Skip to main content
Erschienen in: BMC Medical Genetics 1/2018

Open Access 01.12.2018 | Research article

Spectrum of MECP2 mutations in Vietnamese patients with RETT syndrome

verfasst von: Huong Le Thi Thanh, Trinh Do Thi Diem, Chinh Vu Duy, Ha Ly Thi Thanh, Hoa Bui Thi Phuong, Liem Nguyen Thanh

Erschienen in: BMC Medical Genetics | Ausgabe 1/2018

Abstract

Background

Rett syndrome (RTT) is a severe neurodevelopmental disorder in children characterized by a normal neurodevelopmental process in the first 6–18 months followed by a period of motor and vocal deterioration with stereotypic hand movements. Incidence of RTT is mostly due to de novo mutation in the MECP2 gene (methyl-CpG-binding protein 2).

Methods

The study assessed 27 female patients presented with classical RTT phenotype age range from 18 months to 48 months. Specialist carried out the clinical evaluation and diagnosis according to RTT diagnosis criteria. Blood samples from patients were then collected for genomic DNA extraction. We next performed MECP2 gene amplification and sequencing of the whole coding region to screen for mutations.

Result

MECP2 mutation was found in 20 patients (74%) including: 2 missense, 4 nonsense, 6 frameshift and 2 deletion mutation. The study identified 14 pathogenic mutations which we found 4 mutation, to our knowledge and extensive search, not priory reported in any mutation database or publication: c.1384-1385DelGT, c.1205insT, c.717delC and c.1132_1207del77. High percentage of C > T (70%) in CpG sites mutation was found.

Conclusion

Our result reveals a high percentage of C > T mutation in CpG hot spot, which is more prone to modification and more likely to be detected in RTT as a disorder is strictly due to de novo mutations. The study is the first to identify the mutation spectrum of MECP2 gene in Vietnamese patients and also an important step toward better diagnosis and care for RTT patients in Vietnam.
Abkürzungen
MECP2
Methyl CpG binding protein 2
MLPA
Multiplex Ligation-dependent Probe Amplification
PCR
Polymerase Chain Reaction
RTT
Rett Syndrome

Background

Rett syndrome (RTT; OMIM Entry #312750) is a neurodevelopmental disorder which is one of the main causes of neurological disability in children [1]. Rett syndrome almost occurs in females, the estimate incident of RTT worldwide is 1:10.000–1:15000 female births [2]. The classic clinical presentation of RTT is characterized by average psychomotor progression from birth until 6–18 months, and then development halted followed by period of psychomotor deterioration [3, 4] . During the phase of deterioration, the patients often present stereotypic movements (classic RTT hand), loss of acquired motor skills and communication skills [5]. The neurodevelopmental of the child may stabilize or in some case, limited recovery can be observed in the next phase called the pseudo-stationary stage [6]. Other complications and symptoms of RTT may include seizure, cardiac abnormalities, irregular breathing patterns and scoliosis [79]. The level of motor impairment becomes more severe as the child’s age [10]. There are also atypical RTT patients whom present with several but not all clinical features and progression phases of classical RTT [11].
The most common cause of RTT is de novo mutations in the MECP2 gene (Methyl-CpG binding protein 2), located on the X chromosome (locus Xq28) [1]. Additionally, the gene is also subjected to X-chromosome inactivation, which alters the severity and manifestation of RTT [12]. The MECP2 gene consists of four exons and encode for the widely expressed methyl-CpG-binding protein 2 – member of the methyl-binding domain protein family. MECP2 is an important transcription factor, which functions by interaction and modification of epigenetic factors [13]. There exist two isoforms of MECP2 (MeCP2_e1 and MeCP2_e2) which have slight difference in their expression levels between tissues and distinct N termini. MeCP2_e1 is most commonly found in the brain tissue whilst MeCP2_e2 predominate in the placenta, liver and skeletal muscle tissues [14, 15]. Many studies have addressed MECP2 role in RTT, beside the critical role in neurodevelopmental process, MECP2 have been hypothesized to help maintenance of synaptic function, brain cell connectivity and neuronal plasticity [16, 17].
To date, around 1000 disease-causing MECP2 mutations have been characterized and recorded in multiple databases such as RettBASE and The Human Gene Mutation Database [18]. Case reports of asymptomatic carriers or carriers with mild clinical symptoms have been found to have skewed X chromosome inactivation (XCI) in preference of the normal copy of MECP2 [12]. In addition, MECP2 mutations have been loosely associated with other pediatric neurological conditions, most notably autism, Angelman syndrome, and many behavioral and intellectual disorders [19, 20].
In Vietnam, the lack of awareness and knowledge is also a major problem as consultation measures need to be provided families of RTT patients. Diagnosis of RTT require both clinical and molecular evidence, in which characterization of MECP2 gene is required for the disorder and provide valuable information for clinician in planning care and treatments.
In this study we first report the mutation spectrum of MECP2 in Vietnamese patients with clinically diagnosed for Rett syndrome, in which 4 novel mutations was found. This finding is an important step toward understanding and development of therapy to help patients suffering from RTT.

