the exploration of new therapeutic targets for the treatment of epithelial malignancies and metastasis.
In our previous work [
13], we investigated the role of Pin2/telomeric repeat factor 1-interacting telomerase inhibitor 1 (PinX1) in nasopharyngeal CD133
+ CSCs and found that its overexpression could inhibit proliferation, migration, and invasion and induce apoptosis by significantly downregulating c-Myc expression and upregulating TRF1, Mad1, and P53 expression. However, the underlying mechanisms through which PinX1 regulates EMT and stemness in NPC have not been fully elucidated.
MicroRNA-200b (miR-200b) has recently been found to be highly involved in EMT, tumor metastasis, CSC self-renewal, and differentiation [
14‐
16]. For example, the overexpression of miR-200b was demonstrated to significantly inhibit tumor cell growth and differentiation by targeting GATA-4 to downregulate the expression of CCND1 [
16]. In addition, miR-200b has also been found to suppress cell growth, migration, and invasion by targeting Notch1 in NPC [
17]. Moreover, increased evidence indicates that the tumor-suppressor P53 can directly regulate miRNAs, which plays crucial roles in tumor initiation, progression, and metastasis [
18,
19]. Accordingly, we hypothesized that PinX1 might regulate EMT and tumor metastasis in NPC through the functions of miR-200b and P53.
Currently, few studies have explored the potential mechanisms associated with the cooperation among PinX1, miR-200b, and P53 during the regulation of EMT and tumor metastasis in NPC. Therefore, we investigated the effects of PinX1, miR-200b, and P53 on EMT in nasopharyngeal CD133+ CSCs, aiming to provide new therapeutic targets to prevent distant metastasis and NPC progression. In this study, we found that the overexpression of PinX1 and P53 could inhibit nasopharyngeal CD133+ CSC proliferation, migration, and invasion but that the inhibition of miR-200b blocked these effects. Furthermore, we showed that PinX1 inhibits cell proliferation, migration, and invasion by regulating the P53/miR-200b-mediated transcriptional suppression of Snail1, Twist11, and Zeb1, ultimately inhibiting EMT to repress the migration and invasion of these cells.
Materials and methods
Cell culture and transfection
Nasopharyngeal CD133
+ cancer stem cells (CSCs) and CD133
− CSCs were sorted from the nasopharyngeal cancer cell line CNE2 (poorly differentiated nasopharyngeal squamous cell carcinoma cell line; Beijing Concord Cell Resource Center) using magnetic beads in our previous work [
13]. The cells were cultured in DMEM (HyClone, USA) supplemented with 5% fetal calf serum (Gibco, USA) in a humidified incubator with 5% CO
2 at 37 °C. The culture medium was replaced after 24 h, and cells were passaged after 72 h. Third passages of nasopharyngeal CSCs at the logarithmic phase of growth were divided into the following groups: CD133
− CSCs (CD133
− CSCs without any transfection), blank (CD133
+ CSCs without any transfection), negative control (NC, CD133
+ CSCs transfected with empty vector), PinX1 overexpression (CD133
+ CSCs transfected with pcDNA3.0-PinX1), P53 overexpression CD133
+ CSCs transfected with pcDNA3.0-P53), miR-200b inhibitor (CD133
+ CSCs transfected with miR-200b inhibitor), PinX1 overexpression + P53 overexpression (CD133
+ CSCs transfected with pcDNA3.0-PinX1 and pcDNA3.0-P53) and PinX1 overexpression + miR-200b inhibitor (CD133
+ CSCs transfected with pcDNA3.0-PinX1 and miR-200 inhibitor). The plasmids used were synthetized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). All plasmids were transfected into cells according to the instructions of Lipofectamine™ 2000 (Invitrogen, Carlsbad, California, USA). After transfection for 48 h, the cells were harvested and used for subsequent studies. The miR-200b inhibitor (5′-AGAGCUAGCACCAGUAUUA-3′) was designed and synthesized by Suzhou GenePharma Co.,Ltd. (Suzhou, China).
