Background
Liver fibrosis is a wound-healing process that occurs in response to chronic liver injury from a variety of etiologies and eventually progresses to liver cirrhosis following persistent inflammation and fibrogenesis [
1,
2]. Characteristic features of liver fibrosis include agglutination in the extracellular matrix (ECM) of the liver, increased collagen fiber content, and decreased ECM degradation. Hepatic parenchymal cell injury is the initiating factor in liver fibrosis. Hepatic stellate cell (HSC) activation, proliferation, and transdifferentiation into myofibroblasts are considered pivotal mechanisms of hepatic fibrosis and of the activation of HSC secretion of ECM, including α-smooth muscle actin (α-SMA) and collagen I [
3]. The activated HSCs secrete matrix metalloproteinases (MMPs) and matrix metalloproteinase tissue inhibiting factors (TIMPs) and affect the deposition and degradation of the ECM in the liver. Among the MMPs is the main ECM-degrading enzyme, while TIMPs are specific inhibitors of MMPs. Thus, TIMPs inhibit the expression of TIMP1 and weaken the inhibition of MMP1, which promotes ECM degradation and exerts an anti-liver fibrosis effect [
4,
5]. Transforming growth factor-1 (TGF-β1), a highly potent fibrogenic cytokine, simulates both small mothers against decapentaplegic homolog (Smad) and mitogen-activated protein kinase (MAPK) signaling in HSCs, thus stimulating collagen I gene expression [
6,
7]. TGF-β signaling also plays an important role in the reduction of MMPs and the increase in TIMPs during liver fibrosis [
8]. Platelet-derived growth factor (PDGF), a potent proliferative cytokine in HSCs, stimulates mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) and PI3K/Akt/P70S6K signaling in HSCs. These signaling pathways lead to the activation, migration, proliferation, survival, and contraction of HSCs as well as the promotion of ECM secretion and deposition, thus potentially causing hepatic fibrogenesis [
9,
10].
Recent studies of the pathophysiological mechanisms and diagnosis of hepatic fibrosis have made considerable progress. Moreover, possible drug targets against hepatic fibrosis have been identified [
11]; however, biological or chemical drugs that target hepatic fibrosis have not yet been approved by the FDA (food and Drug Administration) for clinical applications. Traditional Chinese medicine (TCM) has proven to be effective in the treatment of liver fibrosis due to its unique advantages, which have been demonstrated over many years of clinical validation [
12]. LWWL is classified under a new category of TCM drugs approved by the CFDA. LWWL is composed of six herbs:
Schisandrae chinensis fructus,
Fructus Ligustri Lucidi,
Forsythiae fructus,
Curcumae rhizoma,
Perennial sow thistle, and
Ganoderma spore. Clinically, LWWL effectively improves collagenase activity, thus increasing collagen degradation in liver tissue and the serum protein content, reduces the liver tissue collagen content, and effectively reduces liver fibrosis markers in the serum. Chronic liver injury is significantly improved and reversed, which promotes ECM degradation and reabsorption to prevent and delay the occurrence of progressive liver fibrosis [
12,
13]. Moreover, long-term colchicine treatment in patients with liver fibrosis showed anti-inflammatory, anti-fibrotic, and immunomodulatory effects as well as the relief of portal hypertension [
14,
15]. Therefore, colchicine was used as a positive control. In this study, we evaluated the therapeutic effect of LWWL in the treatment of hepatic fibrosis and investigated the mechanism of its antifibrotic effects.
Methods
Experimental animals
Sprague-Dawley rats (male, Grade III, 180 ± 20 g, 8 weeks old) were purchased from the Laboratory Animal Center of the Academy of Military Medical Sciences. All the animals were kept in an environmentally controlled breeding room (20–22 °C, 45–50% humidity). This study protocol strictly adhered to the recommendations of the Guidelines for the Care and Use of Laboratory Animals of 302 Military Hospital (No. IACUC-2015-008).