Methods

Study population

The study assessed 27 female patients presented with sporadic, RTT phenotype; diagnosis were made based on the criteria by Neul et al. [11]. Specialized pediatricians and neurologists at Vinmec hospital made clinical evaluation and confirmation of RTT. The Ethical board of Vinmec International Hospital approved of the study; informed consent was obtained from the parents of the patients.

Inclusion criteria

Female patients were recruited in the study based on classic presentation of RETT syndrome: average psychomotor progression from birth until 6–18 months of age, with no history of brain injury, trauma or serious infection. The patients presented with 2 out of 4 main clinical criteria:
  • Loss of acquired hand skills
  • Loss of acquired language skill
  • Gait abnormalities: impaired (dyspraxic) or absence of ability
  • Stereotypic hand movements

Molecular analysis

The genomic DNA was extracted from patient’s peripheral blood using the Wizard® Genomic DNA Purification Kit (Promega). The DNA quality was tested by the NanoDrop spectrophotometer. In order to perform mutant analysis, we designed primers to amplify the complete coding region (exon 2, 3, 4) including flanking intronic splice site sequence and 5’UTR within exon 2 and 3’UTR based on published genomic sequence of MECP2.
DNA was amplified by manual PCR method using GoTaq® Green Master Mix (Promega) on the GeneAmp PCR system 9700 thermocycler. The PCR product was checked on agarose gel and purified using QIAquick PCR purification Kit (Qiagen) according to the manufacturer’s instruction. The purified PCR product was sequenced directly in both strands using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) by automated fluorescent sequencing technology (Applied Biosystems 3500 Dx Genetic Analyzer). We used DNAstar to compare the patients’ MECP2 sequences with the reference MECP2 sequence (Genebank accession number. MECP2 locus, AF030876; MECP2, ENSG00000169057). The novel mutation was confirmed by doing extensive search on RettBASE and The Human Gene Mutation Database as well as from prior publications. We used in silico analysis to predict the consequence of the mutation identified in our cohort. The tool used were Polyphen-2 [21] and MutationTaster [22].

Results

Mutation analysis of the MECP2 gene

Mutation analysis was conducted in 27 female patients. The diagnosis followed the standard protocol: After clinical evaluation, blood sample was taken and PCR with the designated primers (Table 1) was used to amplify MECP2, followed by Sanger sequencing of the exons and compare with reference sequence to detect mutations. On clinical examination, all patients presented with history of a period of neurodevelopmental regression followed by recovery or stabilization, together with partial or complete loss of motor and language skill and stereotypic hand movements.
Mutation analysis detected MECP2 mutation in 20 out of 27 patients (mutation detection rate 74%)(Table 2). The study identified 14 pathogenic mutations, including 2 missenses, 4 nonsenses, 6 frame shifts and 2 deletions. The mutations that occur more frequently were c.473 C > T (n = 4); c.808 C > T (n = 4), c.763 C > T (n = 2) and c.502C > T (n = 2). All mutation were predicted to be disease causing by in silico analysis (Table 3).
Table 1
Primers used in MECP2 amplification
Amplicon
Length (bp)
Forward primer
Reverse primer
Exon 2
355
TAGCCCTGGGAAAAAGGTCG
GGCACAGTTTGGCACAGTTAT
Exon 3
484
CCTGCCTCTGCTCACTTGTT
CATGAGGGATCCTTGTCCCTG
Exon 4.1
429
TGCCCTATCTCTGACATTGCT
ATGACCTGGGTGGATGTGGT
Exon 4.2
631
GTCCTGGGAAGCTCCTTGTC
CTCTCCAGTGAGCCTCCTCT
Exon 4.3
388
CAGCGTCTGCAAAGAGGAGA
CCCTGAAGCCACGAAACTCT
Table 2
Mutation alleles frequency of RETT patients
Patient No.
Mutation of MECP2
Mutation type
Novel mutation
Nucleotide change
Amino acid change
1–4
c.473C > T
p.T158 M
Missense
No
5–8
c.808C > T
p. R270X
Nonsense
No
9–10
c.763C > T
p.R255X
Nonsense
No
11–12
c.502C > T,
p. R168X
Nonsense
No
13
c.1384-1385del GT
V462fs
Frameshift
Yes
14
c.763C > T
p.R255X
Nonsense
No
 
