Background
Steroid-induced osteonecrosis of the femoral head (ONFH) is a progressive disease caused by long-term use of hormone drugs, which results in impaired blood supply in the femoral head and causes bone marrow and osteocyte death, leading to internal structural disorders, and dysfunction of femoral head and hip joint [
1,
2]. Aside from long-term use of chronic steroid, smoking, alcoholism, hip traumas, and prior hip surgery are also risk factors for ONFH [
3]. The occurrence of ONFH has been rising in the past few years because of the wide application of steroid drugs for immunosuppression, particularly in the intervention of rheumatic diseases and in transplant patients [
4]. Relative moderate core decompression may be effective in early-stage ONFH, and more major procedures including femoral osteotomy, bone grafting and even total hip replacement are needed for ONFH clinical intervention [
5]. The development of this disorder may seriously affect the life quality of the patients [
6]. Thus, understanding the pathogenesis and developing therapeutic approaches to ONFH is of great importance.
Bone is capable to react to mechanical changes by adjusting its internal microstructure via bone forming and resorbing cells, which is called bone modeling and remodeling [
7]. Bone homeostasis is mediated by the remodeling process controlled by three cell types: osteoclasts, osteoblasts and osteocytes [
8]. Mechanical stresses include mechanical strain, compressive stress and shear stress [
9]. Mechanical stress stimulation acts as a key regulator in bone remodeling and formation and the stimulation [
10]. Load loss may lead to deterioration of mechanical properties of bones and reduction in muscle strength and postural stability [
11]. Mechanical stress has been suggested to promote osteoblast proliferation and attachment [
12]. Therefore, mechanical stress may also have protective effects on ONFH.
Researches on pathological and physiological mechanisms of osteoprotegerin (OPG), receptor activator of nuclear factor kappa B (RANK) and RANK ligand (RANKL) provide new options for the ONFH therapy [
13]. OPG, RANK and RANKL constitute a molecular triad that is closely correlated with vascular calcification, bone metabolism and immune system development through dendritic cells [
14]. OPG and RANKL are two main regulators controlling activities of mature osteoclasts and osteoclastogenesis [
15]. Based on these findings, we hypothesized that mechanical stress might exert protective functions in ONFH, where the OPG/RANK/RANKL trial system may play key roles. To validate this hypothesis, in vivo experiments on rats and in vitro experiments on ex vivo cells of femoral head were performed.
Methods
Ethics statement
The study was ratified by the Clinical Ethical Committee of Affiliated Zhongshan Hospital of Dalian University. All procedures were performed according to the ethical guidelines for the study of experimental pain in conscious animals. Great efforts were made to minimize the suffering of conscious animals.
Establishment of steroid-induced osteonecrosis of femoral head (ONFH) rat models
A total of 140 sprague dawley rats (SYXK (Liaoning) 2017–0005) were included in this study, among which 10 rats were allocated into normal group, and the rest 130 rats were used for ONFH model establishment. After 1 week of adaptive feeding, the rats were weighed and intraperitoneally injected with 20 mg/kg lipopolysaccharide (LPS, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for twice at a 24-h interval. Next, 24 h after the last LPS injection, the rats were further intramuscularly injected with methylprednisolone sodium succinate (40 mg/kg, Pfizer Company, Dalian, Liaoning, China) every 24 h for a total of 3 times. The normal rats were administrated with saline through intramuscular injection as controls. Six weeks after the last injection, 10 rats from the control group and the model group were collected and each rat was intraperitoneally injected with 800 mg/kg excess pentobarbital sodium for euthanasia [
16]. After the injection, loss of righting reflex of rats was evaluated to verify that rats were unconscious, and cessation of heartbeat was verified by auscultation of left thoracic cavity of rats using a stethoscope. After confirmation of euthanasia, the bilateral femurs in 5 rats were collected for histomorphology measurement and the rest 5 rats were screened by Micro Computed Tomography (CT) to identify the model establishment. Among the included rats, 100 ones were successfully modeled and the ONFH rate was 76.9%.