Experimental drugs
LWWL was purchased from the Shandong Shibojindu Pharmaceutical Company (batch Nos. 150,709, 150,805, 150,804, and 150,812). Colchicine was purchased from Sigma-Aldrich (USA). Olive oil was purchased from Sinopharm (China). Carbon tetrachloride (CCl4) was purchased from Beihua.
Reagents
Hydroxyproline, alanine transaminase (ALT) and aspartate aminotransferase (AST) testing kits were purchased from Nanjing Jiancheng Co., Ltd., China. PCR primers were purchased from Invitrogen. Maxima SYBR Green qPCR Master Mix (2×) and the First Strand cDNA Synthesis Kit were purchased from Thermo Fisher Scientific, Inc. The bicinchoninic acid (BCA) Protein Quantification Kit was purchased from CWBIO (China). Primary antibodies against α-SMA and collagen I were purchased from Abcam (UK), and that against DAPDH was purchased from Cell Signaling Technology (USA).
Animal model and protocol
Hepatic fibrosis was induced by CCl4 as previously described. Male Sprague-Dawley rats were treated twice weekly for 8 weeks with either 2 mL·kg− 1 body weight of a 50% solution of CCl4 in olive oil or olive oil alone by oral gavage. A subset of rats received daily intraperitoneal injections of either colchicine (0.2 mg/kg per day), LWWL (0.4, 1.6, or 6.4 g/kg per day), or vehicle (N = 12 for all groups) during weeks 9–12. The rats were sacrificed after 12 weeks. After sample collection, the rats were euthanized by cervical dislocation. The rat was placed on the lid of the feeding box, and then, the research grabbed the rat’s tail with their right hand, pulled the tail back slightly, quickly pressed the thumb and forefinger of their left hand down on the head, and dislocated the rat’s neck with both hands. All the animals received humane care in compliance with the Chinese Animal Protection Act and according to National Research Council criteria. The protocol was approved by the Committee on the Ethics of Animal Experiments of the 302 Military Hospital.
Histological analysis and immunohistochemistry
Tissues were fixed in 4% paraformaldehyde and embedded in paraffin. Sections (5-μm thickness) were prepared for H&E and Sirius Red staining as well as α-SMA (1:500) and collagen I (1:200) immunohistochemistry. All the procedures were performed as previously described.
Measurement of the hydroxyproline content and serum ALT/AST levels
Hydroxyproline, ALT, and AST kits were utilized in accordance with the manufacturers’ protocols. Briefly, serum samples were obtained by separating the supernatant from the blood. After centrifugation (3000 rpm for 10 min), serum ALT and AST levels and the hydroxyproline content were measured using an Olympus AU5400 Automatic Biochemistry Analyzer (Olympus Optical, Tokyo, Japan).
RNA isolation and quantitative reverse-transcription polymerase chain reaction (RT-PCR) analysis
The total RNA was isolated from liver tissue using TRIzol reagent (Invitrogen). RNA (1 μg) was reverse-transcribed to complementary DNA (cDNA) using a First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc.). Quantitative RT-PCR was performed to measure Acta2 (encoding α-SMA), collagen I, TGF-β1, PDGF, TIMP1, and TIMP2 mRNA expression using Power SYBR Green PCR Master Mix (Life Technologies, Thermo Fisher Scientific, Inc.) on an ABI Prism 7500 Sequence Detection System. Data analysis was performed using the 2
−ΔΔCT method for relative quantification. All the gene expression levels were calculated relative to GADPH. Primer sequences are shown in Table
1.
