Background
Central nervous system (CNS) homeostasis is maintained by the blood brain barrier (BBB) restricting the passage of substances and cells from the blood to the CNS parenchyma, as well as the active role of CNS resident cells (particularly astroglial and microglial cells), sensing and responding to any imbalance in the CNS environment. Infections, trauma, stroke, toxins, and other perturbations are capable of arousing an immediate short-term innate immune response as a defence mechanism to protect the CNS from insults. The response is resolved once the threat has been eliminated and homeostasis is restored. This acute neuroinflammatory response includes the activation of astrocytes [
1] and the resident immune cells (microglia) [
2]. When glial cells are activated, they change their morphology to the “reactive state”, increasing the expression of specific proteins (e.g., glial fibrillary acidic protein (GFAP) in astrocytes and ionized calcium-binding adapter molecule 1 (Iba-1) in microglia) and their migratory capacity to the insult site. Activated microglial cells increase the phagocytic activity. CNS glial cells can regulate this inflammatory response [
3‐
5]. If the glial cells cannot restore the homeostasis, the inflammatory response is maintained long after the initial insult. This chronic neuroinflammation causes the loss of white and grey matter that leads to functional deficits [
6,
7] that characterize the pathology of neurodegenerative diseases [
8,
9], stroke [
10], and traumatic brain injuries [
11]. Reactive glial cells release a wide number of mediators, including proinflammatory and anti-inflammatory cytokines, and chemokines that increase BBB permeability and induce the activation and recruitment of blood monocytes, lymphocytes, and neutrophils to the inflammation site inside the CNS parenchyma [
12,
13].
Bile acids, such as ursodeoxycholic (UDCA) and its conjugated derivative tauroursodeoxycholic acid (TUDCA), have neuroprotective effects in several neurodegenerative diseases in neuronal culture [
14] and in ischemia/reperfusion animal models, reducing infarct area and inflammation [
15‐
18]. The anti-inflammatory effect of bile acids has been previously described in BV-2 microglial cells, reducing nitrite production after β-amyloid peptide treatment [
19]. Bile acids are an interesting therapeutic tool since they can be administered either orally, intravenously, or intraperitoneally, and they easily cross the BBB. UDCA is an FDA approved drug for the treatment of primary biliary cirrhosis and has not shown any relevant side effects during chronic treatments [
20].
In this study, we tested the in vitro anti-inflammatory effect of the bile salt TUDCA in the glial cells involved in neuroinflammation and in an animal model of acute brain inflammation.
Methods
Reagents
Tauroursodeoxycholic acid, sodium salt (TUDCA) was purchased from Calbiochem (La Jolla, CA, USA). E. coli lipopolysaccharides (LPS) isotypes 026:B6 and 055:B5, Roswell Park Memorial Institute medium 1640 (RPMI), Dulbecco’s modified Eagle’s medium (DMEM), penicillin/streptomycin mix (P/S), and poly-L-lysine were purchased from Sigma-Aldrich (St Louis, MO, USA). Foetal bovine serum (FBS) and horse serum were purchased from Gibco BRL (Gaithersburg, MD, USA).
Acute brain inflammation in a mouse model
We used 8–10-week-old C57/BL6 mice purchased from Harlan® Interfauna Iberica (Sant-Feliu-de-Codines, Spain) to study acute brain inflammation. The animals were given food and water ad libitum, and were housed in the Cajal Institute animal house at a controlled ambient temperature of 22°C with 50% ± 10% relative humidity and with a 12 h light/dark cycle. Experiments were carried out in accordance with the Guidelines of the European Union Council (86/609/EU) and following the Spanish regulations (BOE 67/8509-12, 1988) for the use of laboratory animals, and were approved by the Ethics and Scientific Committees of Instituto Cajal, CSIC, and Hospital Nacional de Parapléjicos, SESCAM.