Construction of the lentiviral vectors
The lentiviral vectors pLVX-IRES-ZsGreen1 [containing green fluorescent protein (GFP) reporter gene] were purchased from Clonetch Inc. (CA, USA). The cDNA of OPG was synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), and a marker sequence was inserted to the C-terminus of the cDNA to construct recombined OPG DNA. Then the DNA was cloned to the pLVX-OPG-ZsGreen1 to construct pLVX-OPG-IRES-ZsGreen1 vector, namely OPG vector, and the corresponding pLVX-IRES-ZsGreen1 empty vector was constructed and named as Mock.
The LV-OPG-RNAi-1 vector which contained small interfering RNA (siRNA) targeting OPG expression was constructed by Shanghai Genechem Co., Ltd. (Shanghai, China) and named as si-OPG, and the non-targeting lentiviral vector U6-MCS-Ubiquitin-EGFP-IRES-puromvcin was constructed as a control.
Animal grouping and treatments
Next, 60 model rats were collected and randomly allocated into Sham group (n = 20, rats without weight-bearing), Partial group (n = 20, rats with partial weight bearing) and Total group (n = 20, rats with total weight bearing). Following 4 weeks of weight-bearing training, 10 rats in each group were euthanized as abovementioned methods for the following experiments, while the rest 10 rats were trained for 4 more weeks and then euthanized for experiments.
As to the remaining 30 model rats, 10 of them were allocated into the lentiviral vector (Lv)-mock group (rats injected with 100 ng Lv-mock vector through the bilateral ankle joints), 10 in the Lv-OPG group (rats injected with 100 ng Lv-OPG vector through the bilateral ankle joints), and the last 10 in the Lv-si-OPG group (rats injected with 100 ng Lv-si-OPG vector through the bilateral ankle joints). Following 8 weeks of partial weight-bearing training, rats in each group were further injected with corresponding vectors through the bilateral ankle joints for twice at a 2-week interval, and the rats were euthanized 4 weeks after the last injection.
All model rats were subjected to 1-weel adaptive training with 30 min each day. Rats were set on a treadmill with the speed set at 10 m/min and the inclination at 0°. Weight-bearing was introduced by strapping a strip load on the rat back. The load for rats in the Total group was 50% of the maximum bearing weight, and that for rats in the Partial group was 30% of the maximum bearing weight. Then the 8-week weight-bearing training was performed with the speed set at 15 m/min and the inclination at 0°. Rats underwent 6 cycles of 2-min running and 2-min relaxing each day for a total of 8 weeks. At the 4th and 8th week, 5 rats in each group were screened by Micro computed tomography (CT) and had the bone density evaluated, and the left-side femoral head of the rest 5 rats was used for reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis, while the right-side femoral head was used for tissue section preparation.
Micro CT
Micro CT scanning was performed by the Institute of Laboratory Animal Sciences (Beijing, China) using an Inveon micro positron emission tomographic (PET)/CT instrument (Siemens Ltd., Erlangen, Germany) on the 5-cm near end of the femur. Then the bone volume/total volume (BV/TV), bone surface area/bone volume (BS/BV), trabecular thickness (Tb. Th) and the trabecular number (Tb. N) were evaluated.
Hematoxylin and eosin (HE) staining
The tissues of femoral head were stained with HE as previously described [
17]. Each experiment was performed in triplicate, and each section was observed under a microscope with 5 random fields selected.
Immunohistochemistry
Femoral head tissue sections were collected and incubated with the antibodies against the following antigens vascular endothelial growth factor (VEGF, 1:500, ab15580), B-cell lymphoma-2 (Bcl-2, ab59348, 1:100) and caspase-3 (ab13847, 1:100) (all purchased from Abcam Inc., Cambridge, MA, USA) for 30 min. Then the sections were washed with phosphate buffer saline (PBS) for 3 times and incubated with 40 μL horseradish peroxidase-labeled streptavidin-working solution at 37 °C for 15 min. Following 3 times of PBS washes, the sections were stained with diaminobenzidine for color development, washed with distilled water, counterstained with hematoxylin for 30 s, dehydrated, sealed with neutral balsam, and finally observed under the microscope with 5 non-overlapping fields selected.
