Introduction
Chronic kidney disease (CKD) is a public health problem with increasing global prevalence (about 10–13% of the population [
1,
2]). CKD can cause irreversible progressive loss of kidney function. CKD is usually asymptomatic until later stages when it is difficult to reverse, at which point end-stage renal disease (ESRD) often occurs. Therefore, CKD causes high disability and mortality. Renal interstitial fibrosis (RIF) is a common phenomenon in CKD and ESRD which closely relates to loss of renal function and motility. RIF is characterized by tubular atrophy, myofibroblast activation and proliferation, and extracellular matrix deposits [
3]. Accumulating evidence indicates that epithelial cells play major roles in RIF via epithelial-to-mesenchymal transition (EMT). Following EMT, renal tubular epithelial cells (TECs) lose normal morphology, tight cell–cell junctions, and epithelial cell markers such as E‐cadherin, instead gaining mesenchymal markers including α‐smooth muscle actin (α‐SMA) and vimentin [
4,
5]. Multiple cytokines regulate EMT, such as transforming growth factor beta 1 (TGF‐β1), which is known to induce both EMT and RIF [
6,
7].
Interleukin-like EMT inducer (ILEI), a member of the family with sequence similarity 3 (FAM3) family, is widely expressed in human and mouse tissues and plays important roles in a variety of biological processes. It was originally discovered as a pivotal gene for Alzheimer’s disease [
8] and is also a key factor in retinal formation [
9,
10]. In the past 20 years, studies have found that ILEI plays important roles in EMT to promote formation, invasion, and metastasis in melanoma and breast, colon, prostate, lung, and liver cancers [
11‐
13]. Our previous research demonstrates that ILEI is involved in TGF‐β1-induced renal tubular EMT, with ILEI overexpression independently driving EMT in HK‐2 cells and enhancing EMT in response to TGF‐β1 through the Akt and ERK pathways [
14].
The leukemia inhibitory factor receptor (LIFR) acts as a signaling platform for a variety of cytokines. It is involved in maintaining hepatocyte pluripotency, protecting the liver, promoting glucose absorption and utilization, regulating cellular proliferation and differentiation, and other biological processes. Studies have reported that LIFR activates the JAK/STAT, ERK/MAPK, and Akt/PI3K pathways in tumor formation, inflammation, and cardiac function [
15‐
17]. Woosley, et al. found that ILEI forms a ligand-receptor complex by binding to the extracellular binding factor region of LIFR [
18], suggesting that LIFR may be a key downstream effector molecule for many functions of ILEI. However, no research defines interactions of ILEI and LIFR in RIF.
In a previous study, we demonstrated that ILEI likely mediates TGF‐β1–induced EMT via the Akt and ERK pathways [
14]. However, the specific mechanisms through which ILEI promotes EMT during RIF progression are undefined. Here, we test whether LIFR participates in ILEI-induced EMT and whether this contributes to RIF formation. We explore possible mechanisms in vitro then use mouse and human fibrotic kidney tissue to verify the results in vivo.
Materials and methods
Experimental animals and antibodies
Male C57BL6/J mice weighing 20–25 g were housed at the Ethics Committee for Animal Experiments of the First Hospital of China Medical University under a 12 h:12 h light/dark cycle with a constant temperature (22 ± 1 °C) and free access to food and water. All animal experiments were performed according to the National Institutes of Health guide for the care and use of Laboratory animals, and were approved by the Animal Care and Use Committee of the First Hospital of China Medical University.
The detailed information of antibodies are as follows: Anti-ILEI antibody (ab72182, Abcam, Cambridge, U.K.), Anti-α‐SMA antibody (ab5694, Abcam), Anti-vimentin antibody (ab137321, Abcam), Anti-E‐cadherin antibody (ab133597, Abcam), Anti-p‐Akt antibody (ab18206, Abcam), Anti-Akt antibody (ab126811, Abcam), Anti-p‐ERK antibody (ab223500, Abcam), Anti- ERK antibody (ab17942, Abcam), Anti-collagen Ι antibody (ab34710, Abcam), Anti-LIFR antibody (sc-659, Santa cruz, Dallas, U.S.A.),Anti-collagen ΙII antibody (WL03186,wanleibio,Shenyang, China), Anti-β‐actin antibody (WL01845,wanleibio).