Two experimental procedures were used to determine the effect of TUDCA on acute brain inflammation: in the first procedure, 21 mice were anesthetized with 3 mL/kg of equitesin and 2 mg/kg LPS from
E. coli isotype 055:B5 (Sigma-Aldrich, St Louis, MO, USA), diluted in 5 μL of phosphate-buffered saline (PBS), was injected intracerebroventricularly (icv) on the stereotaxic coordinates AP: -0.46, ML: -1.0, and DV: -1.8 from bregma [
21] with a Hamilton syringe. One group of mice (n = 11) was treated with one intraperitoneal (ip) injection of TUDCA at 500 mg/kg every 8 h, starting right after the icv LPS injection. A control group of mice (n = 6) received an icv injection with 5 μL of PBS at the same coordinates. An additional group of untreated mice (n = 3) was used as a control to assess the inflammatory effect of the icv injections with PBS. Three days after the icv injection the animals were sacrificed with an overdose of sodium pentobarbital (50 mg/kg, ip), and perfused with 60 mL of saline buffer and 60 mL of 4% paraformaldehyde (PFA, MERCK, Darmstatd, Germany). Brains were extracted, post-fixed for 24 h in 4% PFA at 4°C, left for 48 h in 30% sucrose at 4°C, embedded in OCT™ Compound (Tissue-Tek®, Sakura Finetek Europe, Alphen aan den Rijn, The Netherlands) and stored at –20°C until further use.
In the second experimental procedure, we performed the same acute brain inflammation model on 26 mice, half of which (n = 13) received an icv injection with 5 μL of PBS and half of which (n = 13) received an icv injection with 5 μL of LPS. Seven mice from each experimental group were injected with TUDCA (500 mg/kg, ip) right after the icv injection at 3, 6, 9, and 23 h. Mice were sacrificed 24 h after the icv injection by cervical dislocation and brains were extracted, fixed in 4% PFA at 4°C for 48 h, then left for 72 h in 30% sucrose at 4°C and embedded in OCT™ compound, as described above. An additional group of untreated mice (n = 3) was processed as a control group.
Immunohistochemistry
Serial sections (15-μm thick) from the hippocampus were cut on a cryostat LEICA CM1900 (Nussloch, Germany), mounted on gelatin-coated slides (n = 7 sections per slide) and stored at –20°C until further use. For immunolabeling, endogenous peroxidase activity was previously quenched with a solution of peroxide. After blocking with normal serum, sections were incubated overnight at 4°C with the primary antibody. A specific antibody against GFAP was used to detect astrocytes, anti-Iba-1 antibody was used to detect microglia, and an antibody against vascular cell adhesion molecule 1 (VCAM-1, for more details see Table
1 and Additional file
1) was used to stain endothelial cells. Slides were incubated for 90 min at room temperature with the corresponding biotinylated secondary antibody. The signal was amplified with Vectastain ABC reagent (Vectastain ABC kit, Vector Laboratories, Burlingame, CA, USA) and the immunohistochemical stain was developed with 3,3′-diaminobenzidine. Slides were mounted with DePeX mounting medium (BDH, Poole, England) and photographed using an Olympus Provis AX70 microscope, coupled to an Olympus PD50 photography system. Image J software (Wayne Rasband, NIH, USA) was used to obtain the photographs and analyse the images.
Table 1
Antibodies for immunohistochemistry
Iba-1 | Rabbit | WAKO | 1:2000 |
GFAP (096) | Rabbit | DAKO | 1:2000 |
VCAM-1 (P3C4) | Mouse | Iowa Hybridoma Bank | 1:500 |
α-rabbit biotinylated | Goat | Jackson ImmunoResearch | 1:200 |
α-mouse biotinylated | Goat | Jackson ImmunoResearch | 1:200 |
Cell culture
Primary cultures of microglial cells were obtained from newborn (P0) to 2-day-old (P2) Wistar rat forebrains and grown in DMEM medium supplemented with 10% heat-inactivated FBS, 10% heat-inactivated horse serum, and P/S (DMEM 10:10:1) in 75-cm
2 flasks, coated with poly-L-lysine (10 μg/mL) [
22]. Briefly, after reaching confluence, cells were shaken at 230 rpm for 3 h at 37°C. Detached cells were centrifuged at 168×
g for 10 min. Cell pellets were resuspended in warm DMEM 10:10:1 and plated at a density of 200,000 cells/cm