RT-qPCR
Total RNA from tissues and cells was extracted using RNAiso Plus (Takara, Otsa, Shiga, Japan) and Trizol LS Reagent (Takara), respectively. Then the high quality of the extracted RNA was confirmed using formaldehyde denaturing electrophoresis. The reverse transcription PCR was then performed according to the instructions of a PrimeScript™ kit (Takara), and real-time qPCR was conducted on a SYBR-Premix Ex Taq (Takara). The mRNA expression was quantified with glyceraldehyde-3-phosphate dehydrogenase as the internal reference. The primers are shown in Table
1.
Table 1
Primer sequences for RT-qPCR
OPG | F: TTTGCCTGGGACCAAAGTGAATGCAGAGAG |
R: AGAAATGATAGGGAATCAGGTTCAATCAGT |
RANK | F: TGGACAACCCAGGAAACCTTTCCTCCAAAA |
R: GCCAGCCGAGACTACGGCAAGTACCTGCGC |
RANKL | F: GGCCA GGTGG TCTGC AGCATCGCTCTGTTC |
R: TTTATAGAATCCTGAGACTCCATGAAAACG |
GAPDH | F: CGGACCAATACGACCAA |
R: AGCCACATCGCTCAGACACC |
Western blot analysis
Total proteins from cells and tissues were extracted, and the concentrations were determined using a bicinchoninic acid kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s protocol. The extracted proteins were run on sodium dodecyl sulfate polyacrylamide gel electrophoresis with the voltage increasing from 80 V to 120 V. Then the proteins were transferred onto polyvinylidene fluoride membranes using the semi-dry method at 80 mV for 30–45 min. The membranes were incubated with 5% bovine serum albumin at room temperature for 1 h, and then incubated with the primary antibodies against OPG (1:1000, ab2302), receptor activator of nuclear factor kappa B (RANK, 1:1000, ab32370), RANK ligand (RANKL, 1:5000, ab32064) and β-actin (1:5000, ab227387) (all purchased from Abcam) at 4 °C overnight. Afterwards, the membranes were washed with tris-buffered saline tween (TBST) (3 × 5 min), and incubated with the corresponding secondary antibody horseradish peroxidase-labeled immunoglobulin G (ab6747, 1:10000, Abcam) at room temperature for 1 h, After 3 times of TBST washes (5 min for each), the bands were visualized using chemiluminescence reagent on a Bio-Rad Gel Dol EZ imager (Bio-Rad Laboratories, California, USA). The target band was analyzed by calculating the gray value using ImageJ software (National Institutes of Health, Bethesda, Maryland, USA).
Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL)
Cell apoptosis in femoral head tissues was measured using a TUNEL kit (Roche Ltd., Basel, Switzerland) in accordance with the instructions [
18]. The TUNEL-positive cells (apoptotic cells) showed stained condensed nuclei under the microscope.
Separation and culture of ex vivo cells of femoral head
When rats were euthanized, the femoral head was collected under sterile conditions with the attached periosteum and the surrounding connective tissues removed. Then the femoral head was washed twice with PBS, and low-glucose Dulbecco’s modified Eagle medium (DMEM) was injected into the bone marrow to produce bone marrow stromal cell suspension. The suspension was then sorted in culture bottles and incubated in an incubator with 5% CO2 and saturated humidity. On the 2nd d, half of the DMEM was refreshed, and the medium was further refreshed once every 3 d after that. When the cell confluence reached 80% on the 10th d, the cells were detached with 0.25% trypsin and subcultured.
Cell grouping and treatments
After extraction of ex vivo cells of femoral head, the cells were cultured in low-glucose DMEM containing 10% fetal bovine serum and 100 U/mL penicillin and 100 mg/mL streptomycin. The medium was further added with 8–10 mol-L dexamethasone, 10 mmol/L sodium β-glycerophosphate and 50 μg/mL vitamin C for cell subculture. The cells at passage 3 were harvested for subsequent experiments.
