Background
Chemokines are a family of small (8-14 kDa), inducible, structurally related proteins, which mediate chemotaxis of various cell types including neutrophils, monocytes, lymphocytes, basophils, eosinophils and fibroblasts to sites of inflammation [
1] and are implicated in many biological processes, such as migration of leukocytes, embryogenesis, angiogenesis, hematopoiesis etc [
2‐
5]. The biological activities of chemokines are mediated via chemokine receptors, which belong to a large family of rhodopsin-like G-protein-coupled, seven transmembrane domain receptors [
6,
7]. Chemokines and their receptors were divided into four families (CXC, CC, C, and CX3C) on the basis of cysteine residues in the ligands (here C represents cysteine and X/X3 represents one or three no-cysteine amino acids) [
1]. Recently, a system of nomenclature was introduced in which each ligand and receptor is identified by its subfamily with an identifying number [
8]. Thus, there exist CCR1-11, CXCR1-7, XCR1 (the lymphotactin receptor), and CX3CR1 (the fractalkine receptor) [
9].
In human and mouse, seven different CXC chemokine receptors denoted as CXCR1 to CXCR7 have so far been reported, and these CXC chemokine receptors have roles in chemotaxis of neutrophils, attraction of Th1 cells, or effector of T cell generation [
10]. Genomic structure and expression of five CXCRs including CXCR1, 2, 3, 4, 7 have been characterized either in model fish and/or in economically important fish species. For example, CXCR1 has been reported in several species of fish, such as common carp
Cyprinus carpio and mandarin fish
Siniperca chuatsi [
11,
12]; CXCR2 in common carp [
12]; CXCR3 in grass carp
Ctenopharyngodon idella [
13]; CXCR4 in sea lamprey
Petromyzon marinus, zebrafish
Danio rerio, common carp, rainbow trout
Oncorhynchus mykiss, sterlet
Acipenser ruthenus [
14‐
18], CXCR7 in zebrafish and medaka
Oryzias latipes [
19,
20]. In teleost fish, the literature on the function of CXC chemokine receptors is rather limited. It was only recently reported that two CXCR4 genes, CXCR4a and CXCR4b, isolated in zebrafish had roles in the development and migration of cranial neural crest cells [
21]. Similar to CXCR4, it was demonstrated that CXCR7, which was recently revealed to recognize the chemokine, stromal cell-derived factor-1 (SDF1) [
22], played an essential role in primordium migration [
23], and CXCR4 and CXCR7 are antagonistic in control of cell migration in the development of the posterior lateral line [
23].
CXCR5 was first reported from human Burkitt's lymphoma [
24], whereafter the murine homologue of CXCR5 was cloned and its expression was found in a pattern similar to human CXCR5 [
25]. In mammals, CXCR5 and its ligand CXCL13 are responsible for the organization of B cell follicles and the migration of B and T cells [
26,
27], and involved in other functions such as in the attraction of human metastatic neuroblastoma cells to the bone marrow [
28]. However, CXCR5 has not been identified in any species of fish so far. In this study, CXCR5 was cloned from the grass carp
C. idella, an important fish in aquaculture industry of China [
29]. Furthermore, its expression was examined in different organs/tissues, and in response to the stimulation of peptidoglycan (PGN), lipopolysaccharide (LPS), polyinosinic-polytidylic acid sodium salt (Poly I:C) and phytohaemagglutinin (PHA).