c.1205insT
p.P402Lfs
Frameshift
Yes
15
Exon 4 deletion
_
Large deletion
No
16
c.(164–182)del 19
p.Q56fs
Frameshift
No
 
(1148–1193)del 46
p.L383fs
Frameshift
No
17
c.717del C
p.A240fs
Frameshift
Yes
18
c.806del G
p. G269fs
Frameshift
No
19
c.1132_1207del77
A378fs
Deletion
Yes
20
c.917G > A
p.R306H
Missense
No
Table 3
In silico analysis to determine the causal relationship of the mutation and RETT syndrome
Nucleotide change
Amino acid change
Domain
MutationTaster
PolyPhen-2
Reference
c.473C > T
p.T158 M
MDB
Disease causing
Probably damaging with a score of 1.000
Rettbase
c.808C > T
p. R270X
TRD-NLS
Disease causing
N/A
Rettbase
c.763C > T
p.R255X
TRD
Disease causing
N/A
Rettbase
c.502C > T,
p. R168X
Inter-domain region
Disease causing
N/A
Rettbase
c.1384-1385del GT
p.V462fs
C- term
Disease causing
N/A
Novel
c.763C > T
p.R255X
TRD
Disease causing
N/A
Rettbase
c.1205insT
p.402Lfs
C - term
Disease causing
N/A
Novel
c.(164–182)del 19
p.Q56fs
TRD-NLS, 3’UTR
Disease causing
N/A
Rettbase
c.(1148–1193)del 46
p.L383fs
C - term
Disease causing
N/A
Rettbase
c.717delC
p.A240fs
TRD
Disease causing
N/A
Novel
c.806delG
p. G269fs
TRD-NLS
Disease causing
N/A
Rettbase
c.1132_1207del77
A378fs
C – term
Disease causing
N/A
Novel
c.917G > A
p.R306H
TRD
Disease causing
Probably damaging with a score of 0.999
Rettbase
N/A: Not applicable
A novel mutation was also identified: c.1384–1385 del GT (Fig. 1), a two-nucleotide deletion which lead to frameshift and alter the amino-acid sequence and premature termination of the protein product. The carrier was a female patient diagnosed with classic RTT at the age of 3. We also identified 3 other novel mutations: c.1205insT, c.717delC and c.1132_1207del77, to the best of our knowledge, not described in the MECP2 mutation database (Rettbase) or previously described in any publication.

In silico prediction of mutation

Two in silico tool (Polyphen-2, MutationTaster) were used to predict the consequence of mutation. We identified the region change, probability of disease causing and potential changes to protein structure of each mutation identified in our cohort.