CCK8 analysis
The proliferative capacity of nasopharyngeal CD133+ CSCs and the transfected CSCs was measured by Cell Counting Kit-8 (CCK8, GlpBio, USA) analysis. Briefly, after culture for 24, 48, and 72 h, the cells were seeded on 96-well plates at 1 × 104 cells per well. CCK8 was added to the plates and the plates were incubated for 2 h. The absorbance at 450 nm was determined using a microplate reader. The experiment was repeated three times to obtain the mean values. The time point was regarded as the abscissa, the OD value as the ordinate, and cell viability curves were plotted.
Migration and invasion assays
The migration and invasion of nasopharyngeal CD133+ CSCs and transfected CSCs were determined by Transwell assays. For migration analysis, Six hundred microliters of DMEM supplemented with 10% fetal bovine serum (FBS) was added to the lower chamber, while 2 × 104 cells in serum-free medium were added to the upper chamber. The protocol for the invasion analysis was similar to that of migration analysis, except that the chambers were covered with Matrigel matrix (BD Biosciences, USA). During incubation, the cells migrated and invaded through the lower membrane. Cells on the lower chambers were stained and fixed with 4% paraformaldehyde and 0.1% crystal violet, which was followed by counting under an OLYMPUS CX41 upright microscope. A minimum of four fields of vision were randomly selected from each sample to calculate the mean number of cells that had moved through the Matrigel as the index of cell invasion ability.
Nasopharyngeal CD133+ CSCs and transfected CSCs were plated in 6-well plates at 1 × 104 cells per well. The cells were incubated with serum-free DMEM/F12 medium supplemented with HGF (20 ng/mL), bFGF (20 ng/mL), insulin (10 ng/mL), and B27 and cultured for 10 days in a 5% CO2 humidified incubator at 37 °C. After colony formation was observed, the medium was removed. Cells were washed twice with PBS, fixed with 4% formaldehyde, and stained with 5% crystal violet. Colonies containing > 50 cells were used for counting.
Xenograft tumorigenicity assay in nude mice
Four-week-old female nude mice with body weight of 17 g were randomly numbered using earrings. A total amount of 1 × 104 logarithmically growing CD133+ CSCs without any transfection or transfected with pcDNA3.0-PinX1 and transfected with pcDNA3.0-PinX1 and miR-200 inhibitor in 0.1 ml 1640 medium without FBS were subcutaneously injected into the right side of the same nude mice (N = 5 each group), respectively, and tumor size was measured once a week in the feeding environment. At 4 weeks after injection, nude mice were sacrificed and tumor grafts were isolated. The size of tumor grafts was measured using the eq. V = (a2*b)/2, where a is the short side length of the tumor graft and b is long side length of the tumor graft. Differences in volume of tumor graft in CD133+ CSCs and CD133+ CSCs transfected with pcDNA3.0-PinX1 and CD133+ CSCs transfected with pcDNA3.0-PinX1 and miR-200b inhibitor injected sides were compared. The animals were provided by the Animal Laboratory of the Southern Medical University. In vivo experiments were approved by the Laboratory Animal Committee and conducted in accordance with the National Laboratory Animal Care and Maintenance Guide.
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from cultured cells with TRIzol reagent (Invitrogen) according to the manufacturer’s instructions and was used as a template for reverse transcription reactions into cDNA following the instructions of the Bestar qPCR RT Kit (Applied Biosystems, Grand Island, NY, USA). RT-qPCR was performed using the Agilent Stratagene Mx3000 real-time qPCR Thermocycle Instrument (Agilent Stratagene, CA, USA) with cDNA as the template and glyceraldehyde-3-phosphate dehydrogenase (
GAPDH) as the internal reference. The PCR amplifications were performed using DBI Bestar® SybrGreen qPCRmasterMix. The reaction conditions were as follows: pre-degeneration at 95 °C for 2 min, and 40 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 20 s, and extension at 72 °C for 20 s, followed by a final extension at 72 °C for 10 min. The average threshold cycle (Ct) values from three PCR assays were determined and results were calculated based on the 2
−ΔΔCt method and normalized to
GAPDH levels. Primers for
PinX1,
E-cadherin,
Vimentin,
Snail1,
Twist1,
Zeb1, and
GAPDH were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China) (Table
1).