The cells were allocated into non-stressed group (0 g), 100 g-stressed group (corresponding to 978 rpm), 200 g-stressed group (1372 rpm), 400 g-stressed group (1941 rpm), Lv-mock group (cells were transfected with 100 ng Lv-mock vector and given 200 g stress), Lv-OPG group (cells were transfected with 100 ng Lv-OPG vector and given 200 g stress) and Lv-si-OPG group (cells were transfected with 100 ng Lv-si-OPG vector and given 200 g stress). The in vitro mechanical stimulation experiment was designed based on previous reports [
19,
20]. The cells were respectively centrifuged for 30 min, 60 min and 120 min and further cultured. The cells were collected 48 h later for the following experiments.
Measurement of alkaline phosphatase (ALP) activity
The activity of ALP was detected by ALP staining. All procedures were conducted as previously described [
21].
Alizarin red staining
Alizarin red staining was performed to measure the number of ex vivo cells of femoral head -differentiated calcified nodules, with the procedures guided by a former study [
22].
Immunofluorescence staining
Cells on the slides were rinsed 3 times with PBS, fixed in 4% paraformaldehyde at 4 °C for 15 min, and treated with 0.5% Triton-100 X for 20 min. Then the cell slides were incubated with the primary antibodies against osteocalcin (1:200, ab92552, Abcam) and runt-related gene 2 (RUNX2, 1:100, ab133504, Abcam) at 4 °C overnight. Next, the cells were washed with PBS and incubated with Alexa Fluora or fluorescein isothiocyanate-labeled goat-anti rabbit secondary antibody (1:5000, ab150088, Abcam) at 37 for 1 h. The nuclei were stained with 4′,6-diamidino-2-phenylindole, and the cells were observed under a fluorescence microscope (DM3000, Leica Biosystems, Shanghai, China).
Statistical analysis
SPSS 21.0 software (IBM Corp. Armonk, NY, USA) was applied for data analysis. The Kolmogorov-Smirnov test was used to determine whether data were in normal distribution. Measurement data were described as mean ± standard deviation (SD). Differences between two groups were measured using the t-test, whereas the differences among multiple groups were analyzed using one-way or two-way analysis of variance (ANOVA), followed by pairwise comparisons using Tukey’s multiple comparisons test. The p value was calculated using a two-tailed test, and p < 0.05 indicated a significant difference.
Discussion
A variety of treating procedures have been implemented on ONFH; however, most of these procedures did not present satisfactory clinical outcomes, leaving great suffering to patients and great challenge in therapy development in this field [
13]. Mechanical stress is considered to play a critical role in the pathological osteogenesis progression [
23], and the OPG/RANK/RANKL trail system exerts key functions in bone metabolism, vascular calcification [
14]. In the current study, we identified that proper mechanical stress could promote bone formation and femoral head recovery from osteonecrosis, while excessive stress could even impede the recovery, during which the OPG//RANK/RANKL system was involved.