Discussion

The current study investigated the mutation spectrum of MECP2 in Vietnamese patients. The patients had been enrolled and pediatricians and neurologists carried out clinical evaluation. Therefore, the cohort is well defined and well suited for molecular study. Prior to availability of MECP2 mutation test, criteria for Rett syndrome diagnosis are based on a collection of clinical features organized into age-related stages [23]. Classic Rett syndrome was classified for girls meeting all main criteria while variants of this disorder were marked for patients with a less severe clinical presentation, including preserved speech or hand use, normal head circumference, or delayed symptom onset.
Mutations of MECP2 gene are highly correlated with RTT and have been found in other neurological disorder such as autism, Angelman syndrome, and other behavioral and intellectual disorders. Therefor molecular diagnosis for MECP2 mutations is an important step in diagnosis of neurodevelopmental disorders. Routine diagnostic protocol for MECP2 mutations is often carried out by DNA sequencing because of the gene’s broad spectrum of mutation.
We identified MECP2 mutation in 74% of the cases, the mutation detection rate is comparable with other study in which MECP2 mutations were identified in approximately 75% of RTT patients [2426] . The result suggest that MECP2 mutation is not the only cause of RTT, as there are also FOXG1 gene (locus 14q13) which causes the congenital variant of Rett syndrome and others mutations which could also lead to RTT [27]. Furthermore, we did not take into account intronic sequence change (i.e. splice site mutation) which could lead to changes in the protein structure and function. Therefore, the absent of MECP2 alone is not enough to rule out the possibility of RTT in cases where the child does not have typical symptoms or not old enough to conclude with the diagnosis of classic RTT.
The study identified 14 pathogenic mutations, including 2 missenses, 4 nonsenses, 6 frame shifts and 2 deletions. The more frequently detected mutations in our cohort (c.473 C > T; c.808 C > T, c.763 C > T and c.502C > T) are also the most common mutations reported worldwide as listed on RettBASE [18]. The mutation profile suggested that the similarity of the mutation spectrum in MECP2 is not the product of heredity, but the susceptibility of the mutation sites. We noted that most of the point mutations in our cohort are C > T in CpG sites. The CpG sites are often mutation hotspot because the cytosine in these sites is often methylated (mCpG) and 5-methylcytosine is genetically unstable [28]. In disorder like RTT, which is strictly due to de novo mutations, these CpG sites mutations became more frequent.
In our cohort, we detected a novel mutation not listed previously in any mutation databases: c.1384-1385delGT. The patient had clear clinical presentations of classic RTT. The patients had a relatively normal neurodevelopmental phase in the first 8 months, and then the child’s development regressed. At 12 months of age, she experienced a seizure and was taken to the hospital. At 3 years of age, she was unable to walk independently, and stereotypic hand movements hindered hand usage. She exhibited poor interaction to her surrounding and to other people, and show no communication ability. In silico analysis confirmed the mutation as a disease causing variant.
Before the availability of MECP2 mutation test in Vietnam, criteria for the diagnosis of Rett were solely based on clinical findings. This could lead to the under-diagnosis of Rett thus, overlooking the milder form of the disease. In order to better manage and reduce the incident of Rett we need to develop a framework to provide counseling, prenatal diagnosis for the patients and families.

Conclusions

In conclusion, the study has identified and characterized a spectrum of MECP2 mutations in sporadic case of Rett syndrome and patients with Rett like feature. Because of the clinical consequence and also the lack of data of Rett syndrome in Vietnam, future studies need to be conducted on a larger scale in different parts of the country and could provide better counseling for the patients as well as their families. The mutation spectrum of Vietnamese patients will also contribute to the global mutations database and help progress toward better understanding the etiology of the disorder and aid treatment in the near future.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. We however cannot provide personal information or data contain identification of the patients in any form.
Written informed consent was obtained from the parents of the patients regarding the use of the samples for research purpose. The procedure was part of the patient’s care and posed no additional risk to the patients’ health. No identifiable information of the patients or their families was disclosed in our research. The study design was reviewed and approved by the Ethical board of Vinmec International Hospital. The study conformed with the Declaration of Helsinki regarding the use of human samples and identifiable information.
Not applicable.

