Skip to main content
Erschienen in: BMC Immunology 1/2010

Open Access 01.12.2010 | Research article

The first non-mammalian CXCR5 in a teleost fish: molecular cloning and expression analysis in grass carp (Ctenopharyngodon idella)

verfasst von: Qiao Q Xu, Ming X Chang, Rong H Sun, Fan S Xiao, P Nie

Erschienen in: BMC Immunology | Ausgabe 1/2010

Abstract

Background

Chemokines, a group of small and structurally related proteins, mediate chemotaxis of various cell types via chemokine receptors. In mammals, seven different CXC chemokine receptors denoted as CXCR1 to CXCR7 have been reported. However, the chemokine receptor CXCR5 has not been reported in other vertebrates.

Results

In the present study, the genomic sequence of CXCR5 was isolated from the grass carp Ctenopharyngodon idella. The cDNA sequence of grass carp CXCR5 (gcCXCR5) consists of 1518 bp with a 43 bp 5' untranslated region (UTR) and a 332 bp 3' UTR, with an open reading frame of 1143 bp encoding 381 amino acids which are predicted to have seven transmembrane helices. The characteristic residues (DRYLAIVHA) and conserved cysteine residues are located in the extracellular regions and in the third to seventh transmembrane domains. The deduced amino acid sequence shows 37.6-66.6% identities with CXCR5 of mammals, avian and other fish species. The grass carp gene consists of two exons, with one intervening intron, spaced over 2081 bp of genomic sequence. Phylogenetic analysis clearly demonstrated that the gcCXCR5 is clustered with those in other teleost fish and then in chicken and mammals. Real-time PCR analysis showed that gcCXCR5 was expressed in all tested organs/tissues and its expression level was the highest in trunk kidney, followed by in the spleen. The expression of gcCXCR5 was significantly modulated by immunostimulants such as peptidoglycan (PGN), lipopolysaccharide (LPS), polyinosinic-polycytidylic acid sodium salt (Poly I:C) and phytohaemagglutinin (PHA).

Conclusion

The cDNA and genomic sequences of CXCR5 have been successfully characterized in a teleost fish, the grass carp. The CXCR5 has in general a constitutive expression in organs/tissues examined, whereas its expression was significantly up-regulated in immune organs and down-regulated in brain, indicating its potential role in immune response and central nervous system.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1471-2172-11-25) contains supplementary material, which is available to authorized users.

Authors' contributions

XQQ carried out the experiments and drafted the manuscript. CMX participated in the study design and in the manuscript preparation. SRH cloned partial sequence. XFS was involved in the experiment. NP was responsible for overall project and finalized the manuscript. All authors read and approved the final manuscript.

Background

Chemokines are a family of small (8-14 kDa), inducible, structurally related proteins, which mediate chemotaxis of various cell types including neutrophils, monocytes, lymphocytes, basophils, eosinophils and fibroblasts to sites of inflammation [1] and are implicated in many biological processes, such as migration of leukocytes, embryogenesis, angiogenesis, hematopoiesis etc [25]. The biological activities of chemokines are mediated via chemokine receptors, which belong to a large family of rhodopsin-like G-protein-coupled, seven transmembrane domain receptors [6, 7]. Chemokines and their receptors were divided into four families (CXC, CC, C, and CX3C) on the basis of cysteine residues in the ligands (here C represents cysteine and X/X3 represents one or three no-cysteine amino acids) [1]. Recently, a system of nomenclature was introduced in which each ligand and receptor is identified by its subfamily with an identifying number [8]. Thus, there exist CCR1-11, CXCR1-7, XCR1 (the lymphotactin receptor), and CX3CR1 (the fractalkine receptor) [9].
In human and mouse, seven different CXC chemokine receptors denoted as CXCR1 to CXCR7 have so far been reported, and these CXC chemokine receptors have roles in chemotaxis of neutrophils, attraction of Th1 cells, or effector of T cell generation [10]. Genomic structure and expression of five CXCRs including CXCR1, 2, 3, 4, 7 have been characterized either in model fish and/or in economically important fish species. For example, CXCR1 has been reported in several species of fish, such as common carp Cyprinus carpio and mandarin fish Siniperca chuatsi [11, 12]; CXCR2 in common carp [12]; CXCR3 in grass carp Ctenopharyngodon idella [13]; CXCR4 in sea lamprey Petromyzon marinus, zebrafish Danio rerio, common carp, rainbow trout Oncorhynchus mykiss, sterlet Acipenser ruthenus [1418], CXCR7 in zebrafish and medaka Oryzias latipes [19, 20]. In teleost fish, the literature on the function of CXC chemokine receptors is rather limited. It was only recently reported that two CXCR4 genes, CXCR4a and CXCR4b, isolated in zebrafish had roles in the development and migration of cranial neural crest cells [21]. Similar to CXCR4, it was demonstrated that CXCR7, which was recently revealed to recognize the chemokine, stromal cell-derived factor-1 (SDF1) [22], played an essential role in primordium migration [23], and CXCR4 and CXCR7 are antagonistic in control of cell migration in the development of the posterior lateral line [23].
CXCR5 was first reported from human Burkitt's lymphoma [24], whereafter the murine homologue of CXCR5 was cloned and its expression was found in a pattern similar to human CXCR5 [25]. In mammals, CXCR5 and its ligand CXCL13 are responsible for the organization of B cell follicles and the migration of B and T cells [26, 27], and involved in other functions such as in the attraction of human metastatic neuroblastoma cells to the bone marrow [28]. However, CXCR5 has not been identified in any species of fish so far. In this study, CXCR5 was cloned from the grass carp C. idella, an important fish in aquaculture industry of China [29]. Furthermore, its expression was examined in different organs/tissues, and in response to the stimulation of peptidoglycan (PGN), lipopolysaccharide (LPS), polyinosinic-polytidylic acid sodium salt (Poly I:C) and phytohaemagglutinin (PHA).