Discussion
CXCR5, also known as BLR1, has been identified as a member of the lymphocyte-specific GPCR family [
30]. The present study for the first time reported the cDNA and genomic sequences of CXCR5 and its expression pattern in a teleost fish, the grass carp. In general, the sequences of chemokine receptors have 25-80% aa identity. However, many other G-protein-coupled peptide receptors (GPCRs) also have around 25% aa identity with chemokine receptors, suggesting that the structural boundary is not very sharp. Although they lack a single structural signature, there are several features that together are found more frequently among chemokine receptors than in other types of GPCRs. These include a length of 340-370 aa, an acidic N-terminal segment, the sequence DRYLAIVHA or a variation of it in the second intracellular loop, a short basic third intracellular loop, and a cysteine in each of the four extracellular domains. In addition, chemokine receptors contain numerous serines and threonines in the C-terminal tail that become phosphorylated after receptor-ligand interaction [
8,
31]. The sequence of gcCXCR5 contains all these characters except for the length of amino acid sequences. The alignment of gcCXCR5 amino acid sequence with CXCR5 sequences from other vertebrates revealed some conserved structural features. The presence of N-linked glycosylation sites at N-terminus and/or in the second extracellular loop is a common feature of chemokine receptors, as recognized by other authors [
7,
13,
32], and all the CXCR5s including gcCXCR5 contain a conserved N-linked glycosylation sites at N terminus. Furthermore, the close phylogenetic relationship between gcCXCR5 and zebrafish CXCR5, and then other teleost fish CXCR5 may indicate their close evolutionary relationship. This, together with other CXCR members, i.e., CXCR3, CXCR4, CXCR5, CXCR6, which were clustered respectively into different clades, may reveal to some extent the conservation of these members in vertebrates, except that CXCR1 and CXCR2 were clustered in a same clade, as shown also by other reports [
22,
33], which may imply a similar evolutionary origin of these two receptors.
Similar to the genomic structures of CXCR5 in fugu (ENSTRUG00000011814), human (Gene ID 643), mouse (Gene ID 12145) and cow (Gene ID 497021), the gcCXCR5 consists of two exons and one intron. Compared with the size of mammalian CXCR5 genomic sequences, fish CXCR5 is much smaller in length. Despite the difference in genomic size, vertebrate CXCR5 have similar size in exons.
In mammals, much effort has been focused on identifying CXCR5 expression in different organs/tissues and also in cell types [
25,
30]. Murine homologue of CXCR5 has been described as being expressed in lymphoid organs, and murine CXCR5-specific RNA is detected consistently at low levels in secondary lymphatic organs. The CXCR5 gene is expressed regularly and strongly in lymphomas of mature B cells but not in plasmacytomas [
25,
30]. In the present study, constitutive expression of CXCR5 was observed abundantly in trunk kidney, spleen, head kidney, intestine, muscle and brain. In vivo, grass carp CXCR5 expression was up-regulated mainly in immune organs such as spleen, trunk kidney, head kidney and blood, suggesting the potential function of gcCXCR5 in immune response. The induced expression of gcCXCR5 in a wider range of organs/tissues containing lymphocytes was consistent with the function of mammalian CXCR5, as reported to attract T lymphocytes [
26,
27]. The immunostimulants used in the present study include PGN, LPS and Poly I:C, which are derived from Gram-positive bacteria, Gram-negative bacterial endotoxin and a synthetic double stranded RNA (dsRNA) mimicking viral dsRNA, respectively; and phytohaemagglutinin (PHA), known to cause leucocyte agglutination and to stimulate the proliferation of lymphocytes [
34]. The modulated difference of gcCXCR5 by different immunostimulants may be owing to the effect of different pattern recognition receptors (PRRs) which recognize different bacterial and/or viral elements on different cell types.
On the other hand, it is difficult to explain the down-regulation of gcCXCR5 expression in brain after PGN, LPS, Poly I:C and PHA stimulation. However, the higher expression of gcCXCR5 in brain was similar to gcCXCR3 which also had abundant expression in brain [
13]. Based on the observation in mammals that CXCR2, CXCR3 and CXCR4 were expressed in central nervous system by neurons and microglial cells etc [
31,
35‐
37], it is suggested that brain chemokine receptors may promote the recruitment of haematopoietic cells from circulation, both as part of normal surveillance and immunological control within the brain, and as a component of the inflammatory response [
38]. Whether this is the case for fish CXCR5 and other fish CXCRs requires further study.