Competing interests

The authors declare no conflict of interest.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet. 1999;23(2):185–8.CrossRefPubMed Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet. 1999;23(2):185–8.CrossRefPubMed
2.
Zurück zum Zitat Hagberg B. Rett’s syndrome: prevalence and impact on progressive severe mental retardation in girls. Acta Paediatr Scand. May 1985;74(3):405–8.CrossRefPubMed Hagberg B. Rett’s syndrome: prevalence and impact on progressive severe mental retardation in girls. Acta Paediatr Scand. May 1985;74(3):405–8.CrossRefPubMed
3.
Zurück zum Zitat Hoffbuhr K, et al. MeCP2 mutations in children with and without the phenotype of Rett syndrome. Neurology. 2001;56(11):1486–95.CrossRefPubMed Hoffbuhr K, et al. MeCP2 mutations in children with and without the phenotype of Rett syndrome. Neurology. 2001;56(11):1486–95.CrossRefPubMed
5.
Zurück zum Zitat Shahbazian MD, Zoghbi HY. Molecular genetics of Rett syndrome and clinical spectrum of MECP2 mutations. Curr Opin Neurol. 2001;14(2):171–6.CrossRefPubMed Shahbazian MD, Zoghbi HY. Molecular genetics of Rett syndrome and clinical spectrum of MECP2 mutations. Curr Opin Neurol. 2001;14(2):171–6.CrossRefPubMed
6.
Zurück zum Zitat Dunn HG, MacLeod PM. Rett syndrome: review of biological abnormalities. Can J Neurol Sci. 2001;28(1):16–29.CrossRefPubMed Dunn HG, MacLeod PM. Rett syndrome: review of biological abnormalities. Can J Neurol Sci. 2001;28(1):16–29.CrossRefPubMed
7.
Zurück zum Zitat Lidström J, Stokland E, Hagberg B. Scoliosis in Rett syndrome. Clinical and biological aspects. Spine. 1994;19(14):1632–5.CrossRefPubMed Lidström J, Stokland E, Hagberg B. Scoliosis in Rett syndrome. Clinical and biological aspects. Spine. 1994;19(14):1632–5.CrossRefPubMed
8.
Zurück zum Zitat Guideri F, Acampa M, Hayek C, Zappella M, Perri TD. Reduced heart rate variability in patients affected with Rett syndrome. A possible explanation for sudden death. Neuropediatrics. 1999;30(03):146–8.CrossRefPubMed Guideri F, Acampa M, Hayek C, Zappella M, Perri TD. Reduced heart rate variability in patients affected with Rett syndrome. A possible explanation for sudden death. Neuropediatrics. 1999;30(03):146–8.CrossRefPubMed
9.
Zurück zum Zitat Trabacca A, Gennaro L. A genetic cause of breathing abnormalities and severe abdominal distension. Pediatr Neurol. 2018;78:82–3.CrossRefPubMed Trabacca A, Gennaro L. A genetic cause of breathing abnormalities and severe abdominal distension. Pediatr Neurol. 2018;78:82–3.CrossRefPubMed
10.
Zurück zum Zitat Segawa M. Pathophysiology of Rett syndrome from the stand point of clinical characteristics. Brain and Development. Dec. 2001;23:S94–8.CrossRefPubMed Segawa M. Pathophysiology of Rett syndrome from the stand point of clinical characteristics. Brain and Development. Dec. 2001;23:S94–8.CrossRefPubMed
11.
Zurück zum Zitat Jeffrey L. Neul et al., “Rett syndrome: revised diagnostic criteria and nomenclature,” Ann Neurol, 2010 68: 6, 944–950. Jeffrey L. Neul et al., “Rett syndrome: revised diagnostic criteria and nomenclature,” Ann Neurol, 2010 68: 6, 944–950.
12.
Zurück zum Zitat Amir RE, et al. Influence of mutation type and X chromosome inactivation on Rett syndrome phenotypes. Ann Neurol. 2000;47(5):670–9.CrossRefPubMed Amir RE, et al. Influence of mutation type and X chromosome inactivation on Rett syndrome phenotypes. Ann Neurol. 2000;47(5):670–9.CrossRefPubMed
13.
Zurück zum Zitat Ausió J. Role of MeCP2 in neurological disorders: current status and future perspectives. Epigenomics. 2018;10(1):5–8.CrossRefPubMed Ausió J. Role of MeCP2 in neurological disorders: current status and future perspectives. Epigenomics. 2018;10(1):5–8.CrossRefPubMed
14.