Results

Cloning and characterization of grass carp CXCR5 cDNA

The grass carp CXCR5 (gcCXCR5) cDNA (GenBank accession no. FJ825363) consists of 1648 bp with a 43 bp 5' untranslated region (UTR) and a 332 bp 3'-UTR with poly(A) addition signal (AATAAA) and two mRNA instability motifs (ATTTA). The open reading frame of gcCXCR5 cDNA encodes 381 amino acids with a calculated molecular mass of 43.34 kDa and an isoelectric point of 8.40. Analysis of the putative amino acid sequence by TMpred program suggests that gcCXCR5 is a membrane protein with seven transmembrane helices between amino acids 65-87, 99-121, 136-155, 176-198, 230-252, 272-294 and 314-336 (Figure 1). The extracellular regions of the gcCXCR5 contain four cysteines, presumably forming disulfide bonds. In the transmembrane regions TM3-TM7 existed respectively two other cysteine residues. Moreover, there are two cysteine intracellular regions at the carbon terminal. Analysis using Signal P-N program showed that gcCXCR5 has no signal peptide, but has a potential N-glycosylation sites at N34. Using the Scanprosite programs in PROSITE database http://​ca.​expasy.​org/​prosite, a sequence CGSLLLACISVDRYLAI (145-161 amino acids) containing the G-protein-coupled receptor family 1 signature was identified. It was also revealed that the gcCXCR5 sequence contains cAMP- and cGMP- dependent protein kinase phosphorylation sites (at amino acids 85-88), tyrosine kinase phosphorylation site (at amino acids 206-214), N-myristoylation sites (at amino acids 72-82, 125-130 and 215-220), protein kinase C phosphorylation sites (at amino acids 13-15, 224-226 and 255-257), and casein kinase II phosphorylation sites (at amino acids 7-10, 30-33 and 367-370) (Figure 1).
The deduced amino acid sequence of the gcCXCR5 protein was compared with other chemokine receptors by calculating the sequence identities using the MEGALIGN program. The full-length amino acid sequence of gcCXCR5 has the highest identities with zebrafish CXCR5 (66.6%), followed by stickleback CXCR5 (53.5%) and fugu CXCR5 (51.6%). The identifies of gcCXCR5 with CXCR5 from human, mouse, rat and chicken are 38.8%, 37.8%, 37.6% and 37.6%, respectively. The identity between gcCXCR5 and other reported chemokine receptors, CXCR1, CXCR2, CXCR3, CXCR4, CXCR6 and CXCR7, ranges among 27.3-33.2%, 31.2-34.0%, 35.0-43.5%, 27.8-30.4%, 26.4-28.0%, and 36.5-37.1%, respectively. In the phylogenetic tree based on amino-acid sequences from four CXCR1, three CXCR2, eight CXCR3, six CXCR4, seven CXCR5, two CXCR6 and four CXCR7 sequences, the gcCXCR5 was clustered closely (bootstrap value > 99%) with CXCR5 in other fish species, and then with other CXCR5 in higher vertebrates (Figure 2), and all other CXCRs with same identified number were clustered into a same clade, except that CXCR1 and CXCR2 were clustered together.

Characterization of gcCXCR5 genomic DNA

The gcCXCR5 gene has a length of 2081 bp (GenBank accession no. FJ825364). Using BLAST2, the alignment of gcCXCR5 cDNA sequence with gcCXCR5 genomic sequence revealed that the gcCXCR5 gene is composed of two exons and one intron. The first exon is 109 bp in length, containing a short 5'-UTR and ORF of 23 amino acids (Figure 3). The second exon is 1384 bp in length, coding for the all seven transmembrane domains of gcCXCR5. The intervening intron is 588 bp. The exon-intron junction follows the consensus rule of the splice donor and acceptor sites for splicing (Figures 1 and 3).

Expression of gcCXCR5

In normal fish, the expression of gcCXCR5 was observed in all the organs/tissues examined, with strong expression in trunk kidney, spleen, intestine, head kidney, brain, muscle, but almost undetectable expression in liver and heart (Figure 4).
As shown in Figure 5, PGN injection significantly induced gcCXCR5 expression in spleen, thymus and trunk kidney, decreased expression in brain, gill, liver and blood (P < 0.05), but no significant difference in other organs/tissues (P > 0.05). LPS stimulation significantly increased gcCXCR5 expression in spleen, trunk kidney, blood, intestine and head kidney (P < 0.05), but decreased expression in brain (P < 0.05), with no significant difference in other organs/tissues (P > 0.05). The induced expression of gcCXCR5 by Poly I:C was observed in trunk kidney, head kidney and gill (P < 0.05), decreased expression in brain and blood (P < 0.05). PHA significantly induced gcCXCR5 in most organs/tissues (P < 0.05) except brain and liver. The decreased expression of gcCXCR5 by PHA was observed in brain (P < 0.05).