In addition, CXCR5 may be modulated by other cytogenes. Krumbholz et al. [
39] reported that about 20% of CSFCD4
+ cells and almost all B cells expressed the CXCL13 receptor CXCR5. In vitro, CXCL13 was produced by monocytes and at a much higher level by macrophages. CXCL13 mRNA and protein expression was induced by TNF alpha and IL-1beta but inhibited by IL-4 and IFN gamma [
39]. However, it would be interesting to know if this is the case in fish.
Methods
Cloning of cDNA and genomic sequences
Based on the zebrafish and Tetraodon sequences of CXCR5 homologues from Ensembl website, one pair of degenerate primers F1 and R1 were designed to obtain the internal region of gcCXCR5. The PCR cycling conditions were 1 cycle of 94°C for 5 min, 35 cycles of 94°C for 30 s, 57°C for 30 s and 72°C for 30 s, followed by 1 cycle of 72°C for 10 min. The resultant product was isolated using the Gel Extraction Kit (Omega, USA), cloned into pMD18-T vector (TaKaRa, Japan) and transformed into Escherichia coli strain M15 competent cells by following the manufacturer's instruction. Putative clones were screened by PCR using the above primers under the same PCR cycle conditions, and the selected clones were sequenced. To obtain the full-length cDNA sequence of gcCXCR5, 5' RACE and 3' RACE were performed by using the gene-specific primers and adaptor primers. The universal primers mix (UPM) was the mixture of the long form (UPM Long) and short form (UPM Short).
For the first 3'-RACE, the PCR was initially performed with primers UPM/3-F1 followed by a nested PCR with primers UPM/3-F2. The annealing temperature of first and second PCR was 63°C and 65°C, respectively. For the second 3'-RACE, the PCR was performed with primers UPM/3-F3 followed by a nested PCR with primers UPM/3-F4. The annealing temperature of first and second PCR was 63°C and 66°C, respectively.
For 5'-RACE, first strand cDNA synthesis is primed using a gene-specific antisense primer (5-R1). Following cDNA synthesis, the first strand product is purified from unincorporated dNTPs and 5-R1. TdT (Terminal deoxynucleotidyl transferase) is used to add homopolymeric tails to the 3' ends of the cDNA. Tailed cDNA is then amplified by PCR using gene-specific antisense primer (5-R2) and 5' abridged anchor primer (AAP). The annealing temperature of PCR was 55°C. A dilution of the original PCR (0.1%) was re-amplified using a gene-specific antisense nested primer (5-R3) and abridged universal amplification primer (AUAP). The annealing temperature of PCR was 65°C. All primers are listed in Table
1.
Table 1
Oligonucleotide primers used to amplify the gcCXCR5 gene
F1 | ATCTACCTGCTA(G)CAC(T)CTGGC | Cloning for the internal fragment |
R1 | AGCAGC(G)TGC(G)AGCAGGTCG(T)C(T)T | |
UPM Long | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | Race-PCR Universal primers |
UPM Short | CTAATACGACTCACTATAGGGC | |
AAP | GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG | 5' RACE Abridged Primer |
AUAP | GGCCACGCGTCGACTAGTAC | |
5-R1 | GGTTCCAAAAAGCCA | 5'RACE 1st round PCR |
5-R2 | CTTGAGTAACTGCGAATGGAAA | 5'RACE 2nd round PCR |
5-R3 | GAGCAGGTCAGCCAGTGCCAGAT | 5'RACE 3rd round PCR |
3-F1 | GTTTTCTGCCTGTGCTGGCTACCG | 3'RACE 1st round PCR |
3-F2 | CCCTGGTAGTGTTGGGTGTTATGCC | 3'RACE 2nd round PCR |
3-F3 | CCGTTTCCGAAGAGACCTCCTGC | 3'RACE 1st round PCR |
3-F4 | GCCATTACTACCACAACAAGCAGC | 3'RACE 2nd round PCR |
D-F1 | TGGACGAGGACACACACTTCTGAG | For intron |
D-R1 | GCCGTTTTAGCAGGACTGTCAAGAG | |
β-actinF | CCTTCTTGGGTATGGAGTCTTGAGAGTATTTACGCTCAGGTGGG | Real-time quantitative PCR control |
β-actinR | | |
RT-F1 | GTGTTGGGTGTTATGCCTGAGATGTATTGGCTGCTTGTTGTG | Real-time quantitative PCR |
RT-R1 | | |
The genomic DNA was purified from trunk kidney of healthy grass carp using Wizard Genomic DNA Purification Kit (Promega). Based on the full-length cDNA sequence, D-F1 and D-R1 were designed to obtain the full-length genomic sequence of gcCXCR5. PCR was performed using the primer pairs listed in Table
1.