2. For experiments, microglial cells were resuspended in RPMI 1640 medium supplemented with 10% FBS and P/S.
Primary cultures of astrocytes were obtained from newborn (P0) to 2-day-old (P2) Wistar rat cortices [
23]. The tissue homogenate was filtered through a 40-μm mesh (BD Falcon, Franklin Lakes, NJ, USA) and centrifuged at 950 rpm for 5 to 7 min. The pellet was plated and grown in DMEM supplemented with 10% FBS and P/S in 75-cm
2 flasks coated with poly-L-lysine (10 μg/mL). Media was changed every 3 to 4 days. After reaching confluence, cultures were shaken overnight at 280 rpm and 37°C in a shaker (Infors Minitron Botmingen, Switzerland). Detached cells were washed off with PBS and the remaining astrocyte monolayer was trypsinized and replated at a density of 30,000 cells/cm
2.
Nitrite production assays
Inducible nitric oxide synthase (iNOS) activity in cell cultures was assessed by measuring nitrite accumulation in the cell culture media [
24]. The optimal concentrations of LPS and IFN-γ used are shown in Additional file
2. We tested different
E. coli LPS isotypes (055:B5 and 026:B6) at different concentrations and the effect of the presence/absence of IFN-γ in the treatment, since we did not find a consensus for microglia cells and astrocyte in the literature. Our results show that only the 026:B6 LPS isotype stimulated a proinflammatory response in rat microglial cells
in vitro, whereas the 055:B5 isotype did not. The addition of IFN-γ did not increase this response. Therefore, we decided to use the 026:B6 isotype without IFN-γ for microglial treatment. However, astrocytes were stimulated with both LPS isotypes, but nitrite production was obtained only when we added LPS together with IFN-γ. To be consistent with both cell types we decided to perform the
in vitro experiments with the 026:B6 isotype, at the optimal concentration for nitric oxide production for each cell type.
Cells were pretreated with different concentrations of TUDCA for 90 to 120 min and were then treated with LPS from E. coli isotype 026:B6 (200 ng/mL for microglial cells) or LPS plus IFN-γ (1 μg/mL LPS plus 20 ng/mL IFN-γ, for astrocytes) for an additional 24 h in low serum media (2% FBS). Supernatants were mixed with modified Griess reagent (Sigma-Aldrich, Saint Louis, MO, USA) (v/v, 1:1), shaken, and absorbance was measured at λ492 in a Multiskan Ascent (Thermo Electron Co., Shanghai, China).
Nitrite production was related to viable cells measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. After removing the conditioned media for nitrite determination, MTT (Sigma-Aldrich, Saint Louis, MO, USA) dissolved in DMEM or RPMI medium without phenol-red was added to the treated cells (0.5 μg/mL). After 3 h incubation at 37°C, cell culture media was removed and 100 μL of dimethyl sulfoxide (Sigma-Aldrich, Saint Louis, MO, USA) was added to each well, shaken, and the absorbance was measured at λ595 in the same device. Experiments were performed in triplicate and the assay repeated at least six times with microglial cells and at least four times with astrocytes.
