Background
While there is an active search for new antimalarial drug combinations that could prevent or delay further spread of resistance, there is a need to understand the basis of parasites resistance to chloroquine (CQ) and other antimalarial drugs and explore potentials to use the data in improving the potency and rational for selecting components for effective drug combination. Constant observation of the existing parasite population concerning their genetic makeup determining the resistance to CQ became even more important since it was shown that after CQ withdrawal for therapy CQ-sensitive parasite re-occurred [
1]. So written-off drugs may come into focus again.
The molecular basis of CQ resistance in
Plasmodium falciparum is still unclear, and the association of point mutations in different genes with chloroquine-resistance has been largely studied in the last decade. In 2000,
pfcrt gene was identified [
2]. This gene consisting of 13 exons showed 6–8 point mutations including one that appears to play a crucial role in CQR [
3]. A lysine to threonine change at position 76 (K76T) which was subsequently found in every
in vitro CQR parasite from around the world [
4,
5] was identified as an important mutation associated with CQR. The resistance was associated with a reduced accumulation of CQ in the parasite digestive vacuole but how the
pfcrt gene exerts such an effect on the digestive vacuole is still unclear. Many studies have shown that the
pfcrt play a crucial on CQR, but this mutation was not the sole requirement, suggesting that other factors including host factors are responsible for the clearance of CQR parasites [
6].
Polymorphisms in
pfmdr1, a gene located on chromosome 5 which encodes the
P. falciparum P-glycoprotein homologue-1 is also thought to modulate CQR. It is a typical member of the ATP-binding cassette transporter superfamily localized in the parasite vacuole, where it may regulate intracellular drug concentrations [
7]. Mutations were observed at the amino acids 86, 184, 1034, 1042, and 1246, which were strongly linked to the CQR in laboratory clones obtained from various regions [
8]. However, the link between
pfmdr1 and CQR still remains unclear and controversial [
6,
9]. While some field studies had indicated that there is positive association between CQR and mutation (asparagine to tyrosine change) at position 86 (N86Y) [
10,
11], several others had doubts about this association [
12,
13]. Currently,
pfmdr1 mutations are said to assist the CQR parasites by augmenting the level of resistance. A combination of
pfcrt and
pfmdr1 polymorphisms is believed to result in higher levels of CQR [
4,
7].
In Nigeria, CQ has been used for many years as the first-line treatment for uncomplicated malaria. However, like many other malaria endemic regions the therapeutic efficacy of CQ has decreased considerably. This, therefore, has led to the change in the first line drug for the treatment of malaria to artemisinin-based combination, although, CQ is still widely used in the country. In order to explore the roles of pfcrt and pfmdr1 polymorphisms in CQR, the Fluorescence Resonance Energy Transfer (FRET) method was used to determine these polymorphisms and their in vivo sensitivity to chloroquine in P. falciparum isolates from Osogbo Western Nigeria. The use of a Real Time PCR assay for a rapid, sensitive, and specific detection of these mutations was also assessed.
Materials and methods
Study site and patients
The study was undertaken between July 2004 and January 2005 in the town of Osogbo located in the western part of Nigeria. Osogbo is the state capital of Osun state Nigeria and it represents a typical urban setting in Nigeria. Malaria is present throughout the year with a marked increase during the raining season (i.e. April – September). Febrile children (1–12 years old) attending the Osun state Hospital and Ladoke Akintola University Teaching hospital were screened for P. falciparum parasitaemia. Blood films were stained with 10% Giemsa and examined microscopically. Criteria for recruitment in this study were: (1) asexual parasitaemia between 2,000/μl and 200,000/μl, (2) no signs of severity or severe malaria (including severe anaemia defined by haemoglobin <5 g/dl), (3) no intake of antimalarial drugs during the preceding four weeks, (4) informed consent from the patient parent or guardian. The detected parasitaemic cases were treated with 25 mg/kg chloroquine in divided doses for three days at 10 mg/kg daily for D0 and D1 and 5 mg/kg for D2. Subsequent follow up appointments were scheduled for days 3, 7, 14, 21 and 28.