Table 1The primer sequences for relative mRNA used in this study
PinX1 F | CCAGAGGAGAACGAAACCACG | 128 |
PinX1 R | ACCTGCGTCTCAGAAATGTCA |
E-cadherin F | ACAGGGAGGATTTTGAGCAC | 107 |
E-cadherin R | GATCAGCAGAAGTGTCCCTG |
Vimentin F | AGTCCACTGAGTACCGGAGAC | 98 |
Vimentin R | CATTTCACGCATCTGGCGTTC |
Snail1 F | ACTGCAACAAGGAATACCTCAG | 242 |
Snail1 R | GCACTGGTACTTCTTGACATCTG |
Twist1 F | GAGCAAGATTCAGACCCTCA | 115 |
Twist1 R | CTCGTGAGCCACATAGCTG |
Zeb1 F | CAGCTTGATACCTGTGAATGGG | 106 |
Zeb1 R | TATCTGTGGTCGTGTGGGACT |
GAPDH F | TGTTCGTCATGGGTGTGAAC | 154 |
GAPDH R | ATGGCATGGACTGTGGTCAT |
Western blot analysis
Total protein was extracted from 1 × 106 cells using the Radio-Immunoprecipitation Assay (RIPA) lysate (Beyotime, Nanjing, China). Next, protein concentration was determined using a BCA Protein Assay Kit (Beyotime). The pre-treated proteins were added to the sampling wells (each well approximately 20 μg) for protein isolation on a 10% separation gel (120 V) and 5% spacer gel (100 V) for approximately 2 h. The protein samples were then transferred onto polyvinylidene fluoride membranes (Millipore, USA) and blocked with 5% non-fat milk for 1.5 h. Next, the membranes were washed and incubated with primary antibodies including rabbit polyclonal anti-PinX1 (dilution, 1:1000), rabbit monoclonal anti-Zeb1 (dilution, 1:1000), rabbit monoclonal anti-Snail1 (dilution, 1:500), rabbit monoclonal anti-E-cadherin (dilution, 1:3000), rabbit monoclonal anti-Vimentin (dilution, 1: 1500), rabbit polyclonal anti-Twist1 (dilution, 1:2000) and rabbit monoclonal anti-GAPDH (dilution, 1:10000) at 4 °C overnight. The membranes were then washed and incubated with the horseradish peroxidase (HRP)-labeled goat anti-rabbit immunoglobulin G (IgG) secondary antibody (dilution, 1:20000, ab6721) at 37 °C for 4 h. All aforementioned antibodies were purchased from Abcam Inc. (Cambridge, MA, USA). The target signals were visualized using an enhanced chemiluminescence detection kit (ECL, Beyotime). Densitometric analysis of the bands was carried out using the Gel imaging analysis system. Next, the Gel Doc XR imager system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for imaging and Quantity One (Bio-Rad version 4.6.2) was used for quantitative analysis. The gray value ratio of the target protein to the internal reference (GAPDH) was regarded as the relative protein expression. Experiments were repeated three times to obtain the mean values.
Immunohistochemical staining
The paraffin-embedded tumor tissues prepared from in vivo experiments were sectioned to a thickness of 4 μm and mounted on polylysine-coated slides for immunohistochemistry assays to detect protein expression levels of EMT factors. The indirect streptavidin-peroxidase method kit (ZSGB-bio, Beijing, China) was used according to the protocol provided by the manufacturer. Briefly, the sections were deparaffinized in xylene and rehydrated in ethanol of gradient concentrations. Antigen retrieval was performed by heating at 100 °C in 10 mM citrate buffer (Cwbio, Beijing, China) in a pressure cooker for 20 min. The sections were treated with 3% H2O2 for 25 min to quench endogenous peroxidase activity, and with sheep serum for 30 min to block the non-specific binding. Then, the sections were incubated in a humidity chamber with the following antibodies overnight at 4 °C: anti-E-cadherin (Cat. No. 20874–1-AP, 1:100, PTG, USA), anti-Vimentin (Cat. No. 22031–1-AP, 1:100, PTG, USA). The biotinylated secondary antibody, horseradish peroxidase streptavidin (Cat. No. ab205718, 1:4000, Abcam, USA), and diaminobenzidine (Cat. No. G1211, Servicebio, China) were used successively as the detection reagents. Finally, the sections were counterstained with hematoxylin (Cat. No. G1004, Servicebio, China) for 1 min. Negative controls without primary antibody were used to exclude nonspecific binding.