Discussion

CXCR5, also known as BLR1, has been identified as a member of the lymphocyte-specific GPCR family [30]. The present study for the first time reported the cDNA and genomic sequences of CXCR5 and its expression pattern in a teleost fish, the grass carp. In general, the sequences of chemokine receptors have 25-80% aa identity. However, many other G-protein-coupled peptide receptors (GPCRs) also have around 25% aa identity with chemokine receptors, suggesting that the structural boundary is not very sharp. Although they lack a single structural signature, there are several features that together are found more frequently among chemokine receptors than in other types of GPCRs. These include a length of 340-370 aa, an acidic N-terminal segment, the sequence DRYLAIVHA or a variation of it in the second intracellular loop, a short basic third intracellular loop, and a cysteine in each of the four extracellular domains. In addition, chemokine receptors contain numerous serines and threonines in the C-terminal tail that become phosphorylated after receptor-ligand interaction [8, 31]. The sequence of gcCXCR5 contains all these characters except for the length of amino acid sequences. The alignment of gcCXCR5 amino acid sequence with CXCR5 sequences from other vertebrates revealed some conserved structural features. The presence of N-linked glycosylation sites at N-terminus and/or in the second extracellular loop is a common feature of chemokine receptors, as recognized by other authors [7, 13, 32], and all the CXCR5s including gcCXCR5 contain a conserved N-linked glycosylation sites at N terminus. Furthermore, the close phylogenetic relationship between gcCXCR5 and zebrafish CXCR5, and then other teleost fish CXCR5 may indicate their close evolutionary relationship. This, together with other CXCR members, i.e., CXCR3, CXCR4, CXCR5, CXCR6, which were clustered respectively into different clades, may reveal to some extent the conservation of these members in vertebrates, except that CXCR1 and CXCR2 were clustered in a same clade, as shown also by other reports [22, 33], which may imply a similar evolutionary origin of these two receptors.
Similar to the genomic structures of CXCR5 in fugu (ENSTRUG00000011814), human (Gene ID 643), mouse (Gene ID 12145) and cow (Gene ID 497021), the gcCXCR5 consists of two exons and one intron. Compared with the size of mammalian CXCR5 genomic sequences, fish CXCR5 is much smaller in length. Despite the difference in genomic size, vertebrate CXCR5 have similar size in exons.
In mammals, much effort has been focused on identifying CXCR5 expression in different organs/tissues and also in cell types [25, 30]. Murine homologue of CXCR5 has been described as being expressed in lymphoid organs, and murine CXCR5-specific RNA is detected consistently at low levels in secondary lymphatic organs. The CXCR5 gene is expressed regularly and strongly in lymphomas of mature B cells but not in plasmacytomas [25, 30]. In the present study, constitutive expression of CXCR5 was observed abundantly in trunk kidney, spleen, head kidney, intestine, muscle and brain. In vivo, grass carp CXCR5 expression was up-regulated mainly in immune organs such as spleen, trunk kidney, head kidney and blood, suggesting the potential function of gcCXCR5 in immune response. The induced expression of gcCXCR5 in a wider range of organs/tissues containing lymphocytes was consistent with the function of mammalian CXCR5, as reported to attract T lymphocytes [26, 27]. The immunostimulants used in the present study include PGN, LPS and Poly I:C, which are derived from Gram-positive bacteria, Gram-negative bacterial endotoxin and a synthetic double stranded RNA (dsRNA) mimicking viral dsRNA, respectively; and phytohaemagglutinin (PHA), known to cause leucocyte agglutination and to stimulate the proliferation of lymphocytes [34]. The modulated difference of gcCXCR5 by different immunostimulants may be owing to the effect of different pattern recognition receptors (PRRs) which recognize different bacterial and/or viral elements on different cell types.
On the other hand, it is difficult to explain the down-regulation of gcCXCR5 expression in brain after PGN, LPS, Poly I:C and PHA stimulation. However, the higher expression of gcCXCR5 in brain was similar to gcCXCR3 which also had abundant expression in brain [13]. Based on the observation in mammals that CXCR2, CXCR3 and CXCR4 were expressed in central nervous system by neurons and microglial cells etc [31, 3537], it is suggested that brain chemokine receptors may promote the recruitment of haematopoietic cells from circulation, both as part of normal surveillance and immunological control within the brain, and as a component of the inflammatory response [38]. Whether this is the case for fish CXCR5 and other fish CXCRs requires further study.
In addition, CXCR5 may be modulated by other cytogenes. Krumbholz et al. [39] reported that about 20% of CSFCD4+ cells and almost all B cells expressed the CXCL13 receptor CXCR5. In vitro, CXCL13 was produced by monocytes and at a much higher level by macrophages. CXCL13 mRNA and protein expression was induced by TNF alpha and IL-1beta but inhibited by IL-4 and IFN gamma [39]. However, it would be interesting to know if this is the case in fish.

Conclusions

In summary, gcCXCR5 consists of 1518 bp, encoding 381 amino acids which are predicted to have seven transmembrane helices. The characteristic residues (DRYLAIVHA) and conserved cysteine residues are located predominantly in the extracellular regions and in the third to seventh transmembrane domains. The gcCXCR5 was expressed in all tested organs/tissues. The expression of gcCXCR5 was significantly modulated by peptidoglycan, lipopolysaccharide, polyinosinic-polycytidylic acid sodium salt and phytohaemagglutinin.

Methods

Cloning of cDNA and genomic sequences

Based on the zebrafish and Tetraodon sequences of CXCR5 homologues from Ensembl website, one pair of degenerate primers F1 and R1 were designed to obtain the internal region of gcCXCR5. The PCR cycling conditions were 1 cycle of 94°C for 5 min, 35 cycles of 94°C for 30 s, 57°C for 30 s and 72°C for 30 s, followed by 1 cycle of 72°C for 10 min. The resultant product was isolated using the Gel Extraction Kit (Omega, USA), cloned into pMD18-T vector (TaKaRa, Japan) and transformed into Escherichia coli strain M15 competent cells by following the manufacturer's instruction. Putative clones were screened by PCR using the above primers under the same PCR cycle conditions, and the selected clones were sequenced. To obtain the full-length cDNA sequence of gcCXCR5, 5' RACE and 3' RACE were performed by using the gene-specific primers and adaptor primers. The universal primers mix (UPM) was the mixture of the long form (UPM Long) and short form (UPM Short).
For the first 3'-RACE, the PCR was initially performed with primers UPM/3-F1 followed by a nested PCR with primers UPM/3-F2. The annealing temperature of first and second PCR was 63°C and 65°C, respectively. For the second 3'-RACE, the PCR was performed with primers UPM/3-F3 followed by a nested PCR with primers UPM/3-F4. The annealing temperature of first and second PCR was 63°C and 66°C, respectively.
For 5'-RACE, first strand cDNA synthesis is primed using a gene-specific antisense primer (5-R1). Following cDNA synthesis, the first strand product is purified from unincorporated dNTPs and 5-R1. TdT (Terminal deoxynucleotidyl transferase) is used to add homopolymeric tails to the 3' ends of the cDNA. Tailed cDNA is then amplified by PCR using gene-specific antisense primer (5-R2) and 5' abridged anchor primer (AAP). The annealing temperature of PCR was 55°C. A dilution of the original PCR (0.1%) was re-amplified using a gene-specific antisense nested primer (5-R3) and abridged universal amplification primer (AUAP). The annealing temperature of PCR was 65°C. All primers are listed in Table 1.
Table 1
Oligonucleotide primers used to amplify the gcCXCR5 gene
Name
Sequence (5'-3')
Usage
F1
ATCTACCTGCTA(G)CAC(T)CTGGC
Cloning for the internal fragment
R1
AGCAGC(G)TGC(G)AGCAGGTCG(T)C(T)T
 
UPM Long
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
Race-PCR Universal primers
UPM Short
CTAATACGACTCACTATAGGGC
 
AAP
GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG
5' RACE Abridged Primer
AUAP
GGCCACGCGTCGACTAGTAC
 