RNA purification and qPCR
Cell were pretreated with TUDCA (200 μM) for 2 h and were then treated with proinflammatory stimuli (200 ng/mL of LPS for microglial cells; 1 μg/mL LPS plus 10 ng/mL IFN-γ, for astrocytes) for 6 and 24 h. Gene and protein expression of untreated cells and untreated cells exposed to TUDCA were also determined. Total RNA for quantitative real-time PCR (qPCR) was isolated from cultured primary microglia cells and astrocytes with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), extracted, and reverse transcribed with RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania). Specific primers for different RNA messengers (mRNA) were obtained with Primer Express 3.0 software (Applied Biosystems, Warrington, UK) and the pair of primers with less secondary structures for all the mRNA were selected (for more information see Table
2), once analyzed by Gene Runner 3.05 software (Hastings Software Inc.). Quantitative PCR was developed in a 7500 Real Time PCR System (Applied Biosystems, Warrington, UK) with Power SYBR® Green (Applied Biosystems) reagent. Gene expression was determined with 7500 Software v2.0.4 and the passive reference gene was ROX. Results are presented as the ratio between transcriptional expression of the gene of interest and the transcriptional expression of a housekeeping gene as a loading control. We tested the transcriptional expression of several housekeeping genes (18S ribosomal RNA, 36B4 ribosomal protein, and β-actin). Although we did not see any major differences among them, we decided to use β-actin as a normalized control for astrocytes and 36B4 for microglial cells.
Table 2
Primers for quantitative PCR
iNOS | NM_012611.3 | acattgatctccgtgacagcc | cccttcaatggttggtacatg | 158 |
MCP-1 | NM_031530.1 | tgctgtctcagccagatgcagtta | tacagcttctttgggacacctgct | 131 |
β-actin | NM_031144.3 | tccgtaaagacctctatgc | atcttcatggtgctaggagc | 114 |
36B4 | NM_022402.2 | ttcccactggctgaaaaggt | cgcagccgcaaatgc | 59 |
Transient transfection experiments in glial cells with luciferase reporters
Microglial cells (300,000 cells/well) were seeded on 24-well plates coated with poly-L-lysine (50 μg/mL). After 24 h, cells were transfected using a transfection mixture, according to the manufacturer’s protocol, with a firefly luciferase reporter plasmid (1 μg/well), pSV40-Renilla luciferase plasmid (100 ng/well, Promega, Madison, WI, USA) as a control for transfection efficiency, and XtremeGENE HP DNA Transfection Reagent (1 μL/well, Roche, Indianapolis, IN, USA) in OPTIMEM. A rat iNOS-pGL3 firefly luciferase reporter plasmid containing a 720 bp fragment from the 5′ flanking region of the rat iNOS promoter [
25] and a NFκB-pGL3 firefly reporter plasmid [
26] containing a -241 to -54 base pair fragments of 5′ flanking region with the NFκB binding site from the human E-selectin promoter (Addgene plasmid #13029) were used. After 24 h of incubation, the transfection mixture was removed from the wells and cells were cultured overnight in culture media with low serum and treated with LPS (200 ng/mL) or TUDCA plus LPS for 6 h (for NFκB-pGL3 reporter) and 24 h (for iNOS-pGL3 reporter). After treatment, the media was removed from the wells and 100 μL/well of 1× Passive Lysis Buffer (Promega, Madison, WI, USA) was added. Culture plates were sealed with parafilm and stored at –80°C until luciferase activity determination.