Statistical analysis
All data are shown as the mean ± SEM. Graphpad Prism 6.0 (GraphPad, Inc., USA) was used for statistical analysis. The statistical analysis methods included Student’s t-test and Pearson’s correlation analysis.
Discussion
Although multimodal treatment for the local control of NPC has achieved great advances, with an improved 5-year survival rate (approximately 80%), local recurrence and distant metastasis are still primarily responsible for treatment failure and death associated with NPC [
20]. Therefore, a better understanding of the underlying mechanism of NPC metastasis is the key to explore novel treatment strategies for patients with this disease. CSCs, a group of “tumor-initiating cells” possessing the capacity to initiate tumor growth, self-renewal properties, and multi-drug resistance, have been found to be highly related to tumor occurrence, development, and metastasis [
21]. Over the years, increasing studies have focused on understanding the biological properties and mechanisms of CSC formation to develop novel strategies to identify these stem-like cancer cells and to target them specifically [
22‐
24]. EMT is considered an important process that leads to tumor invasion and distant metastasis, and it has become an important biological characteristic of CSCs that confers new biological behaviors such as chemotherapy resistance, anti-radiation properties, recurrence, and distant metastasis [
25]. Guen et al. [
26] demonstrated that EMT programs promote basal mammary stem cell and tumor-initiating cell stemness by inducing primary ciliogenesis and Hedgehog signaling. Further, Nomura et al. [
27] found that the overexpression of CD133 can increase the expression and secretion of IL1 beta (IL1B), which activates an autocrine signaling loop that upregulates NF-kappa B signaling, EMT, and cellular invasion. These results together indicate that EMT and CSCs are mutually interdependent and together confer specific biological behaviors to the tumor.
In this study, we demonstrated that EMT participates in NPC progression. The epithelial marker E-cadherin was decreased, and the mesenchymal marker Vimentin was increased in nasopharyngeal CD133
+ CSCs compared to levels in nasopharyngeal CD133
− CSCs. One important characteristic of EMT is the decrease in cadherin expression and the increase in vimentin expression, which indicates that EMT was significantly promoted in nasopharyngeal CD133
+ CSCs. To provide a more comprehensive understanding of tumor EMT, a series of EMT-related transcription factors including Snail1, Twist1, and Zeb1 were detected. Twist1 is the most important regulator of EMT and is significantly associated with expression of the mesenchymal markers fibronectin and vimentin [
28]. Zhu et al. [
29] found that Twist11 is involved in EMT in esophageal cancer and cancer-associated fibroblasts and plays a vital role in tumor growth in vivo. Another transcription factor that is closely related to EMT is Snail1, a zinc finger transcriptional repressor that can induce morphological and molecular changes that are characteristic of EMT in breast cancer cells [
30]. In addition, Ota et al. [
31] found that Snail-induced EMT maintains the CSC-like phenotype, and enhances sphere formation capability, chemoresistance, and invasive ability in head and neck squamous cell carcinoma cells. Moreover, Zeb1, a powerful EMT-related transcription factor, significantly mediates doxorubicin resistance and mesenchymal characteristics in hepatocarcinoma cells [
32]. Therefore, understanding the function of transcriptional factors such as Snail1, Twist1, and Zeb1 is necessary to achieve a more comprehensive understanding of tumor EMT. The high expression of Snail1, Twist1, and Zeb1 in nasopharyngeal CD133
+ CSCs indicated that EMT was promoted via the upregulation of these markers.
