Polyphyllin VII attenuated RANKL-induced osteoclast differentiation via inhibiting of TRAF6/c-Src/PI3K pathway and ROS production

Ethical approval was approved by the Ethics Committee of Shengjing Hospital of China Medical University, Shenyang, China. ICR mice with ages of 4–6 weeks (Beijing Huakangkang Biotechnology Co., Ltd., Beijing, China) were sacrificed by skull relocation. Two hind leg bones were dissected out on a sterile station. Three ml of α-MEM complete media containing 10% serum was added to a 6 cm dish, and the cells in the bone marrow cavity were blew out into the dish three times using a 1 ml syringe. The cells were cultured in an incubator at 37 °C for 20 h (overnight). The cells in the super cell suspension was harvested, counted and used as primary BMMS.

BMMs (3 × 10³) in 100 μl of DMEM containing 10% bovine serum were plated into each well of a 96-well plate and incubated in an incubator containing 5% CO₂ at 37 °C overnight. Next day, polyphyllin VII (Solarbio, Beijing, China), which was dissolved with DMSO at stock solution and further diluted with medium to final concentration of 0 μM, 1 μM, 10 μM, 30 μM, or 50 μM, was added into the culture. The cells were further incubated for 9 days, and the cytotoxic effect of polyphyllin VII on the cells was tested using CCK-8 test kit (Dojindo, Japan) following the manufacture’s instruction.

BMMs were plated into a 96-well plate at a density of 1 × 10⁴ cells/well and grouped as negative control group without any treatment, or experimental groups that were treated with 20 ng/ml of RANKL, 20 ng/ml of M-CSF and polyphyllin VII at the concentrations of 0, 1, 10, 30 and 50 μM. The media containing the corresponding induction reagents were changed once on the third day after seeding and once every other day during the following culture period. When osteoclasts were formed during 7–9 days in culture, the cells were fixed and stained with TRAP using commercial kit (Sigma-Aldrich, Cat. no. 387) following the manufacture’s instruction. The TRAP positive cells with multi-pseudopodia and multi-nuclei (> 3 nuclei) were counted. The activity of TRAP was determined using tartrate-resistant acid phosphatase assay kit (P0332, Beyotime Biotechnology, Shanghai, China) following the manufacture’s instruction.

Resorption pit formation assay was performed on Corning 96-well plate (Corning, 3989, USA). Briefly, BMMs were seeded into a 96-well hydroxyapatite plate at a density of 1 × 10³ cells/well, grouped as negative control group without any treatment, experimental groups that were treated with 20 ng/ml of RANKL, 20 ng/ml of M-CSF and polyphyllin VII at the concentrations of 0, 1, 10, 30 and 50 μM for 9 days. The media containing corresponding induction reagents were changed once on the third day after seeding and once every other day during the following culture period. When osteoclasts were induced (9 days induction), the media were discarded and replaced with 100 μL of 10% bleach. After standing at room temperature for 5 min, bleach was discarded, and cells were washed with ddH₂O twice for 5 min each. They were air-dried at room temperature for 3–5 h. The resorption pits formed on the hydroxyapatite plate due to erosion by osteoclasts were observed and photographed under an invert microscope. Average areas of resorption lacunae per well was measured and expressed as pixel dimensions.

BMMs were seeded into a 96-well plate at a density of 1 × 10⁴ cells/well. The cells were grouped as negative control group without any treatment and experimental groups that were treated with 20 ng/ml of RANKL, 20 ng/ml of M-CSF and polyphyllin VII at the concentrations of 1, 10, and 30 μM. After 48 h induction, cells were washed with PBS twice, and 2′-7′-Dichlorodihydrofluorescein diacetate (DCFH-DA) was added in a final concentration of 50 μM. After incubation at dark at 37 °C for 30 min, cells were washed with PBS three times and treated with trypsin solution containing no phenol red. Cells were suspended in 500 μL of PBS, centrifuged at 1000 rpm, and re-suspended in 500 μL of PBS. The fluorescence from DCFH-DA bound to ROS was measured using flow cytometry.

Real time qRT-PCR was performed as previously reported procedure to quantify the mRNA of serum band 5 tartrate-resistant acid phosphatase (TRACP5), cathepsin K (CtsK), and nuclear factor of activated T-cell cytoplasmic 1 (NFATc1) [22]. Briefly, total RNA was extracted using RNAiso Plus (Takara Biotechnology Co., Ltd., Dalian, China). Reverse transcription was performed using Prime-Script RT reagent kit with gDNA eraser (Takara Biotechnology Co. Ltd., Dalian, China). Quantitative real time PCR was conducted using ABI 7500 (Applied Biosystem, Foster City, CA, USA) to determine mRNA expression of the target gene. Level of gene expression was expressed as relative to GAPDH and calculated using the 2^-ΔΔCt method.