Sequence analysis
Protein prediction was performed using software at the ExPASy Molecular Biology Server
http://www.expasy.ch/. The putative ORFs were analyzed for the presence of signal peptides using the algorithms Signal P 3.0. The intron/exon structure of the identified genomic sequence was determined by alignment of the full-length cDNA to the genomic sequence using BLAST2
http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi. The transmembrane regions were identified by the Tmpred
http://www.cbs.dtu.dk/services/TMHMM/. Putative domains and the G-protein-coupled receptors family 1 signature were identified by PROSITE
http://ca.expasy.org/prosite. A multiple alignment was generated using the CLUSTAL W program. Sequence identities were calculated using the MEGALIGN program within DNASTAR. Phylogenetic analysis was performed using the neighbor-joining method within the Mega molecular evolutionary genetic analysis software package. Data were analyzed using Poisson correction, and gaps were removed by pairwise deletion. The degree of confidence for each branch point was determined by bootstrap analysis (1,000 times). All the sequences used for the phylogenetic analysis are listed in Table
2.
Table 2
The accession numbers of chemokine receptor sequences used for phylogenetic tree construction and multiple sequence alignment
Homo sapiens
| CXCR1 | NP_000625 |
Gallus gallus
| CXCR1 | NP_001026762 |
| CXCR2 | NM_001557 | | CXCR5 | NP_001026083 |
| CXCR3A | P49682 | | CXCR7 | NM_001083362 |
| CXCR3B | NP_001136269 |
Danio rerio
| CXCR3a | NP_001082899 |
| CXCR4 | NP_001008540 | | CXCR3b | NP_001007315 |
| CXCR5 | NP_001707 | | CXCR4 | NP_571909 |
| CXCR6 | NP_006555 | | CXCR5 | XP_002665447 |
| CXCR7 | NP_064707 | | CXCR7 | NM_001083832 |
Mus musculus
| CXCR1 | NP_839972 |
Cyprinus carpio
| CXCR1 | BAA31458 |
| CXCR2 | NM_009909 | | CXCR2 | BAA31470 |
| CXCR3 | NP_034040 | | CXCR4 | BAA32797 |
| CXCR4 | NP_034041 |
Ctenopharyngodon idella
| CXCR3 | AAW69766 |
| CXCR5 | NP_031577 | | CXCR5 | FJ825363 |
| CXCR6 | NP_109637 |
Oncorhynchus mykiss
| CXCR3 | CAC86390 |
| CXCR7 | NP_031748 | | CXCR4 | NP_001117814 |
Rattus norvegicus
| CXCR5 | NP_445755 |
Takifugu rubripes
| CXCR1 | NP_001072110 |
Tetraodon nigroviridis
| CXCR3 | CAF98051 | | CXCR5 | ENSTRUG00000011814 |
Petromyzon marinus
| CXCR4 | AAO21209 |
Gasterosteus aculeatus
| CXCR5 | ENSGACG00000012278 |
RNA extraction and cDNA synthesis for expression analysis
Grass carp, 200 to 300 g in body weight, were obtained in Niushan lake, Wuhan, Hubei Province, China. After seven-day acclimatization in a quarantine tank, heart, trunk kidney, brain, liver, head kidney, intestine, spleen, blood, gill and muscle from three grass carp were used for RNA isolation using Trizol reagent (Invitrogen, USA) in order to analyze the expression of gcCXCR5 in healthy grass carp.