Telomerase and its core component human telomerase reverse transcriptase (hTERT) are crucial players in cancer metastasis and stemness. El-Badawy et al. [
33] investigated the function of hTERT in EMT in CSCs and suggested that targeting this marker might improve the elimination of breast CSCs by coordinating with EMT through a feedback loop. Using gastric cancer as a model, Liu et al. [
34] also demonstrated that hTERT stimulates EMT and induces cancer cell stemness, thereby promoting cancer metastasis and recurrence. Therefore, targeting hTERT might prevent cancer progression by inhibiting EMT and CSCs. Our previous work demonstrated that the overexpression of PinX1 significantly decreases hTERT expression, inhibits proliferation, migration, and invasion, and induces apoptosis in nasopharyngeal CD133
+ CSCs by regulating TRFs and Mad1/c-Myc/P53 pathways [
13]. However, the ability of PinX1 to alter the biology of cancer cells needed to be further clarified. Specifically, we found that EMT is significantly inhibited by PinX1 overexpression. Further, in this study, E-cadherin was found to be upregulated and Vimentin, Snail1, Twist1, and Zeb1 were downregulated when PinX1 expression was promoted. Hence, the inhibitory effect on EMT was suggested to be due to PinX1-mediated suppression of the expression of key transcriptional factors involved in this process. In addition, the overexpression of PinX1 was found to diminish the migration and invasion of nasopharyngeal CD133
+ CSCs. These results confirmed the role of PinX1 in suppressing tumor aggressiveness in NPC cell lines.
To further reveal the mechanisms underlying the involvement of PinX1 in EMT in nasopharyngeal CD133
+ CSCs, the probable related pathways were determined. Since PinX1 was previously found to be associated with P53 and MYC pathways [
13], this study further clarified whether P53 is involved in modulating these pathways and suppressing NPC aggressiveness. The expression of E-cadherin was found to be upregulated while the expression of Vimentin and EMT-related transcription factors including Snail1, Twist1, and Zeb1, was significantly suppressed upon P53 overexpression. Co-transfection with pcDNA3.0-PinX1 and pcDNA3.0-P53 further inhibited Vimentin, Snail1, Twist1, and Zeb1 expression and promoted E-cadherin expression. In addition, the overexpression of PinX1 significantly upregulates the expression of P53 in nasopharyngeal CD133
+ CSCs [
13]. These results confirmed that P53 plays a crucial role in PinX1-regulated EMT and tumor aggressiveness in NPC.
Furthermore, this study investigated the function of miR-200b in PinX1-regulated EMT in nasopharyngeal CD133
+ CSCs. MicroRNAs (miRNAs) are an important class of tumor suppressors or oncogenes that function by regulating their target genes through mRNA degradation, post-transcriptional repression, or promoter activation [
35,
36]. These molecules have been recently reported to be closely associated with tumor growth, metastasis, and angiogenesis via transcription factor P53 pathways [
37,
38]. Taewan Kim et al. [
39] reported that P53 suppresses EMT by transactivating miR-200 family members and then repressing the expression of ZEB1 and ZEB2. Here, we found that the inhibition of miR-200b significantly blocks the effects of PinX1 overexpression on EMT, migration, and invasion in nasopharyngeal CD133
+ CSCs. In addition, the proliferation and in vitro sphere formation abilities of nasopharyngeal CD133
+ CSCs were significantly recovered after inhibiting miR-200b. These data together revealed that miR-200b is a key target of PinX1 during the inhibition of EMT.
P53-induced miRNAs played a key role in tumor proliferation, metastasis, and angiogenesis by regulating EMT during the initiation and development of cancer; for example, P53-induced miR-1249 might suppress colorectal cancer (CRC) growth, metastasis, and angiogenesis by targeting VEGFA and HMGA2, in addition to regulating the Akt/mTOR pathway and EMT processes [
19]. In addition, Laudato et al. [
18] also found that P53-induced miR-30e-5p might inhibit CRC invasion and metastasis by targeting ITGA6 and ITGB1. Here, we observed that the overexpression of PinX1 and P53 inhibits cell proliferation, migration, and invasion, but that the inhibition of miR-200b blocked these effects, in nasopharyngeal CD133
+ CSCs. In addition, we found that PinX1 and P53 inhibit EMT by suppressing Snail1/Twist11/Zeb1 expression.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.