Table 1
Primer Sequences Used in This Study
Acta2 | GAACACGGCATCATCACCAA | CAAGGTCGGATGCTCCTCTG |
Collagen I | CTCCTGGCAAGAACGGAGA | CCAGCTGTTCCAGGCAATC |
TGF-β1 | CCGCAACAACGCAATCTATG | AGTTCTACGTGTTGCTCCACAGT |
PDGF | TCTGCTGCTACCTGCGTCTG | AGGCGCTGAAGGTCATCAA |
TIMP1 | GCCTCTGGCATCCTCTTGTT | CCAGGTCCGAGTTGCAGAA |
TIMP2 | TATTGTGCCCTGGGACACG | GTCCATCCAGAGGCACTCATC |
GAPDH | GCATCCTGCACCACCAACT | GCAGTGATGGCATGGACTGT |
Western blot analysis
Liver tissues were homogenized in lysis buffer (150 mM of NaCl, 1% Nonidet P-40, 0.1% SDS, 50 mM of Tris-HCl, pH = 7.4, 1 mM of EDTA, 1 mM of PMSF, and 1× Roche Complete Mini Protease Inhibitor Cocktail), and protein concentrations were determined using the BCA Protein Assay Kit according to the manufacturer’s protocol. The proteins were separated by gel electrophoresis and transferred to membranes, followed by blocking with 5% w/v skim milk in 1× TBST for 1 h at room temperature and overnight incubation with primary antibodies against α-SMA (1:200) and GAPDH (1:1000) at 4 °C with gentle shaking. After incubation with the secondary antibody (anti-rabbit IgG) for 1 h, the blot was processed according to the recommended procedure. The gray densities of the protein bands were normalized by using the GAPDH density as an internal control, and the results were further normalized to the control.
Statistical analysis
All the data are presented as the means ± standard deviation (x ± s) and were analyzed using SPSS 23.0. Differences between experimental groups were analyzed by analysis of variance (ANOVA) followed by post-hoc tests. P < 0.01 was regarded as highly statistically significant, and P < 0.05 was regarded as statistically significant.
Discussion
Hepatic fibrosis results in severe hepatic injury following ECM accumulation. This phenomenon causes many chronic liver diseases, including chronic HCV and HBV infections, chronic alcoholic liver disease, and nonalcoholic steatohepatitis. These occurrences can lead to cirrhosis or hepatocellular carcinoma (HCC). Thus, preventing hepatic fibrosis represents an important strategy for the treatment of chronic liver disease. A variety of small molecules and biological agents are being developed to treat hepatic fibrosis [
20]. However, several pathogenic mechanisms mediate hepatic fibrosis, and these agents have not yet been successfully employed in anti-hepatic fibrosis treatment regimens in a clinical setting. Many clinical and experimental studies have shown that TCMs are advantageous because they exert pharmacological effects by acting on multiple targets during the treatment of complex diseases [
25,
26], which can delay or curb liver fibrosis and even cirrhosis. Their mechanism of action includes liver injury prevention, inhibition of ECM synthesis, activation of HSCs, and ECM degradation. Thus, TCMs with anti-liver fibrosis properties are becoming the focus of studies on the prevention and treatment of this disease [
27‐
30].
LWWL, a Chinese medicinal formula, has historically been used to reduce ALT levels in patients with chronic hepatitis. Moreover, LWWL-specific adverse drug reactions have not yet been observed in a clinical setting. The present study investigated the herbal prescription LWWL, which exerts protective effects on the liver by reducing serum ALT levels. In the pharmacodynamic evaluation section of this study, LWWL did not significantly interfere with the level of AST in the serum of rats with CCl
4-induced hepatic fibrosis. The above results were repeated at least two times, and the error of detection could be eliminated as a cause. Some studies on anti-hepatic fibrosis exist, but only ALT data were available, and AST data did not appear [
31,
32]. A possible reason for the above results is that the model is a classic model of hepatic fibrosis, but the modeling time is as long as 8 weeks. Therefore, it may be that long-term stimulation by CCl
4 is not sensitive to changes in AST. LWWL inhibited HSC activation associated with a reduction in the mRNA and protein levels of α-SMA. LWWL administration also markedly suppressed fibrotic pathological changes and elevated the hydroxyproline content in parallel with a reduction in the mRNA levels of collagen I in the liver treated with CCl
4. In fact, we gathered the protein expression of collagen I several times before; during the experiment, we changed to different antibodies, and the experimental conditions were constantly improved, but the band was blurred. Thus, the result was very difficult to determine, and the final data are not displayed. Because there is currently no reliable anti-hepatic fibrosis drug, it is difficult to determine which drug concentrations should be utilized for antifibrotic experiments. Upon designing this experiment, we decided to use colchicine as the positive control drug, but taking into account that the mechanism may be different from that of LWWL, it did not appear in the later data.