Astrocytes (20,000 cells/well) were seeded on 96-well plates coated with poly-L-lysine (10 μg/mL). Cells were transfected by adding a firefly luciferase reporter plasmid (0.2 μg/well), a pSV40-Renilla luciferase plasmid (50 ng/well) as control for transfection efficiency, and XtremeGENE 9 DNA Transfection Reagent (0.4 μL/well, Roche) in OPTIMEM according to the manufacturer’s protocol. After 24 h of incubation, the transfection mixture was removed from the wells and the cells were cultured overnight in culture media with low serum and treated with LPS (1 μg/mL) and IFN-γ (10 ng/mL) or different concentrations of TUDCA with LPS plus and IFN-γ for 6 h (for ELAM-pGL3 reporter) and 24 h (for iNOS-pGL3 reporter). After treatment, the media was removed from the wells and 50 μL/well of 1× Passive Lysis Buffer was added. Culture plates were sealed with parafilm and stored at –80°C until luciferase determination. Laboratory-made dual-luciferase buffers were used. Firefly luciferase buffer (50 μL/sample of 30 mM Tricine, 0.1 mM EDTA pH 8, 15 mM magnesium sulfate, 10 mM DTT, 533.3 μM ATP, 0.4 mM D-Luciferin, and 0.27 mM Coenzyme A adjusted to pH 7.8) was mixed in a tube with the sample and luciferase activity was measured in a luminometer Sirius (Berthold). Renilla luciferase buffer (100 μL/sample of 0.22 M potassium phosphate pH 5.1, 1.1 M sodium chloride, 2.2 mM EDTA, 0.44 mg/mL BSA, 1.3 mM sodium azide, and 1.43 μM coelenterazine, adjusted to pH 5.0) was added to the same tube with the mix and the Renilla luciferase activity was measured again in the luminometer. Results are presented as the mean ± standard deviation (SD) of the fold induction related to the control of the ratio firefly luciferase activity/Renilla luciferase activity of at least three individual experiments in triplicate.
Western blotting
Cells were washed with ice cold PBS and lysed in a buffer containing 50 mM Tris-HCl (pH 7.6), 137 mM NaCl, 0.5 mM DTT, 1% Nonidet-P40, 0.2% sodium dodecyl sulphate (SDS), 0.5 μM Okadaic acid, and Phosphatase and Protease Inhibitor Cocktail Tablets (PhosSTOP and cOmplete Mini, Roche). Protein samples (100 μg for microglial lysates and 50 μg for astroglial lysates) were dissolved into 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and wet-transferred overnight at 4°C to a nitrocellulose membrane (Whatman, GmbH, Dassel, Germany). Membranes were blocked with 5% (w/v) dry skimmed milk or BSA in TBS with 0.1% Tween 20 (TTBS) for 1 h at room temperature and incubated overnight at 4°C with the corresponding primary antibody (for more information, see Table
3). After washing with TTBS and TBS, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature and the protein bands were detected using Supersignal west pico or west femto chemiluminescent substrate (Pierce, Rockford, IL, USA).
Table 3
Antibodies for Western blot
iNOS/NOS2 | Rabbit | BD Biosciences | 1:4000 | 130 |
α-Actinin | Mouse | BD Biosciences | 1:5000 | 105 |
p- NFκB p65 (Ser536) | Rabbit | Cell Signaling | 1:1000 | 65 |
NFκB p65 | Rabbit | Cell Signaling | 1:1000 | 65 |
p-PKR (Thr451) | Rabbit | Sigma-Aldrich | 1:500 | 65 |
GAPDH | Mouse | Millipore | 1:2000 | 36 |
p-eIF2α (Ser51) | Rabbit | Abcam | 1:500 | 36 |
α-rabbit-HRP conjugated | Goat | Jackson ImmunoResearch | 1:5000 | |
α-mouse-HRP conjugated | Goat | Jackson ImmunoResearch | 1:2000 | |
Image densitometry was performed with a Bio-Rad GS-810 scanner (BIO-RAD Labs, Richmond, CA, USA) and analyzed with Quantity One 4.2 software (BIO-RAD). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α-actinin expression were used as loading control for microglia and astrocyte samples, respectively.
Migration assays of microglial cells
Microglial cells were added on the upper part of a Transwell well (pore size 8-μm, Corning, San Dimas, CA, USA) in RPMI medium without FBS only or with TUDCA (200 μM or 100 μM) and IFN-γ (20 ng/mL) was used as chemoattractant and added to the lower well [
27,
28].