Classification of responses to treatment was done according to the WHO criteria [
14]. The cure rate on day 28 of the follow-up was defined as the percentage of children who remained free of parasites. Two drops of blood were also blotted onto 3 MM Whatman filter paper on days 0 before treatment and during following up when there was re-occurrence of clinical symptoms for extraction and analysis of parasites DNA. Treatment failure rates were corrected by
msp-2 genotyping of parasites at enrollment and recrudescence of infections [
15]. The study received ethical approval from the ethical review committee boards of the joint College of Health Sciences/Ladoke Akintola University Teaching Hospital and Osun State Hospitals Management Board.
Detection of Pfcrt and Pfmdr1 mutations by Real time PCR
Parasite genomic DNA was extracted from blood samples collected on filter paper using a QIAamp DNA blood kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. The oligonucleotide probes and primer used to detect the polymorphisms in
pfcrt and
pfmdr1 are shown in Table
1.
Table 1
Sequence of primers and probes used for Pfcrt and Pfmdr1 amplification and melting temperatures of the sensor probes of each allele
Pfcrt
| | |
Forward Primer: CTTGTCTTGGTAAATGTGCTCA | | |
iLC Primer: GTTACCAATTTTGTTTAAAGTTCT | | |
Sensor Probe: TGTGTAATTGAAACAATTTTTGCTAA | 46.5 ± 0.2 | 65.3 ± 0.4 |
Pfmdr1
| | |
Forward Primer: TGTATTATCAGGAGGAACATTACC | | |
Reverse Primer: ACCACCAAACATAAATTAACGGA | | |
Sensor Probe 86: ATTAATATCATCATAAATACATG | 51.8 ± 0.3 | 56.5 ± 0.2 |
Anchor Probe 86: TCTTTAATATTACACCAAACACAGATAT | | |
Sensor Probe 184: TAAAAAATGCACGTTTGACTTTATGTATTA | 53.0 ± 0.2 | 58.7 ± 0.3 |
Anchor Probe 184: CCTTTTTAGGTTTATTTATTTGGTCAT | | |
For
pfcrt analysis the sensor probe labeled with fluorescein at the 3' end is designed to be perfectly complementary to the mutation site. An amplification primer iLC labeled with Cy5 on the third base from the 3'end is used as a reverse primer which is extended during amplification. During FRET, fluorescein which is excited by the light source of the Rotor Gene instrument transfers its energy to the Cy5 incorporated into the PCR product working as anchor probe [
16,
17]. A specific melting temperature is then obtained for each genotype: a sensor probe spanning one mismatch could still hybridize to the target sequence but will melt off at lower temperature than a sensor probe with a perfect match. Primers and probes for
pfcrt were designed and synthesized by TIB MOLBIOL (DNA synthesis service, Berlin, Germany)
For
pfmdr1 mutations, hybridization probes consisted of two different oligonucleotides that bind to an internal sequence amplified by forward and reverse primers Table
1. The sensor probe, labeled at the 3'end with FAM, is designed to match the mutation sites. The anchor probe, labeled at the 5' end with Cy5 and phosphorylated at the 3' end to prevent extension by Taq polymerase, is designed to conserved sequences adjacent to the mutation sites. Both probes, localised on the same DNA strand, could hybridize in a head-to tail arrangement, bringing the two fluorescent dyes into close proximity. During FRET, FAM was excited by the light source of the Rotor Gene instrument. The excitation energy was transferred to the acceptor fluorophore, Cy5, and the emitted fluorescence was measured on the Rotor Gene channel in continuous during the melting phase. A specific melting temperature is then obtained for each genotype as described above.
Pfmdr1 primers and probes were synthesized by Operon Biotechnology (Cologne, Germany).
PCR amplification
Amplification was performed with Rotor Gene 3000 (Corbbett, Sydney, Australia). For pfcrt forward primer was added at a final concentration of 0.4 μM, iLC primer 0.5 μM and probe at 0.2 μM. The amplification program consisted of an initial step at 95°C for 10 min, amplification was performed with 40 cycles of denaturation (95°C for 10 s), annealing (50°C for 15 s), and extension (65°C for 15 s). The melting curve program consisted of one cycle of 95°C for 15 s, and heating at 36°C to 75°C rising by 1°C.
For pfmdr1, the master mix contains a final concentration of 0.4 μM of both primers and 0.2 μM of both Anchor and sensor probes. For pfmdr1 codons 86 and 184, the PCR program was as follows: 5 min at 95°C, 40 cycles of 94°C for 10 s, 52°C for 30 s, and 72°C for 40 s. The melting program consisted of one cycle of 95°C for 15 s and heating from 36 to 85°C rising by 1°C.