5-R1
GGTTCCAAAAAGCCA
5'RACE 1st round PCR
5-R2
CTTGAGTAACTGCGAATGGAAA
5'RACE 2nd round PCR
5-R3
GAGCAGGTCAGCCAGTGCCAGAT
5'RACE 3rd round PCR
3-F1
GTTTTCTGCCTGTGCTGGCTACCG
3'RACE 1st round PCR
3-F2
CCCTGGTAGTGTTGGGTGTTATGCC
3'RACE 2nd round PCR
3-F3
CCGTTTCCGAAGAGACCTCCTGC
3'RACE 1st round PCR
3-F4
GCCATTACTACCACAACAAGCAGC
3'RACE 2nd round PCR
D-F1
TGGACGAGGACACACACTTCTGAG
For intron
D-R1
GCCGTTTTAGCAGGACTGTCAAGAG
 
β-actinF
CCTTCTTGGGTATGGAGTCTTGAGAGTATTTACGCTCAGGTGGG
Real-time quantitative PCR control
β-actinR
  
RT-F1
GTGTTGGGTGTTATGCCTGAGATGTATTGGCTGCTTGTTGTG
Real-time quantitative PCR
RT-R1
  
The genomic DNA was purified from trunk kidney of healthy grass carp using Wizard Genomic DNA Purification Kit (Promega). Based on the full-length cDNA sequence, D-F1 and D-R1 were designed to obtain the full-length genomic sequence of gcCXCR5. PCR was performed using the primer pairs listed in Table 1.

Sequence analysis

Protein prediction was performed using software at the ExPASy Molecular Biology Server http://​www.​expasy.​ch/​. The putative ORFs were analyzed for the presence of signal peptides using the algorithms Signal P 3.0. The intron/exon structure of the identified genomic sequence was determined by alignment of the full-length cDNA to the genomic sequence using BLAST2 http://​www.​ncbi.​nlm.​nih.​gov/​blast/​bl2seq/​wblast2.​cgi. The transmembrane regions were identified by the Tmpred http://​www.​cbs.​dtu.​dk/​services/​TMHMM/​. Putative domains and the G-protein-coupled receptors family 1 signature were identified by PROSITE http://​ca.​expasy.​org/​prosite. A multiple alignment was generated using the CLUSTAL W program. Sequence identities were calculated using the MEGALIGN program within DNASTAR. Phylogenetic analysis was performed using the neighbor-joining method within the Mega molecular evolutionary genetic analysis software package. Data were analyzed using Poisson correction, and gaps were removed by pairwise deletion. The degree of confidence for each branch point was determined by bootstrap analysis (1,000 times). All the sequences used for the phylogenetic analysis are listed in Table 2.
Table 2
The accession numbers of chemokine receptor sequences used for phylogenetic tree construction and multiple sequence alignment
Species
Gene
Accession no.
Species
Gene
Accession no.
Homo sapiens
CXCR1
NP_000625
Gallus gallus
CXCR1
NP_001026762
 
CXCR2
NM_001557
 
CXCR5
NP_001026083
 
CXCR3A
P49682
 
CXCR7
NM_001083362
 
CXCR3B
NP_001136269
Danio rerio
CXCR3a
NP_001082899
 
CXCR4
NP_001008540
 
CXCR3b
NP_001007315
 
CXCR5
NP_001707
 
CXCR4
NP_571909
 
CXCR6
NP_006555
 
CXCR5
XP_002665447
 
CXCR7
NP_064707
 
CXCR7
NM_001083832
Mus musculus
CXCR1
NP_839972
Cyprinus carpio
CXCR1
BAA31458
 
CXCR2
NM_009909
 
CXCR2
BAA31470
 
CXCR3
NP_034040
 
CXCR4
BAA32797
 
CXCR4
NP_034041
Ctenopharyngodon idella
CXCR3
AAW69766
 
CXCR5
NP_031577
 
CXCR5
FJ825363
 
CXCR6
NP_109637
Oncorhynchus mykiss
CXCR3
CAC86390
 
CXCR7
NP_031748
 
CXCR4
NP_001117814
Rattus norvegicus
CXCR5
NP_445755
Takifugu rubripes
CXCR1
NP_001072110
Tetraodon nigroviridis
CXCR3
CAF98051
 
CXCR5
ENSTRUG00000011814
Petromyzon marinus
CXCR4
AAO21209
Gasterosteus aculeatus
CXCR5
ENSGACG00000012278

RNA extraction and cDNA synthesis for expression analysis

Grass carp, 200 to 300 g in body weight, were obtained in Niushan lake, Wuhan, Hubei Province, China. After seven-day acclimatization in a quarantine tank, heart, trunk kidney, brain, liver, head kidney, intestine, spleen, blood, gill and muscle from three grass carp were used for RNA isolation using Trizol reagent (Invitrogen, USA) in order to analyze the expression of gcCXCR5 in healthy grass carp.
To study the effect of different immunostimulants on the expression of gcCXCR5, four stimulants with different origins and different functions were chosen. Phytohaemagglutinin (PHA) is an extract from plant with roles in stimulating lymphocyte proliferation, lipopolysaccharide (LPS) and peptidoglycan (PGN) were derived from Gram- negative and positive bacteria, respectively, while Poly I:C mimics virus. Five groups of fish (three fish each) were injected with either 500 μl PBS, 500 μl PGN (1 mg/ml), 500 μl PHA (1 mg/ml), 500 μl Poly I:C (2 mg/ml), or 500 μl LPS (2 mg/ml). Twenty-four hours after injection, total RNA was extracted using TRIzol reagent (Gibco) as described by the manufacturer from organs/tissues of interest, including brain, spleen, gill, trunk kidney, liver, intestine, head kidney, thymus and blood from both injected and control groups.
After treatment with RNase-free DNase I, 2 μg of total RNA was reverse-transcribed respectively with Revert Aid TM First Strand cDNA Synthesis Kit (Fermentas). All cDNA samples were stored at -20°C until used in real-time PCR assays.