To study the influence of activated astrocytes on microglial cell migration, astrocytes were seeded on the wells. The next day, cells were preincubated with TUDCA (200 μM for 90 min) and then exposed to LPS (1 μg/mL) and IFN-γ (10 ng/mL) for 24 h. Supernatants were removed from the wells and astrocytes were washed twice with warm PBS. DMEM with 10% FBS was added to the astrocytes and incubated for an additional 24 h to obtain the conditioned media. After this period, Transwells were placed on the wells, microglial cells were seeded in the upper part of the Transwell and left for 24 h. Non-migrating cells were removed from the inserts with a cotton swab. Migrating microglial cells in the Transwells were fixed with 4% PFA for 15 min on ice, washed with PBS, and stained with Hoechst 33258 (1 μg/mL) for 5 min at room temperature. After washing with PBS, the number of attached cells in the lower part of the Transwells was determined by counting the Hoechst stained cells in photographs using an Olympus Provis AX70 microscope, coupled to an Olympus PD50 photography system. Each experiment was done in triplicate and photographs were obtained from five fields of each Transwell with a 20× microscope objective. Image J software was used to obtain the photographs and to analyse the images.
Microglia proliferation assays
Microglial cells (20,000 cells/well) were seeded on 96-well plates and left overnight in an incubator at 37°C. The next day, the cells were pretreated for 2 h with concentrations of TUDCA ranging from 4 to 500 μM, and LPS (10 ng/mL) in RPMI medium supplemented with 5% FBS was added to the wells. After 48 h of treatment, proliferation was determined with the MTT assay (Sigma-Aldrich), according to the manufacturer’s protocol.
Cytokine secretion assays
Astrocytes (500,000 cells/well) or microglial cells (2,000,000 cells/well) were seeded in 6-well plates and treated as previously described. After 6 or 24 h of treatment, supernatants were collected and processed according to the manufacturer’s instructions. Cytokines were measured using the commercial Quantibody® kit of Rat Cytokine Array 3 Glass Chip (Raybiotech Inc., Norcross, GA, USA).
Statistical analysis
GraphPad Prism software version 5.0 for Windows was used for statistical analysis. The variances of the treatments were compared with a one-way ANOVA and the statistical significance between two experimental groups was determined by Mann-Whitney U test. Data in graphs are presented as the mean ± SD.
Discussion
Although the neuroprotective effects of bile acids have already been previously described, little is known about the effect of TUDCA on the neuroinflammatory pathway in glial cells. We have demonstrated that microglial activation is reduced by TUDCA in an animal model of acute neuroinflammation by LPS icv injection (Figure
1a–f). However, we do not see this effect in astrocytes at day 1 and day 3 after icv of LPS (using GFAP as a marker for activated astrocytes, Figure
1g–l). We cannot be sure that there is no effect of TUDCA on astrocyte activation because we have not tested other time points after 3 days of LPS injection.
We tested whether there was a direct effect on glial cell activation of proinflammatory stimuli, on astrocytes and microglial cell cultures. Our
in vitro results showed that TUDCA pretreated cells decreased proinflammatory stimuli-induced nitrite production in astrocytes and microglial cells (Figure
2A and B). The production of nitric oxide in glial cells is mediated by the iNOS enzyme. We have demonstrated that the expression of iNOS enzyme is reduced at transcriptional (Figure
2C–F) and translational level (Figure
3C and D) by this bile conjugate after inflammatory stimulation in glial cells. The induction of iNOS expression is regulated by NFκB proinflammatory pathway [
25]. We have shown that the expression (e.g., MCP-1 and VCAM-1) and secretion (e.g., IFN-γ) of other NFκB target genes are reduced by TUDCA. The activation of NFκB pathway by proinflammatory stimuli is affected on TUDCA pretreated cells, reducing NFκB phosphorylation (Figure
3E and F) and the activation of the NFκB reporter (Figure
3A and B).