Zurück zum Zitat Guy J, Cheval H, Selfridge J, Bird A. The role of MeCP2 in the brain. Annu Rev Cell Dev Biol. 2011;27:631–52.CrossRefPubMed Guy J, Cheval H, Selfridge J, Bird A. The role of MeCP2 in the brain. Annu Rev Cell Dev Biol. 2011;27:631–52.CrossRefPubMed
15.
Zurück zum Zitat Olson CO, Zachariah RM, Ezeonwuka CD, Liyanage VRB, Rastegar M. Brain Region-Specific Expression of MeCP2 Isoforms Correlates with DNA Methylation within Mecp2 Regulatory Elements. PLoS ONE. 2014;9(3):e90645.CrossRefPubMedPubMedCentral Olson CO, Zachariah RM, Ezeonwuka CD, Liyanage VRB, Rastegar M. Brain Region-Specific Expression of MeCP2 Isoforms Correlates with DNA Methylation within Mecp2 Regulatory Elements. PLoS ONE. 2014;9(3):e90645.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Qiu Z, Sylwestrak EL, Lieberman DN, Zhang Y, Liu X-Y, Ghosh A. The Rett syndrome protein MeCP2 regulates synaptic scaling. J Neurosci. 2012;32(3):989–94.CrossRefPubMedPubMedCentral Qiu Z, Sylwestrak EL, Lieberman DN, Zhang Y, Liu X-Y, Ghosh A. The Rett syndrome protein MeCP2 regulates synaptic scaling. J Neurosci. 2012;32(3):989–94.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Na ES, Nelson ED, Kavalali ET, Monteggia LM. The impact of MeCP2 loss- or gain-of-function on synaptic plasticity. Neuropsychopharmacology. 2013;38(1):212–9.CrossRefPubMed Na ES, Nelson ED, Kavalali ET, Monteggia LM. The impact of MeCP2 loss- or gain-of-function on synaptic plasticity. Neuropsychopharmacology. 2013;38(1):212–9.CrossRefPubMed
18.
Zurück zum Zitat Christodoulou J, Grimm A, Maher T, Bennetts B. RettBASE: the IRSA MECP2 variation database-a new mutation database in evolution. Hum Mutat. 2003;21(5):466–72.CrossRefPubMed Christodoulou J, Grimm A, Maher T, Bennetts B. RettBASE: the IRSA MECP2 variation database-a new mutation database in evolution. Hum Mutat. 2003;21(5):466–72.CrossRefPubMed
19.
Zurück zum Zitat Lam C-W, et al. Spectrum of mutations in the MECP2 gene in patients with infantile autism and Rett syndrome. J Med Genet. 2000;37(12, pp. e41–e41) Lam C-W, et al. Spectrum of mutations in the MECP2 gene in patients with infantile autism and Rett syndrome. J Med Genet. 2000;37(12, pp. e41–e41)
22.
Zurück zum Zitat Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods. 2014;11(4):361–2.CrossRefPubMed Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods. 2014;11(4):361–2.CrossRefPubMed
23.
Zurück zum Zitat Hagberg B, Goutières F, Hanefeld F, Rett A, Wilson J. Rett syndrome: criteria for inclusion and exclusion. Brain and Development. 1985;7(3):372–3.CrossRefPubMed Hagberg B, Goutières F, Hanefeld F, Rett A, Wilson J. Rett syndrome: criteria for inclusion and exclusion. Brain and Development. 1985;7(3):372–3.CrossRefPubMed
24.
Zurück zum Zitat Laccone F, Huppke P, Hanefeld F, Meins M. Mutation spectrum in patients with Rett syndrome in the German population: evidence of hot spot regions. Hum Mutat. 2001;17(3):183–90.CrossRefPubMed Laccone F, Huppke P, Hanefeld F, Meins M. Mutation spectrum in patients with Rett syndrome in the German population: evidence of hot spot regions. Hum Mutat. 2001;17(3):183–90.CrossRefPubMed
25.
26.
28.
Zurück zum Zitat Pfeifer GP. Mutagenesis at methylated CpG sequences. Curr Top Microbiol Immunol. 2006;301:259–81.PubMed Pfeifer GP. Mutagenesis at methylated CpG sequences. Curr Top Microbiol Immunol. 2006;301:259–81.PubMed
Metadaten
Titel
Spectrum of MECP2 mutations in Vietnamese patients with RETT syndrome
verfasst von
Huong Le Thi Thanh
Trinh Do Thi Diem
Chinh Vu Duy
Ha Ly Thi Thanh
Hoa Bui Thi Phuong
Liem Nguyen Thanh
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
BMC Medical Genetics / Ausgabe 1/2018
Elektronische ISSN: 1471-2350
DOI
https://doi.org/10.1186/s12881-018-0658-x

Weitere Artikel der Ausgabe 1/2018

BMC Medical Genetics 1/2018 Zur Ausgabe