Establishing the UUO mouse model and ILEI specific shRNA treatment
Mice were randomly divided into six groups: sham (n = 10); sham + NC (n = 10); sham + shILEI (n = 10); UUO (n = 10); UUO + NC (n = 10); UUO + shILEI (n = 10).
After anesthesia, the left kidney and the left ureter of mice were exposed, 100 µl virus solution (AAV9, 1 × 10
11 viral genome particles) was retrogradely infused into the ureter according to group setup. And then they were subjected to UUO or sham operation, the UUO procedure was performed as previously described [
19]. Mice were sacrificed 14 days after operation, and the kidneys were harvested, stored in liquid nitrogen or fixed with paraformaldehyde solution (4%) for various analyses.
Histology and immunohistochemistry assays
The kidney samples fixed in 4% paraformaldehyde were embedded in paraffin, sectioned at a thickness of 5 μm, then stained using hematoxylin and eosin (H&E) and Masson staining.
For IHC analysis, paraffin-embedded kidney sections were deparaffinized in xylene, hydrated in graded alcohol and water, then placed in 3% H2O2 to eliminate endogenous peroxidase activity. Sections were then incubated with primary antibodies overnight. Images were captured using an OLYMPUS DP73.
Cells culture and morphological observation
The human proximal tubular epithelial cell line (HK2) was obtained from China Center for Type Culture Collection HK2 cells were cultured in DMEM (12100-46, Gibco, Gaithersburg, U.S.A) with 10% FBS (FSS500, ExCell Bio, Shanghai, China) at 37 °C with 5% CO2. Cellular morphology was observed under a phase‐contrast microscope (OLYMPUS IX53).
Grouping and transfection
To overexpress ILEI, pcDNA3.1-ILEI constructs were identified, sequenced and purchased by the Shanghai Biological Engineering Company. Three shRNA molecules targeting the LIFR gene and its negative control (NC) shRNA were designed and synthesized by GenePharma (Shanghai, China). HK-2 cells were transfected with indicated vector or shRNA using the Lipofectamine 2000 corresponding to the manufacturer’s instruction. After 48 h of transfection, cells were harvested to analyze transfection efficiency by Real-time PCR and Western blot. HK-2 cells were co-transfected with ILEI overexpression vector and the most effective LIFR shRNA or corresponding negative control (NC), cells were divided into four groups: empty vector, ILEI-OE (ILEI overexpression), ILEI-OE + NC, and ILEI-OE + shLIFR groups. Follow-up tests were performed 48 h after transfection. The primer sequences of all shRNA are listed in Table
1.
Table 1
Primer sequence of shRNA
shRNA1 | GGGGCTCCTCATGATTTGAAGTTTCAAGAGAACTTCAAATCATGAGGAGCCCTTTTT |
shRNA2 | GGCTGGATATCCACCAGATACTTTCAAGAGAAGTATCTGGTGGATATCCAGCTTTTT |
shRNA3 | GGGAAGACATTCCTGTGGAAGATTCAAGAGATCTTCCACAGGAATGTCTTCCTTTTT |
NC | GCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAAGTTTTT |
Transwell assays
Migration ability was evaluated in transfected HK2 cells via transwell migration assays. Briefly, 4 × 103 cells from each group were seeded into the upper chamber of a transwell (3422, Corning, NY, U.S.A.) in 200 μl of serum‐free medium, with 800 μl of complete medium added to the lower chamber. All cells were then incubated for 24 h at 37 °C with 5% CO2. Cells which migrated through the membrane were stained with crystal violet (0528, Amresco, Solon, U.S.A.) and photographed and counted using an inverted microscope. Five randomly selected fields were quantified to find an average number.
RNA isolation and real-time PCR
Total RNA was extracted using the TRIpure reagent (RP1001, BioTeke, Beijing, China). Poly-A tails were added to miRNA using the Poly (A) Tailing Kit (AM1350, Ambion, Waltham, MA, U.S.A.). The PrimeScriptTM RT reagent kit with gDNA Eraser (RR047B, Takara, Dalian, China), and gene-specific or random primers were used to generate cDNA. Real-time PCR was performed in an ExicyclerTM 96 Real-Time PCR system (BIONEER, Korea) using SYBR Green (SY1020, Solarbio, Beijing, China). The 2
−△△ CT method was used to calculate relative RNA expression levels from real-time fluorescence quantitative analysis [
20]. Oligonucleotide primer sets are shown in Table
2.