How is TUDCA affecting the NFκB pathway? Our results indicate that it is not affecting PKR phosphorylation in threonine 451 induced by proinflammatory stimuli. However, TUDCA reduces the phosphorylation in Serine 51 in the translation initiator factor eIF2α (Figure
3C and D), as well as in NFκB p65 phosphorylation. The processes affected by TUDCA in the proinflammatory pathway are downstream PKR phosphorylation and upstream of NFκB p65 and eIF2α phosphorylation. In previous work, Joo et al. [
19] showed that the microglial cell line BV-2, pretreated with a structurally similar bile salt to TUDCA, called UDCA, reduced nitrite production induced by β-amyloid. This effect was mediated through inhibition of IκB degradation that blocked NFκB activation. LPS-induced activation of NFκB is PKR dependent in alveolar macrophages [
29]. PKR can stimulate NFκB activity by interacting with the IkappaB kinase complex, independently of PKR kinase activity and PKR-induced phosphorylation of eIF2α through IKKβ interaction [
30]. TUDCA might inhibit PKR-IKKβ interaction or a process downstream that reduces NFκB phosphorylation. As TUDCA reduces eIF2α phosphorylation too, it might be a common process related to the phosphorylation of both proteins. As the translational repression induced by eIF2α phosphorylation is required for NFκB activation [
31], TUDCA might be targeting the phosphorylated status of eIF2α, activating serine phosphatases, and reducing phosphorylated eIF2α and NFκB.
The reduction of Iba-1 positive cells in the hippocampus of mice treated with TUDCA plus LPS (Figure
4) suggested that this effect could be due to a reduction in the microglial migratory capacity. To test this possibility, we studied the effect of TUDCA on IFN-γ-induced migration in microglial cell cultures (Figure
5A). TUDCA inhibited IFN-γ-induced migration of microglial cells to control levels. Moreover, TUDCA inhibited the migration of microglial cells induced by astrocytes activated by proinflammatory stimuli (Figure
5B). As the chemokine MCP-1 is an important regulator of microglial migration, we tested MCP-1 expression in glial cells. TUDCA reduced MCP-1 transcription induced by proinflammatory stimuli in microglial cells (Figure
5C) and astrocytes (Figure
5D).
As the expression of the VCAM-1 protein in the CNS endothelium is critically involved in blood monocyte transmigration into the neural parenchyma [
32], we studied the immunoreactivity for this protein in our animal model of acute neuroinflammation. TUDCA reduced LPS-induced VCAM-1 expression at day 1 and day 3 after LPS injection, compared to animals treated with LPS alone (Figure
6). This result suggests that TUDCA reduced endothelium activation by LPS and, as a consequence, might reduce blood monocyte migration into the CNS parenchyma.
Our results demonstrate that TUDCA reduced glial cell activation induced by proinflammatory stimuli at least by inhibiting NFκB activation. As TUDCA reduced NFκB activation induced by proinflammatory stimuli, it inhibited different key proteins involved in other NFκB regulated processes, such as microglial migration (e.g., MCP-1) and endothelium activation (e.g., VCAM-1), by proinflammatory stimuli required for blood leukocyte transmigration to the CNS parenchyma.
Conclusions
TUDCA is a neuroprotective agent in different animal models of stroke and neurological diseases. Nevertheless, little is known about the anti-inflammatory properties of TUDCA in the CNS. Our results suggest that TUDCA reduced glial cell activation induced by proinflammatory stimuli through inhibition of NFκB activity. TUDCA has a triple inhibitory effect on glial cells in the CNS parenchyma, inhibiting NFκB by i) reducing glial cell activation, ii) reducing microglial cell migratory capacity, and iii) reducing the expression of chemoattractants (e.g., MCP-1) and vascular adhesion proteins (e.g., VCAM-1) required for microglial migration and blood monocyte invasion of the CNS inflammation site. Our results suggest a novel TUDCA anti-inflammatory mechanism with therapeutic implications for inflammatory diseases of the CNS.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
NYC performed the experiments, participated in the interpretation of the data, performed the statistical analysis, and drafted the manuscript. MABM participated in some experiments and in the revision of the manuscript draft. MNS participated in the design of the study, interpretation of the data, and in the revision of the manuscript draft. LRR conceived and designed the study, participated in the interpretation of the data, performed some experiments, and drafted the manuscript. All authors read and approved the final manuscript.