The primers used were as followings: Tracp5, forward primer: 5′-GTGCTGCTGGGCCTACAAAT-3′, reverse primer: 5′- TTCTGGCGATCTCTTTGGCAT-3′; Ctsk, forward primer: 5′- GAAGAAGACTCACCAGAAGCAG − 3′, reverse primer: 5′- TCCAGGTTATGGGCAGAGATT-3′; Nfatc1, forward primer: 5′-CCCGTCACATTCTGGTCCAT-3′, reverse primer: 5′-CAAGTAACCGTGTAGCTGCACAA-3′, and GAPDH, forward primer, 5′-ACCCAGAAGACTGTGGATGG-3′, reverse primer: 5′-TTCAGCTCAGGGATGACCTT-3′.

Rac1-GTP pulled down assay was performed using Active GTPase Pull-down and Detection Kit (Thermos Scientific) following the manufacture’s instruction followed by immunoblotting for the target.

BMMs were pretreated with various concentrations of polyphyllin VII followed by inducing to osteoclasts with RANKL and M-SCF in the presence of varying concentrations of polyphyllin VII for 9 days. Cells were then harvested with RIPA containing inhibitors of proteases and phosphatase. Protein concentration was determined using BCA method. Proteins were differentiated by 10% SDS-PAGE gels, transferred onto PDF membrane, and immunoblotting was performed using the following primary antibodies: anti-PIK3, −p-PIK3 antibodies (Cell Signaling Technology); −TRAF6, −c-Src, −Rac1, and Nox1 antibodies (Abcam); and –ß-actin antibody (Proteintech). After reacting with appropriate 2nd antibodies, the protein bands were visualized by luminescent liquid and photographed. Band density was analyzed using Image J software.

Polyphyllin VII at the concentrations of 1, 10 or 30 μM did not cause significant cell death of BMMs (Fig. 1). At 50 μM, however, polyphyllin VII induced significant (P < 0.05) cell death in the BMMs (Fig. 1). Therefore, polyphyllin VII was used at a concentration of 30 μM or less for the rest of experiments in this study.

BMMs were treated with RANKL and M-CSF for 2 h followed by further treatment in the presence of various concentrations of polyphyllin VII for additional 9 days. TRAP expression and TRAP activity were then assessed in the differentiated osteoclasts. It was found that number of the osteoclasts differentiated from BMMs significantly (P < 0.05) decreased in the presence of 10 μM or 30 μM of polyphyllin VII (Fig. 2a, b), and that TRAP activity was also significantly suppressed by polyphyllin VII in a concentration-dependent manner (1,10 and 30 μM, Fig. 2c).

Resorption lacunae are result of bone resorption and a marker of resorption capacity. RANKL increased the number and area of lacunae (Fig. 3a), which was significantly suppressed by polyphyllin VII (P < 0.05) in a concentration-dependent manner (Fig. 3a, b).

As shown in Fig. 4, gene expression of TRACP5 (Fig. 4a), Ctsk (Fig. 4b) and NFATc1 (Fig. 4c) was significantly increased in the BMM cells exposed to RANKL compared to the cells without any treatment (P < 0.05). Polyphyllin VII significantly (P < 0.05) inhibited mRNA expression of TRACP5 at the concentrations of 10 and 30 μM (Fig. 4a), of Ctsk at the concentrations of 1, 10 and 30 μM (Fig. 4b), and of NFATc1 at the concentrations of 10 and 30 μM (Fig. 4c).

It has been reported that ROS plays an important role in the differentiation of osteoclasts [10]. Since polyphyllin VII is a natural antioxidant, it is perceptible that polyphyllin VII may inhibit the differentiation of osteoclasts via its effect of anti-oxidation. Therefore, effect of polyphyllin VII on ROS production was assessed in this study. It was found that intracellular content of ROS in the BMMs was significantly increased in response to RANKL and M-CSF stimulation (Fig. 5a, P < 0.05), which was significantly suppressed by polyphyllin VII in a concentration-dependent manner (P < 0.05, Fig. 5b).