Real-time quantitative PCR

Primer premier 5.0 was used for designing forward and reverse primers. The primers which performed best in real-time PCR were: gcCXCR5 Forward (RT-F1), Reverse (RT-R1); β-actin Forward (β-actin F), Reverse (β-actin R) (Table 1). The annealing temperatures for gcCXCR5 and β-actin were 58°C, and resultant amplicons of both were 266 and 221 bp, respectively. The gcCXCR5 and β-actin cDNA fragments were generated by PCR. Amplicons were gel-purified, cloned into pMD18-T vector and transformed into Escherichia coli strain DH5α competent cells. Cloned amplicon sequences were confirmed by sequencing. Plasmid DNA was obtained by using the Plasmid mini kit I (Omega) by following the manufacturer's instructions. Serial tenfold dilutions of plasmid DNA were used in PCR for establishing a standard curve. PCR reactions were performed using Chromo 4™ Continuous Fluorescence Detector from MJ Research. Amplifications were carried out at a final volume of 20 μl containing 1 μl DNA sample, 10 μl 2 × SYBR green Real time PCR Master Mix (Toyobo, Japan), 2 μl of each primer and 5 μl H2O. PCR amplification consisted of 5 min at 95°C, followed by 45 cycles consisting of 10 s at 94°C, 15 s at 58°C, 20 s at 72°C and plate-reading at 80°C. The reaction carried out without DNA sample was used as control. Melting curve analysis of amplification products was performed at the end of each PCR reaction to confirm that a single PCR product was detected. Each sample was run in triplicate. Standard curves were run on the same plate.
Statistical analysis was performed using a one-way analysis of variance (ANOVA). A probability level of P < 0.05 was considered significant. Fold change was calculated as (Ts/Tn)/(Cs/Cn) where Ts equals the treated sample assayed for the specific gene and Tn equals the treated sample assayed for β-actin gene, and Cs and Cn equal the calibrator group with the specific and normalizing gene, respectively [40]. All statistical analyses were based on comparisons between the control and injection groups.

Acknowledgements

The research was financially supported by a project (2009CB118703) of National Basic Research Program of China (973 Program).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Authors' contributions