Statistical analysis
For analysis purposes, each isolate was classified based on the presence or absence of a resistance-associated allele and infections with mixed wild-type/mutant alleles of pfcrt or pfmdr1 were treated as mutants. Data were analysed using the statistical programs JMP for Windows. For univariate analysis, frequencies were compared using the Fisher's exact tests. Two sided P values < 0.05 indicated statistical significance. McNemar's test was used to compare the samples before and after treatment.
Discussion
In this study, a Real Time PCR assay for the detection of pfcrt and pfmdr1 alleles thought to be associated with CQ susceptibility and resistance was described. This Real-Time PCR assay was demonstrated to be rapid, sensitive, and specific for the detection and characterization of P. falciparum genetic marker of CQR. The assay detected mixed alleles infections and clearly discriminated between CQ-susceptible and CQ-resistant isolates. Its speed (up to 72 samples can be assayed in a 2-h experiment) and performance characteristics may eliminate the need for more complicated approaches and make it an attractive strategy that could easily be adapted to large-scale studies of drug resistance.
Point mutations in the
pfcrt gene and to a lesser extent, in the
pfmdr1 gene are thought to be associated with CQR [
2,
6]. The goal of this study was to evaluate the utility of these molecular markers as indicators of chloroquine resistance in isolates of
P. falciparum obtained from Osogbo western Nigeria using a hybridization probe method on a Real Time PCR technology platform. The result of this study showed a high prevalence of
pfcrt T76 (74%). This observation is consistent with the previous reports from various malaria endemic regions where chloroquine has been widely used. A significant association was also found between the overall
in vivo rate of treatment failure and the frequency of mutated
pfcrt gene in the population (P = 0.004) as already shown previously in western Nigeria [
19] and other malaria endemic areas [
18]. 93% of the pre-treatment isolates carried the
pfcrt T76 and mixed allele while among the post treatment isolate the prevalence was 98%. The facts that this polymorphism was present in all the recrudescence isolates emphasised again the fact that this mutation is important in CQR.
The point mutation of asparagine to tyrosine at codon 86 of
pfmdr1 has been associated with CQR in some studies [
8,
9] but not in others [
12]. In the present study, both the
pfmdr1 Y86 and F184 mutations showed no correlation with resistance to chloroquine. Both the wild type and the mutant alleles for each locus were present in both sensitive and resistance isolates. Previously, an association was established between chloroquine-resistance and alleles of the
pfmdr1 gene in laboratory isolates obtained from different parts of the world [
8]. Others had considered whether this association existed in parasite isolates obtained directly from the field [
9,
20]. Their analysis showed that African isolates predominantly possess polymorphism at two alleles, codon-86 and codon-184, with a positive association, although incomplete, between mutation of codon-86 and CQR. A similar association has been found in several studies [
4,
11,
21,
22]. Nevertheless, much confusion has surrounded the association of different
pfmdr1 alleles to chloroquine resistance because numerous studies have had contradictory results. Transfection studies as well as carefully controlled molecular epidemiologic studies have shown that there are strong associations between
pfmdr1 polymorphisms and antimalarial resistance [
7]. However, like many other studies [
12] the present findings have failed to find such associations because the presence of both wild-type and mutant-type alleles in our samples were largely independent of their
in vivo responses. Also the current belief that the combination of
pfcrt and
pfmdr1 polymorphisms result in higher levels of CQR [
4] was not observed in this study. Although a significant association was observed (p = 0.028), it was not in any way stronger than the one observed with
pfcrt alone. Analysis of altered gene expression and other mechanisms that may contribute to a resistant phenotype is needed before the role of
pfmdr1 can be excluded.
A recent report from Ibadan Nigeria a neighbouring town to Osogbo had suggested an association and linkage disequilibrium between the
pfcrt T76 and
pfmdr1 Y86 alleles in chloroquine-resistant isolates [
19]. On the contrary this study suggested no possible association between these two polymorphic alleles and
in vivo chloroquine resistance and that these molecular markers by themselves may not predict
in vivo chloroquine resistance.
Authors' contributions
OO performed the in vivo testing and the molecular analysis, and drafted the manuscript.
TOO performed the in vivo testing.
FR participated in the molecular study.
AFF-B supervised the design of the study.
PGK and JFJK supervised the molecular work and the interpretation of the data and helped to draft the manuscript.
All authors read and agreed to the content of the manuscript.