It has been reported that cellular ROS production was highly related with Nox1 [23, 24], and that Nox1 could only be activated by combination with GTP-Rac1 in order to stimulate the generation of ROS [23]. Therefore, effect of polyphyllin VII on Nox1 and GTP-Rac1 activation was assessed in the current study. It was found that RANKL increased protein level of Nox1, while polyphyllin VII significantly (P < 0.05) inhibited RANKL-mediated increase of Nox1 in a concentration-dependent manner (Fig. 6a, b). RANKL increased the content of activated GTP-Rac1 given the total content of Rac1 was constant (Fig. 6a, d), while polyphyllin VII significantly (P < 0.05) inhibited the RANKL-mediated increase in the content of GTP-Rac1 in a concentration-dependent manner (Fig. 6a, c).

It has also been reported that activation of Nox1 was regulated by the upstream TRAF6/c-Src/PI3K pathway [25‐27], and thus, effect of polyphyllin VII on the TRAF6/c-Src/PI3K pathway was further explored. RANKL increased the protein levels of TRAF6 and c-Src, as well as the level of phosphorylated PI3K (p-PI3K, Fig. 7a-d), while it did not alter the level of PI3K (Fig. 7e). Polyphyllin VII significantly inhibited the RANKL-induced increase of TRAF6 and c-Src protein expression, as well as the level of p-PI3K (Fig. 7a-d) in a concentration-dependent manner without affecting the level of PI3K (Fig. 7e).

Polyphyllin VII did not affect cell survival of BMMs at the concentrations of 1 μM, 10 μM or 30 μM while Polyphyllin VII caused cytotoxicity at 50 μM. This observation indicated that polyphyllin VII at a concentration of 30 μM or lower was safe for the cells, and thus, polyphyllin VII at a concentration of 30 μM or lower was used in this study. After BMMs were induced with RANKL and M-CSF, the number of TRAP positive cells and the activity of TRAP were increased, suggesting that BMMs were induced to differentiate into osteoclasts. Resorption lacunae are result of bone resorption and a marker of resorption capacity. Increase of the number and area of lacunae in response to RANKL treatment indicated that the RANKL-induced TRAP positive cells were functional osteoclasts.

It has been reported that TRACP5, Ctsk, NFATc1 were the markers of differentiation of BMMs into osteoclasts [22]. Consistently, in the current study, we further demonstrated that mRNA levels of TRACP5, Ctsk and NFATc1 were significantly up-regulated in response to RANKL and M-CSF exposure, further demonstrating that BMMs were successfully induced to differentiate into osteoclasts.

In the presence of Polyphyllin VII, the number of TRAP positive cells, activity of TRAP, number and area of lacunae were reduced and gene expressions of TRACP5, Ctsk and NFATc1 were down-regulated. These results implicated that polyphyllin VII inhibited the differentiation of BMMs to osteoclasts.

It has been reported that ROS plays an important role in the differentiation of BMMs to osteoclasts [10, 23, 29]. In the present study, therefore, cellular content of ROS was evaluated after BMMs were treated with RANKL and M-CSF. It has been reported that production of intracellular ROS was highly related with Nox1 [23, 24]. In this regard, Nox1 could only be activated by combination with GTP-Rac1 before it stimulated the generation of ROS [23]. Knockdown of Nox1 decreased RANKL-induced production of ROS and the number of osteoclasts generated by RANKL induction [23]. Consistently, we demonstrated that RANKL induced an increase in Nox1 protein level and the content of GTP-Rac1, suggesting that RANKL might increase the production of ROS through up-regulation of Nox1 in the current study. Moreover, consistent with previous reports that activation of Nox1 was regulated by the upstream TRAF6/c-Src/PI3K pathway [25‐27], we further demonstrated that RANKL increased the expression of TRAF6, c-Src and phosphorylation of PI3K, suggesting the up-regulation of Nox1 by RANKL could be dependent on the activation of TRAF6–cSrc–PI3k signal. These findings suggested that RANKL might induce the genesis of osteoclasts from BMMs through increased production of ROS, which was modulated by Nox1 through activated TRAF6–cSrc–PI3k signal pathway.

Polyphyllin VII is a natural antioxidant and may neutralize ROS via its anti-oxidation capacity. In line of this concept, the current study demonstrated that polyphyllin VII attenuated intracellular ROS production in a concentration-dependent manner. Polyphyllin VII also significantly blocked RANKL-stimulated up-regulation of Nox1, GTP-Rac1, TRAF6, c-Src and phosphorylation of PI3K. These findings suggested that polyphyllin VII inhibited differentiation of BMMs into osteoclasts through suppressing intracellular ROS synthesis, which was mediated by the TRAF6–cSrc–PI3k signal pathway as well as GTP-Rac1 and Nox1. The mechanism of Nox1 regulation on the production of ROS, however, remains to be further investigated.