XQQ carried out the experiments and drafted the manuscript. CMX participated in the study design and in the manuscript preparation. SRH cloned partial sequence. XFS was involved in the experiment. NP was responsible for overall project and finalized the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Zlotnik A, Yoshie O: Chemokines: a new classification system and their role in immunity. Immunity. 2000, 12: 121-127. 10.1016/S1074-7613(00)80165-X.CrossRefPubMed Zlotnik A, Yoshie O: Chemokines: a new classification system and their role in immunity. Immunity. 2000, 12: 121-127. 10.1016/S1074-7613(00)80165-X.CrossRefPubMed
2.
3.
Zurück zum Zitat Kanbe K, Shimizu N, Soda Y, Takagishi K, Hoshino H: A CXC chemokine receptor, CXCR5/BLR1, is a novel and specific coreceptor for human immunodeficiency virus type 2. Virology. 1999, 265: 264-273. 10.1006/viro.1999.0036.CrossRefPubMed Kanbe K, Shimizu N, Soda Y, Takagishi K, Hoshino H: A CXC chemokine receptor, CXCR5/BLR1, is a novel and specific coreceptor for human immunodeficiency virus type 2. Virology. 1999, 265: 264-273. 10.1006/viro.1999.0036.CrossRefPubMed
4.
Zurück zum Zitat Luster AD: Chemokines-chemotactic cytokines that mediate inflammation. N Engl J Med. 1998, 338: 436-445. 10.1056/NEJM199802123380706.CrossRefPubMed Luster AD: Chemokines-chemotactic cytokines that mediate inflammation. N Engl J Med. 1998, 338: 436-445. 10.1056/NEJM199802123380706.CrossRefPubMed
5.
Zurück zum Zitat Struyf S, Proost P, Van Damme J: Regulation of the immune response by the interaction of chemokines and proteases. Adv Immunol. 2003, 81: 1-44. full_text.CrossRefPubMed Struyf S, Proost P, Van Damme J: Regulation of the immune response by the interaction of chemokines and proteases. Adv Immunol. 2003, 81: 1-44. full_text.CrossRefPubMed
6.
Zurück zum Zitat Murphy PM: The molecular biology of leukocyte chemoattractant receptors. Annu Rev Immunol. 1994, 12: 593-633. 10.1146/annurev.iy.12.040194.003113.CrossRefPubMed Murphy PM: The molecular biology of leukocyte chemoattractant receptors. Annu Rev Immunol. 1994, 12: 593-633. 10.1146/annurev.iy.12.040194.003113.CrossRefPubMed
7.
Zurück zum Zitat Murphy PM: Chemokine receptors: structure, function and role in microbial pathogenesis. Cytokine Growth Factor Rev. 1996, 7: 47-64. 10.1016/1359-6101(96)00009-3.CrossRefPubMed Murphy PM: Chemokine receptors: structure, function and role in microbial pathogenesis. Cytokine Growth Factor Rev. 1996, 7: 47-64. 10.1016/1359-6101(96)00009-3.CrossRefPubMed
8.
Zurück zum Zitat Murphy PM, Baggiolini M, Charo IF, Hebert CA, Horuk R, Matsushima K, Miller LH, Oppenheim JJ, Power CA: International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol Rev. 2000, 52: 145-176.PubMed Murphy PM, Baggiolini M, Charo IF, Hebert CA, Horuk R, Matsushima K, Miller LH, Oppenheim JJ, Power CA: International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol Rev. 2000, 52: 145-176.PubMed
9.
Zurück zum Zitat Zlotnik A, Morales J, Hedrick JA: Recent advances in chemokines and chemokine receptors. Crit Rev Immunol. 1999, 19: 1-47.CrossRefPubMed Zlotnik A, Morales J, Hedrick JA: Recent advances in chemokines and chemokine receptors. Crit Rev Immunol. 1999, 19: 1-47.CrossRefPubMed
10.
Zurück zum Zitat Oliveira SH, Lukacs NW: The role of chemokines and chemokine receptors in eosinophil activation during inflammatory allergic reactions. Braz J Med Biol Res. 2003, 36: 1455-1463.PubMed Oliveira SH, Lukacs NW: The role of chemokines and chemokine receptors in eosinophil activation during inflammatory allergic reactions. Braz J Med Biol Res. 2003, 36: 1455-1463.PubMed
11.
Zurück zum Zitat Chen C, Li Z, Zhou Z, Yin Z, Chan SM, Yu XQ, Weng S, He J: Cloning, characterization and expression analysis of a CXCR1-like gene from mandarin fish Siniperca chuatsi. Fish Physiol Biochem. 2009, 35: 489-499. 10.1007/s10695-008-9283-5.CrossRefPubMed Chen C, Li Z, Zhou Z, Yin Z, Chan SM, Yu XQ, Weng S, He J: Cloning, characterization and expression analysis of a CXCR1-like gene from mandarin fish Siniperca chuatsi. Fish Physiol Biochem. 2009, 35: 489-499. 10.1007/s10695-008-9283-5.CrossRefPubMed
12.
Zurück zum Zitat Huising MO, Stolte E, Flik G, Savelkoul HF, Verburg-van Kemenade BM: CXC chemokines and leukocyte chemotaxis in common carp (Cyprinus carpio L.). Dev Comp Immunol. 2003, 27: 875-888. 10.1016/S0145-305X(03)00082-X.CrossRefPubMed Huising MO, Stolte E, Flik G, Savelkoul HF, Verburg-van Kemenade BM: CXC chemokines and leukocyte chemotaxis in common carp (Cyprinus carpio L.). Dev Comp Immunol. 2003, 27: 875-888. 10.1016/S0145-305X(03)00082-X.CrossRefPubMed
13.
Zurück zum Zitat Chang MX, Sun BJ, Nie P: The first non-mammalian CXCR3 in a teleost fish: gene and expression in blood cells and central nervous system in the grass carp (Ctenopharyngodon idella). Mol Immunol. 2007, 44: 1123-1134. 10.1016/j.molimm.2006.07.280.CrossRefPubMed Chang MX, Sun BJ, Nie P: The first non-mammalian CXCR3 in a teleost fish: gene and expression in blood cells and central nervous system in the grass carp (Ctenopharyngodon idella). Mol Immunol. 2007, 44: 1123-1134. 10.1016/j.molimm.2006.07.280.CrossRefPubMed
14.
Zurück zum Zitat Alabyev BY, Najakshin AM, Mechetina LV, Taranin AV: Cloning of a CXCR4 homolog in chondrostean fish and characterization of the CXCR4-specific structural features. Dev Comp Immunol. 2000, 24: 765-770. 10.1016/S0145-305X(00)00035-5.CrossRefPubMed Alabyev BY, Najakshin AM, Mechetina LV, Taranin AV: Cloning of a CXCR4 homolog in chondrostean fish and characterization of the CXCR4-specific structural features. Dev Comp Immunol. 2000, 24: 765-770. 10.1016/S0145-305X(00)00035-5.CrossRefPubMed
15.
Zurück zum Zitat Chong SW, Emelyanov A, Gong Z, Korzh V: Expression pattern of two zebrafish genes, cxcr4a and cxcr4b. Mech Dev. 2001, 109: 347-354. 10.1016/S0925-4773(01)00520-2.CrossRefPubMed Chong SW, Emelyanov A, Gong Z, Korzh V: Expression pattern of two zebrafish genes, cxcr4a and cxcr4b. Mech Dev. 2001, 109: 347-354. 10.1016/S0925-4773(01)00520-2.CrossRefPubMed
16.
Zurück zum Zitat Daniels GD, Zou J, Charlemagne J, Partula S, Cunningham C, Secombes CJ: Cloning of two chemokine receptor homologs (CXC-R4 and CC-R7) in rainbow trout Oncorhynchus mykiss. J Leukoc Biol. 1999, 65: 684-690.PubMed Daniels GD, Zou J, Charlemagne J, Partula S, Cunningham C, Secombes CJ: Cloning of two chemokine receptor homologs (CXC-R4 and CC-R7) in rainbow trout Oncorhynchus mykiss. J Leukoc Biol. 1999, 65: 684-690.PubMed