Firstly, rat models with ONFH showed poor physical and mental conditions. The femur was fragile and easily separable, and the cartilages surface became rough and uneven with partial surface lost, and a large number of osteocytes and bone matrix were decreased or lost. Collapse of the articular surface and osteosyte death are typical outcomes of ONFH [
3]. We found proper stress promoted femoral head recovery from osteonecrosis, and the bone density and trabecular number were increased as well. The trabecular number is an important parameter for bone strength assessment in everyday practice; in particular, the trabecular bone score has been developed as a reflection of bone mineral density and bone microarchitecture [
24]. Mechanical stress has been suggested to regulate bone metabolism and promote bone growth [
25]. More intuitively, physical activities and exercise are well-known to improve bone outcomes and strengthen hip and spine bone formation owing to the skeletal loading stimulation [
26]. On the other hand, excessive stress reduced the recovery process with deteriorated symptoms. Concentration of immoderate mechanical stress may induce fatigue fractures or periprosthetic fractures [
27]. Similarly, optimal mechanical stimulation was suggested to impede osteoarthritis progression, while increased stress may exacerbate osteoarthritis in contract [
28]. Our study suggested that proper mechanical stress increased the levels of VEGF and Bcl-2 but decreased the caspase-3 expression in model rats. VEGF is a coordinate regulator drives angiogenesis, osteogenesis and skeletal growth [
29,
30]. These findings suggested that proper mechanical stress promoted osteogenesis and bone recovery from the molecular perspective. Osteoblasts are important mechanical receptors for the mechanical stimuli to biochemical signal transformation, and they release bone matrix to induce bone matrix mineralization [
9]. Aside from the above findings from in vivo experiments, we further extracted the ex vivo cells of femoral head and performed in vitro experiments. Centrifugal stresses were imposed on cells, after which the ALP activity and proliferation of ex vivo cells of femoral head, and the RUNX2 expression were increased. The ALP activity is an important marker of osteoblast differentiation [
31]. RUNX2 mediates proliferation of osteoblast progenitors and regulates the differentiation into osteoblasts through multiple signaling molecules and transcription factors, and it is essential for osteoblast differentiation as well [
32]. As in line with our findings, proper mechanical stress has been documented to increase the periostin production in osteoblasts, which may further inhibit osteoclast differentiation [
8]. Herein, it can be inferred that proper stress could promote differentiation of ex vivo cells of femoral head and bone formation of rats with ONFH.
The OPG/RANK/RANKL axis acts as a key regulatory mechanism controlling the differentiation and activities of both osteoblasts and osteoclasts, thus maintaining bone homeostasis to prevent bone loss and ensure a normal bone turnover [
33]. We further investigated the possible mechanisms involved in the above events. OPG and RANKL are main molecules considered to mediate the role of mechanical stress in bone formation [
25]. Here, our study found that proper mechanical stress promoted OPG expression while decreased RANK/RANKL expression. Serum OPG levels were decreased in the rat models and THP-1 cells with steroid-induced necrosis of the femoral head, while RANK and RANKL levels were increased [
34]. The OPG/RANK/RANKL system plays vital roles in bone remodeling, among which the RANK/RANKL interaction could promote proliferation and enhance the viability of osteoclast, while the stimulatory role of RANKL in osteoclast maturation and function could be suppressed by OPG, which serves as a decoy receptor for RANKL [
13,
15,
34]. Likewise, excessive mechanical stress led to relatively decreased OPG while increased RANK/RANKL expression compared to proper stress, and the findings that inhibition on OPG reversed the promoting role of proper stress in femoral head recovery validated that the stress stimulates this recovery through the OPG/RANK/RANKL system. Soluble RANKL administration was documented to rapidly drive bone loss in mice through activation of bone resorption [
35]. Whereas soluble OPG molecules bind to RANKL to block the binding of RANKL to RANK, thereby preventing osteoclast formation and maturation [
36]. Interestingly, compressive force induced the upregulatino of RANKL/OPG ratio in human periodontal ligament cells [
37]. Similarly, the in vitro experiments suggested that silencing OPG reversed the role of proper stress on the differentiation of ex vivo cells of femoral head. Compressive loading induced a 4.2-fold increase in RANKL gene expression, and OPG protein synthesis in the compressed cells was significantly decreased [
38]. Osteonecrosis of the femoral head was observed both in the non-weight-bearing rats and in the weight-bearing rats, and non-traumatic ONFH developed in non-weight-bearing rats, indicating that weight bearing does not contribute to the development of non-traumatic ONFH in rats [
39]. The effects of mechanical loading on the trabecular bone of the femoral head were not significant, suggesting that the effect of mechanical loading in the rats with backpack mainly occurs at cortical bone sites [
40]. Studies show that chondrocytes are highly sensitive to mechanical stress stimulation, and the mechanical stimulation of normal physiological load can activate the synthesis and metabolism of chondrocytes and promote the formation and deposition of cartilage matrix [
41,
42]. On the contrary, excessive mechanical load aggravates the catabolic process of articular chondrocytes, leading to the decrease of cell matrix formation, the increase of proteolytic enzyme activity and the apoptosis of chondrocytes [
43].
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.