Table 2
Oligonucleotide primer sets for polymerase chain reaction
LIFR | ACATCATCAGCGTAGTGGC | TTCCGACCGAGACGAGTTA | 197 |
ILEI | TGAAGGCCATACAAGATG | CACCACAGAAGACCCAGT | 153 |
E-cadherin | GAACGCATTGCCACATACAC | TGGTGTAAGCGATGGCGGCA | 244 |
α‐SMA | GGGGTGATGGTGGGAATG | GCAGGGTGGGATGCTCTT | 190 |
Vimentin | GACAGGCTTTAGCGAGTTATT | ACCGTTAGACCAGATTGATTC | 160 |
β‐Actin | CACTGTGCCCATCTACGAGG | TAATGTCACGCACGATTTCC | 155 |
Western blotting
Cells or kidney tissue were lysed in lysis buffer containing proteinase inhibitors (WLA019,Beyotime, Shanghai, China) on ice, followed by centrifugation for 10 min at 4 °C 12,000 rpm, then the protein concentration was assessed via BCA protein assay kit (WLA004,Beyotime). Samples were separated by SDS-PAGE followed by transferring to polyvinylidene difluoride membranes (R1DB89779, Sigma-Aldrich, Millipore, U.S.A.) and blocked with 5% fat-free milk at roofHYm temperature for 1 h. After an overnight incubation at 4 °C with primary antibodies, the membranes were incubated with secondary antibodies for 1 h at 37 °C. Immunoreactive bands were visualized by enhanced chemiluminescence (7Sea Biotech). Band intensities were quantified using Gel‐Pro Analyzer 4, with β‐actin as an endogenous reference.
Co-immunoprecipitation(Co-IP)
The endogenous interaction between ILEI and LIFR in HK-2 cells was verified by co-IP assay. The cell lysates of HK-2 cells in different groups were incubated with protein A-agarose beads and anti-ILEI or anti-LIFR antibody at 4 °C. Then the immunoprecipitated proteins were subjected to immunoblotting with anti-LIFR and anti-ILEI antibody.
Patients and samples
12 pediatric patients with CKD who underwent renal biopsy between February 2017 and May 2021 at the First Hospital of China Medical University were included, of which 7 were confirmed to have RIF and 5 were negative for RIF. Among the 7 patients in the RIF group, 3 cases had Lupus nephritis and 3 had Henoch-Schonlein purpura nephritis and 1 case had microscopic polyangiitis. 5 pediatric cases without RIF were selected as controls (3 cases were nephrotic syndrome and 2 cases were Henoch-Schonlein purpura nephritis). H&E, Masson, and IHC staining were performed on all patient kidney tissue sections.
Statistical analysis
All experiments were repeated three times. Statistical analyses were performed using SPSS 22.0 software (SPSS Inc., U.S.A.). All data are presented as mean values ± SD and p < 0.05 was considered statistically significant.
Discussion
RIF is a widely accepted index of CKD and an important pathophysiological mechanism in ESRD formation. Interstitial accumulation of ECM and related molecules are key characteristics of RIF. Although controversy remains, EMT is considered one of the most important processes leading to interstitial fibrosis. EMT has emerged as a well-regulated process by which epithelial cells lose apical-basal polarity and cell–cell adhesions and acquire mesenchymal characteristics. This transition plays a crucial role in many biological processes including embryonic development, tissue regeneration, wound healing, organ fibrosis, and cancer progression. Numerous studies have shown that EMT is a key factor in three aspects of kidney injury: (1) impacting TEC function, (2) causing cell cycle arrest at the G2 phase, disrupting the balance between repair and fibrosis, (3) immune cell recruitment and inflammation [
21,
22]. In this article, we chose E-cadherin, α-SMA, vimentin, collagen Ι and collagen ΙII as important indicators for the detection of EMT and RIF. E-cadherin is an important epithelial cell markers involved in mechanisms regulating cell–cell adhesions, mobility and proliferation of epithelial cells. Alpha-smooth muscle actin (α-SMA) is an excellent marker of myofibroblasts that were recognized as the principal effector cells that are responsible for the excess deposition of interstitial extracellular matrix under pathologic fibrosis conditions [
23]. Vimentin is a type III intermediate filament protein that is expressed in mesenchymal cells, which is often used as a marker of mesenchymally-derived cells or cells undergoing EMT [
24]. Collagen Ι and collagen ΙII are major components of the extracellular matrix in a variety of organs [
25,
26].Therefore, when excessive accumulation of extracellular matrix components leads to fibrotic conditions, collagen Ι and collagen ΙII are important markers in the demonstration of fibrosis [
27].