Activated HSCs proliferate and migrate to injured sites, secreting large amounts of ECM, which alters the normal architecture of the liver and initiates several positive feedback pathways that lead to liver fibrosis [
33,
34]. Therefore, strategies to eliminate or normalize activated HSCs are critical for liver fibrosis therapy. Fibrotic pathologies are associated with increased levels of TGF-β1 that initially recruit inflammatory cells and fibroblasts into an area of injury and then stimulate these cells to produce cytokines and ECM [
35]. TGF-β directly increases the synthesis of ECM components such as Collagen I. In addition, a significant increase in the TGF-β expression is observed in the activated HSCs and MFBs, thus indicating that TGF-β acts as an autocrine positive regulator for ECM production [
36]. In the present study, LWWL markedly decreased the expression of TGF-β1 and PDGF in the livers of experimental rats after treatment with CCl
4. TGF-β inhibits the expression of tissue collagenase, which is a specific enzyme for degradation of mammalian intestinal collagens, and enhances the production of inhibitors of such ECM-degrading enzymes as TIMPs [
37]. In this respect, TIMPs are the main targets of the TGF-β signaling pathway [
38,
39]. LWWL caused significant reductions in TIMP-1 and TIMP-2 mRNA levels in CCl
4-treated rats. Thus, decreasing TIMP-1 or TIMP-2 levels may lead to an increase in ECM degradation. In the present study, TGF-β1 mRNA expression was significantly inhibited by LWWL, which may be one mechanism by which TIMP expression is regulated. Because of their importance in fibrosis, TIMPs may represent an attractive therapeutic target. These results suggest that LWWL prevents hepatic fibrosis, at least in part, by negatively regulation of TGF-β signaling pathway to inhibit the activation and proliferation of HSCs. Salidroside is a phenolic glycoside and possesses various pharmacological properties which can isolated from
Fructus Ligustri Lucidi in the herbal prescription LWWL. It’s reported that treatment with salidroside can protects against bleomycin-induced pulmonary fibrosis via inhibition of NF-κB and TGF-β1/Smad-2/− 3 pathways [
40]. Therefore, understanding the regulatory mechanisms of the TGF-β signal between physiologic and pathologic situations will be essential in the design of new therapeutic approaches for various diseases caused by a deregulation of the TGF-β signal. Thus, antagonists of the TGF-β signal could be applied in liver fibrosis. If the active compounds are available to the public, our present knowledge base of the physiologic regulation in activated HSCs and pathologic deregulation in MFBs of autocrine TGF-β signal will help elucidate the clinical application of such drugs for liver fibrosis in the future.
Conclusions
In summary, we used the well-characterized CCl4 rat model to examine the antifibrotic effects of LWWL. In the present study, LWWL attenuated CCl4-induced liver fibrosis and improved liver function. The antifibrotic effects of LWWL were associated with its reduction of collagen synthesis, suppression of HSC activation, and promotion of ECM degradation. Taken together, the results of this study provide new opportunities for the use of LWWL in the treatment of liver fibrosis. However, the specific mechanism involved still needs to be determined.
Acknowledgments
The authors thank the China Military Institute of Chinese Materia & Integrative Medical Center, 302 Military Hospital, for technical support.