To study the effect of different immunostimulants on the expression of gcCXCR5, four stimulants with different origins and different functions were chosen. Phytohaemagglutinin (PHA) is an extract from plant with roles in stimulating lymphocyte proliferation, lipopolysaccharide (LPS) and peptidoglycan (PGN) were derived from Gram- negative and positive bacteria, respectively, while Poly I:C mimics virus. Five groups of fish (three fish each) were injected with either 500 μl PBS, 500 μl PGN (1 mg/ml), 500 μl PHA (1 mg/ml), 500 μl Poly I:C (2 mg/ml), or 500 μl LPS (2 mg/ml). Twenty-four hours after injection, total RNA was extracted using TRIzol reagent (Gibco) as described by the manufacturer from organs/tissues of interest, including brain, spleen, gill, trunk kidney, liver, intestine, head kidney, thymus and blood from both injected and control groups.
After treatment with RNase-free DNase I, 2 μg of total RNA was reverse-transcribed respectively with Revert Aid TM First Strand cDNA Synthesis Kit (Fermentas). All cDNA samples were stored at -20°C until used in real-time PCR assays.
Real-time quantitative PCR
Primer premier 5.0 was used for designing forward and reverse primers. The primers which performed best in real-time PCR were: gcCXCR5 Forward (RT-F1), Reverse (RT-R1); β-actin Forward (β-actin F), Reverse (β-actin R) (Table
1). The annealing temperatures for gcCXCR5 and β-actin were 58°C, and resultant amplicons of both were 266 and 221 bp, respectively. The gcCXCR5 and β-actin cDNA fragments were generated by PCR. Amplicons were gel-purified, cloned into pMD18-T vector and transformed into
Escherichia coli strain DH5α competent cells. Cloned amplicon sequences were confirmed by sequencing. Plasmid DNA was obtained by using the Plasmid mini kit I (Omega) by following the manufacturer's instructions. Serial tenfold dilutions of plasmid DNA were used in PCR for establishing a standard curve. PCR reactions were performed using Chromo 4™ Continuous Fluorescence Detector from MJ Research. Amplifications were carried out at a final volume of 20 μl containing 1 μl DNA sample, 10 μl 2 × SYBR green Real time PCR Master Mix (Toyobo, Japan), 2 μl of each primer and 5 μl H
2O. PCR amplification consisted of 5 min at 95°C, followed by 45 cycles consisting of 10 s at 94°C, 15 s at 58°C, 20 s at 72°C and plate-reading at 80°C. The reaction carried out without DNA sample was used as control. Melting curve analysis of amplification products was performed at the end of each PCR reaction to confirm that a single PCR product was detected. Each sample was run in triplicate. Standard curves were run on the same plate.
Statistical analysis was performed using a one-way analysis of variance (ANOVA). A probability level of
P < 0.05 was considered significant. Fold change was calculated as (Ts/Tn)/(Cs/Cn) where Ts equals the treated sample assayed for the specific gene and Tn equals the treated sample assayed for β-actin gene, and Cs and Cn equal the calibrator group with the specific and normalizing gene, respectively [
40]. All statistical analyses were based on comparisons between the control and injection groups.
Authors' contributions
XQQ carried out the experiments and drafted the manuscript. CMX participated in the study design and in the manuscript preparation. SRH cloned partial sequence. XFS was involved in the experiment. NP was responsible for overall project and finalized the manuscript. All authors read and approved the final manuscript.