As the gene encoding ILEI,
FAM3C has been identified as an EMT-specific gene [
28] and an emerging biomarker and potential therapeutic target for cancer [
29]. Multiple studies have shown that ILEI participates in EMT and promotes metastasis and invasiveness in different tumors [
30‐
32]. Kral et al. showed that ILEI self-assembly into monomers and covalent dimers is essential for EMT induction, tumor growth, and metastasis in cancer cell lines and tumors [
33]. LIFR mainly binds with its corresponding ligand leukemia inhibitory factor (LIF) with low affinity and then recruits gp130 to form a heterodimerization complex, then leads to activation of downstream signal, for example the ERK/MAPK and Akt/PI3K pathways, exerting multiple biological functions including EMT and fibrosis. Currently, there are rare studies on the relationship between ILEI and LIFR, Woosley et al. demonstrated that in breast cancer stem cells, ILEI could bind with the extracellular cytokine binding region of LIFR to promote the tyrosine phosphorylation of LIFR, after this transformation, LIFR enhances the phosphorylation of STAT3, further activating Jak/STAT signaling. The above series of changes can maintain breast cancer stem cells tumorigenicity and metastatic potential through EMT [
18]. We speculated that LIFR could be involved in the pathological process as a downstream effector molecule of ILEI during RIF.
Akt and ERK are well-defined pathways which are closely associated with fibrosis, and multiple studies have shown that they are hyperactive after phosphorylation and can enhance fibroblast activation, collagen synthesis and EMT process, which will finally lead to fibrotic condition. We have confirmed that ILEI mediates the phosphorylation of Akt and ERK caused by TGF‐β1. Meanwhile, there are studies reported that LIFR activates the JAK/STAT, ERK/MAPK, and Akt/PI3K pathways in tumor formation, inflammation, and cardiac function. So, we supposed LIFR also contribute to the phosphorylation levels of Akt and ERK caused by ILEI.
In our previous study, we demonstrated in vitro that ILEI is a crucial mediator of TGF-β1-induced renal tubular EMT via the Akt and ERK pathways and that ILEI overexpression can independently promote EMT [
14]. Based on this previous research, we explored mechanisms by which ILEI may promote EMT in RIF. First, we directly overexpressed ILEI in HK2 cells to drive EMT and found a simultaneous increase in LIFR expression. Knocking down LIFR rescued the EMT caused by ILEI overexpression, thus we conclude that ILEI promotes EMT by stimulating LIFR. The fact that ILEI and LIFR form a protein complex was further proven by immunoprecipitation. We also reveal that ILEI/LIFR promotes EMT through phosphorylation of Akt and ERK. In summary, our in vitro work demonstrates that ILEI binds to LIFR to form a protein complex, activates LIFR, and promotes renal tubular EMT through the Akt and ERK pathways.
We tested the effect of ILEI in vivo using the classic UUO model to cause renal fibrosis. The UUO group presented with RIF and changes in EMT-related markers such as decreased E-cadherin and increased α-SMA and vimentin, showing that EMT is associated with RIF. During this process, increased expression of ILEI and LIFR suggests that these proteins are involved in RIF. After ILEI was knocked down, we found EMT and RIF significantly alleviated and the expression of LIFR reduced. We further compared kidney specimens from patients with or without RIF and found that ILEI and LIFR were both highly expressed in the RIF group. Therefore, we reached consistent conclusions in vivo and in vitro.
Based on our previous study, we mainly conduct in-depth research from the following two aspects: firstly, we construct the mouse model of RIF for validation and make an effort to collect the precious specimens of children with RIF, which has greater clinical predictive significance; secondly, we reasonably speculated and demonstrated that LIFR participates in RIF formation as a downstream effector of ILEI. We have proved for the first time that LIFR is a crucial mediator of renal tubular EMT and RIF. Our research provides a more in-depth study of the molecular mechanisms and regulatory networks of RIF. In future studies, we will strive to uncover the molecular mechanism of the occurrence and development of RIF and explore new therapeutic targets in order to delay the progression of chronic kidney disease.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.