17.
Zurück zum Zitat Fujiki K, Shin DH, Nakao M, Yano T: Molecular cloning of carp (Cyprinus carpio) CC chemokine, CXC chemokine receptors, allograft inflammatory factor-1, and natural killer cell enhancing factor by use of suppression subtractive hybridization. Immunogenetics. 1999, 49: 909-914. 10.1007/s002510050573.CrossRefPubMed Fujiki K, Shin DH, Nakao M, Yano T: Molecular cloning of carp (Cyprinus carpio) CC chemokine, CXC chemokine receptors, allograft inflammatory factor-1, and natural killer cell enhancing factor by use of suppression subtractive hybridization. Immunogenetics. 1999, 49: 909-914. 10.1007/s002510050573.CrossRefPubMed
18.
Zurück zum Zitat Kuroda N, Uinuk-ool TS, Sato A, Samonte IE, Figueroa F, Mayer WE, Klein J: Identification of chemokines and a chemokine receptor in cichlid fish, shark, and lamprey. Immunogenetics. 2003, 54: 884-895.PubMed Kuroda N, Uinuk-ool TS, Sato A, Samonte IE, Figueroa F, Mayer WE, Klein J: Identification of chemokines and a chemokine receptor in cichlid fish, shark, and lamprey. Immunogenetics. 2003, 54: 884-895.PubMed
19.
Zurück zum Zitat Perlin JR, Talbot WS: Signals on the move: chemokine receptors and organogenesis in zebrafish. Sci STKE. 2007, pe45- Perlin JR, Talbot WS: Signals on the move: chemokine receptors and organogenesis in zebrafish. Sci STKE. 2007, pe45-
20.
Zurück zum Zitat Sasado T, Yasuoka A, Abe K, Mitani H, Furutani-Seiki M, Tanaka M, Kondoh H: Distinct contributions of CXCR4b and CXCR7/RDC1 receptor systems in regulation of PGNC migration revealed by medaka mutants kazura and yanagi. Dev Biol. 2008, 320: 328-339. 10.1016/j.ydbio.2008.05.544.CrossRefPubMed Sasado T, Yasuoka A, Abe K, Mitani H, Furutani-Seiki M, Tanaka M, Kondoh H: Distinct contributions of CXCR4b and CXCR7/RDC1 receptor systems in regulation of PGNC migration revealed by medaka mutants kazura and yanagi. Dev Biol. 2008, 320: 328-339. 10.1016/j.ydbio.2008.05.544.CrossRefPubMed
21.
Zurück zum Zitat Killian ECO, Birkholz DA, Artinger KB: A role for chemokine signaling in neural crest cell migration and craniofacial development. Dev Biol. 2009, 333: 161-172. 10.1016/j.ydbio.2009.06.031.PubMedCentralCrossRef Killian ECO, Birkholz DA, Artinger KB: A role for chemokine signaling in neural crest cell migration and craniofacial development. Dev Biol. 2009, 333: 161-172. 10.1016/j.ydbio.2009.06.031.PubMedCentralCrossRef
22.
Zurück zum Zitat Balabanian K, Lagane B, Infantino S, Chow KY, Harriague J, Moepps B, Arenzana-Seisdedos F, Thelen M, Bachelerie F: The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J Biol Chem. 2005, 280: 35760-35766. 10.1074/jbc.M508234200.CrossRefPubMed Balabanian K, Lagane B, Infantino S, Chow KY, Harriague J, Moepps B, Arenzana-Seisdedos F, Thelen M, Bachelerie F: The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J Biol Chem. 2005, 280: 35760-35766. 10.1074/jbc.M508234200.CrossRefPubMed
23.
Zurück zum Zitat Dambly-Chaudière C, Cubedo N, Ghysen A: Control of cell migration in the development of the posterior lateral line: antagonistic interactions between the chemokine receptors CXCR4 and CXCR7/RDC1. BMC Dev Biol. 2007, 7: 23-10.1186/1471-213X-7-23.PubMedCentralCrossRefPubMed Dambly-Chaudière C, Cubedo N, Ghysen A: Control of cell migration in the development of the posterior lateral line: antagonistic interactions between the chemokine receptors CXCR4 and CXCR7/RDC1. BMC Dev Biol. 2007, 7: 23-10.1186/1471-213X-7-23.PubMedCentralCrossRefPubMed
24.
Zurück zum Zitat Dobner T, Wolf I, Emrich T, Lipp M: Differentiation-specific expression of a novel G protein-coupled receptor from Burkitt's lymphoma. Eur J Immunol. 1992, 22: 2795-2799. 10.1002/eji.1830221107.CrossRefPubMed Dobner T, Wolf I, Emrich T, Lipp M: Differentiation-specific expression of a novel G protein-coupled receptor from Burkitt's lymphoma. Eur J Immunol. 1992, 22: 2795-2799. 10.1002/eji.1830221107.CrossRefPubMed
25.
Zurück zum Zitat Kaiser E, Forster R, Wolf I, Ebensperger C, Kuehl WM, Lipp M: The G protein-coupled receptor BLR1 is involved in murine B cell differentiation and is also expressed in neuronal tissues. Eur J Immunol. 1993, 23: 2532-2539. 10.1002/eji.1830231023.CrossRefPubMed Kaiser E, Forster R, Wolf I, Ebensperger C, Kuehl WM, Lipp M: The G protein-coupled receptor BLR1 is involved in murine B cell differentiation and is also expressed in neuronal tissues. Eur J Immunol. 1993, 23: 2532-2539. 10.1002/eji.1830231023.CrossRefPubMed
26.
Zurück zum Zitat Ansel KM, McHeyzer-Williams LJ, Ngo VN, McHeyzer-Williams MG, Cyster JG: In vivo-activated CD4 T cells upregulate CXC chemokine receptor 5 and reprogram their response to lymphoid chemokines. J Exp Med. 1999, 190: 1123-1134. 10.1084/jem.190.8.1123.PubMedCentralCrossRefPubMed Ansel KM, McHeyzer-Williams LJ, Ngo VN, McHeyzer-Williams MG, Cyster JG: In vivo-activated CD4 T cells upregulate CXC chemokine receptor 5 and reprogram their response to lymphoid chemokines. J Exp Med. 1999, 190: 1123-1134. 10.1084/jem.190.8.1123.PubMedCentralCrossRefPubMed
27.
Zurück zum Zitat Hardtke S, Ohl L, Forster R: Balanced expression of CXCR5 and CCR7 on follicular T helper cells determines their transient positioning to lymph node follicles and is essential for efficient B-cell help. Blood. 2005, 106: 1924-1931. 10.1182/blood-2004-11-4494.CrossRefPubMed Hardtke S, Ohl L, Forster R: Balanced expression of CXCR5 and CCR7 on follicular T helper cells determines their transient positioning to lymph node follicles and is essential for efficient B-cell help. Blood. 2005, 106: 1924-1931. 10.1182/blood-2004-11-4494.CrossRefPubMed
28.
Zurück zum Zitat Airoldi I, Cocco C, Morandi F, Prigione I, Pistoia V: CXCR5 may be involved in the attraction of human metastatic neuroblastoma cells to the bone marrow. Cancer Immunol Immunother. 2008, 57: 541-548. 10.1007/s00262-007-0392-2.CrossRefPubMed Airoldi I, Cocco C, Morandi F, Prigione I, Pistoia V: CXCR5 may be involved in the attraction of human metastatic neuroblastoma cells to the bone marrow. Cancer Immunol Immunother. 2008, 57: 541-548. 10.1007/s00262-007-0392-2.CrossRefPubMed
29.
Zurück zum Zitat Li SF, Lu QQ, Zhou BY: Evaluation on the potential capacity of the swan oxbow for the conservation of the major Chinese carps. Aquaculture. 1995, 137: 46-47. Li SF, Lu QQ, Zhou BY: Evaluation on the potential capacity of the swan oxbow for the conservation of the major Chinese carps. Aquaculture. 1995, 137: 46-47.
30.
Zurück zum Zitat Forster R, Wolf I, Kaiser E, Lipp M: Selective expression of the murine homologue of the G-protein-coupled receptor BLR1 in B cell differentiation, B cell neoplasia and defined areas of the cerebellum. Cell Mol Biol. 1994, 40: 381-387.PubMed Forster R, Wolf I, Kaiser E, Lipp M: Selective expression of the murine homologue of the G-protein-coupled receptor BLR1 in B cell differentiation, B cell neoplasia and defined areas of the cerebellum. Cell Mol Biol. 1994, 40: 381-387.PubMed
31.
Zurück zum Zitat Bajetto A, Bonavia R, Barbero S, Florio T, Schettini G: Chemokines and their receptors in the central nervous system. Front Neuroendocrinol. 2001, 22: 147-184. 10.1006/frne.2001.0214.CrossRefPubMed Bajetto A, Bonavia R, Barbero S, Florio T, Schettini G: Chemokines and their receptors in the central nervous system. Front Neuroendocrinol. 2001, 22: 147-184. 10.1006/frne.2001.0214.CrossRefPubMed
32.
Zurück zum Zitat Strader CD, Fong TM, Tota MR, Underwood D, Dixon RA: Structure and function of G protein-coupled receptors. Annu Rev Biochem. 1994, 63: 101-132. 10.1146/annurev.bi.63.070194.000533.CrossRefPubMed Strader CD, Fong TM, Tota MR, Underwood D, Dixon RA: Structure and function of G protein-coupled receptors. Annu Rev Biochem. 1994, 63: 101-132. 10.1146/annurev.bi.63.070194.000533.CrossRefPubMed
33.
Zurück zum Zitat Goostrey A, Jones G, Secombes CJ: Isolation and characterization of CXC receptor genes in a range of elasmobranchs. Dev Comp Immunol. 2005, 29: 229-242. 10.1016/j.dci.2004.06.012.CrossRefPubMed Goostrey A, Jones G, Secombes CJ: Isolation and characterization of CXC receptor genes in a range of elasmobranchs. Dev Comp Immunol. 2005, 29: 229-242. 10.1016/j.dci.2004.06.012.CrossRefPubMed
34.
Zurück zum Zitat Sodomann CP, Rother M, Havemann K, Martini GA: Lymphocyte proliferation to phytohaemagglutinin (PHA) in hepatitis B antigen -positive and -negative hepatitis. Res Exp Med. 1979, 175: 95-107. 10.1007/BF01851238.CrossRef Sodomann CP, Rother M, Havemann K, Martini GA: Lymphocyte proliferation to phytohaemagglutinin (PHA) in hepatitis B antigen -positive and -negative hepatitis. Res Exp Med. 1979, 175: 95-107. 10.1007/BF01851238.CrossRef
35.
Zurück zum Zitat Horuk R, Martin AW, Wang Z, Schweitzer L, Gerassimides A, Guo H, Lu Z, Hesselgesser J, Perez HD, Kim J, Parker J, Hadley TJ, Peiper SC: Expression of chemokine receptors in subsets of neurons in the central nervous system. J Immunol. 1997, 158: 2882-2890.PubMed Horuk R, Martin AW, Wang Z, Schweitzer L, Gerassimides A, Guo H, Lu Z, Hesselgesser J, Perez HD, Kim J, Parker J, Hadley TJ, Peiper SC: Expression of chemokine receptors in subsets of neurons in the central nervous system. J Immunol. 1997, 158: 2882-2890.PubMed
36.
Zurück zum Zitat Lavi E, Strizki JM, Ulrich AM, Zhang W, Fu L, Wang Q, O'Connor M, Hoxie JA, Gonzalez-Scarano F: CXCR-4 (Fusin), a co-receptor for the type 1 human immunodeficiency virus (HIV-1), is expressed in the human brain in a variety of cell types, including microglia and neurons. Am J Pathol. 1997, 151: 1035-1042.PubMedCentralPubMed Lavi E, Strizki JM, Ulrich AM, Zhang W, Fu L, Wang Q, O'Connor M, Hoxie JA, Gonzalez-Scarano F: CXCR-4 (Fusin), a co-receptor for the type 1 human immunodeficiency virus (HIV-1), is expressed in the human brain in a variety of cell types, including microglia and neurons. Am J Pathol. 1997, 151: 1035-1042.PubMedCentralPubMed
37.
Zurück zum Zitat Xia M, Bacskai BJ, Knowles RB, Qin SX, Hyman BT: Expression of the chemokine receptor CXCR3 on neurons and the elevated expression of its ligand IP-10 in reactive astrocytes: In vitro ERK1/2 activation and role in Alzheimer's disease. J Neuroimmunol. 2000, 108: 227-235. 10.1016/S0165-5728(00)00285-X.CrossRefPubMed Xia M, Bacskai BJ, Knowles RB, Qin SX, Hyman BT: Expression of the chemokine receptor CXCR3 on neurons and the elevated expression of its ligand IP-10 in reactive astrocytes: In vitro ERK1/2 activation and role in Alzheimer's disease. J Neuroimmunol. 2000, 108: 227-235. 10.1016/S0165-5728(00)00285-X.CrossRefPubMed
38.
Zurück zum Zitat Martín-García J, Kolson DL, González-Scarano F: Chemokine receptors in the brain: their role in HIV infection and pathogenesis. AIDS. 2002, 16: 1709-1730. 10.1097/00002030-200209060-00003.CrossRefPubMed Martín-García J, Kolson DL, González-Scarano F: Chemokine receptors in the brain: their role in HIV infection and pathogenesis. AIDS. 2002, 16: 1709-1730. 10.1097/00002030-200209060-00003.CrossRefPubMed
39.
Zurück zum Zitat Krumbholz M, Theil D, Cepok S, Hemmer B, Kivisakk P, Ransohoff RM, Hofbauer M, Farina C, Derfuss T, Hartle C, Newcombe J, Hohlfeld R, Meinl E: Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment. Brain. 2006, 129: 200-211. 10.1093/brain/awh680.CrossRefPubMed Krumbholz M, Theil D, Cepok S, Hemmer B, Kivisakk P, Ransohoff RM, Hofbauer M, Farina C, Derfuss T, Hartle C, Newcombe J, Hohlfeld R, Meinl E: Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment. Brain. 2006, 129: 200-211. 10.1093/brain/awh680.CrossRefPubMed
40.
Zurück zum Zitat Purcell MK, Kurath G, Garver KA, Herwig RP, Winton JR: Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination. Fish Shellfish Immunol. 2004, 17: 447-462. 10.1016/j.fsi.2004.04.017.CrossRefPubMed Purcell MK, Kurath G, Garver KA, Herwig RP, Winton JR: Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination. Fish Shellfish Immunol. 2004, 17: 447-462. 10.1016/j.fsi.2004.04.017.CrossRefPubMed
Metadaten
Titel
The first non-mammalian CXCR5 in a teleost fish: molecular cloning and expression analysis in grass carp (Ctenopharyngodon idella)
verfasst von
Qiao Q Xu
Ming X Chang
Rong H Sun
Fan S Xiao
P Nie
Publikationsdatum
01.12.2010
Verlag
BioMed Central
Erschienen in
BMC Immunology / Ausgabe 1/2010
Elektronische ISSN: 1471-2172
DOI
https://doi.org/10.1186/1471-2172-11-25

Weitere Artikel der Ausgabe 1/2010

BMC Immunology 1/2010 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Echinokokkose medikamentös behandeln oder operieren?

06.05.2024 DCK 2024 Kongressbericht

Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren. 

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

Proximale Humerusfraktur: Auch 100-Jährige operieren?

01.05.2024 DCK 2024 Kongressbericht

Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.

Die „Zehn Gebote“ des Endokarditis-Managements

30.04.2024 Endokarditis Leitlinie kompakt

Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.