Skip to main content
Erschienen in: BMC Neurology 1/2022

Open Access 01.12.2022 | Research

The role of Bordetella pertussis in the development of multiple sclerosis

verfasst von: Mohammad Mahdi Majzoobi, Mohammad Reza Macvandi, Hamidreza Ghasemi Basir, Zahra Sanaei, Shahir Mazaheri, Maryam Afza, Mohammad Reza Arabestani

Erschienen in: BMC Neurology | Ausgabe 1/2022

Abstract

Background

Multiple sclerosis (MS) is one of the most common neurological disorders which main cause is not identified yet. Some studies mentioned the possible role of infectious agents such as chlamydia pneumonia, mycoplasma and also, B. pertussis via asymptomatic nasopharyngeal colonization. The current study aimed to investigate and compared the serum level of B. pertussis antibody and the rate of nasopharyngeal colonization by this pathogen in subjects with and without MS.

Methods

In this case-control study, 109 patients with MS and 114 subjects without MS referred to Sina Hospital in Hamadan in 2019 are studied and compared in terms of serum titer of B. pertussis antibody and nasopharyngeal colonization by this bacterium. Colonization was evaluated using culture and real-time PCR techniques. Data were analyzed using SPSS version 16 with a 95% confidence interval.

Results

The serum titer of B. pertussis antibody in case and control groups was 37.8 and 35.1%, respectively (P = 0.74). Culture and real-time PCR techniques revealed no case of nasopharyngeal colonization by B. pertussis.

Conclusion

There was no difference between B. pertussis antibody titer and the rate of nasopharyngeal colonization between both MS patients and the healthy control group. Therefore, it seems that probably B. pertussis has not a role in MS development.
Hinweise

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
MS
Multiple sclerosis
B. pertussis
Bordetella pertussis
PCR
Polymerase Chain Reaction
CSF
Cerebrospinal fluid
HUMS
Hamadan University of Medical Sciences (HUMS)
EBV
Epstein-Barr virus
CNS
Central nervous system

Background

Multiple sclerosis (MS) is one of the most common neurological disorders all around the world, corresponding to 100 per 100,000 people in Europe and North America to 2 per 100,000 people in areas close to the Earth’s Equator. It is estimated that 2.5 million people live with MS globally. In Iran, the prevalence of MS ranges from 5.3 to 74.28 per 100,000 people [14]. MS is more common in young people, and early symptoms generally begin before the age of 55. The maximum incidence of the disease is in the ages of 20 to 40 years and the genetic factors have a key role in its development [57]. The unequal risk of MS development in monozygotic twins indicates in addition to genetic predisposition, environmental factors are important for MS development [8, 9].
Although some researchers have provided evidence that infectious agents play a significant role in the etiology of MS, it should be noted that to date, no specific virus or bacteria alone is introduced as the cause of MS development. It is not yet clear exactly that infectious agents play a direct role in the etiology of MS or these factors only facilitate and intensify the disease [7].
The most important evidence that indicates a significant association between MS and infectious agents is the fact that 90% of MS patients have an abnormally elevated titer of immunoglobulin G in their cerebrospinal fluid (CSF) [10]. In contrast, there is a hypothesis that high concentrations of IgG in CSF of MS patients may be the cause of the disease [11]. Some evidence indicating that asymptomatic colonization of B. pertussis can be the cause of MS. B. pertussis colonization is common in children, youth, and adults [12, 13].
The high risk of MS in the U.S. is reported to be indirectly associated with pertussis vaccination. It is believed that pertussis vaccination can reduce the incidence of acute and clinical forms of the disease, but it does not exert a mucosal protective effect [1315]. Therefore, it is postulated that cases with subclinical pertussis are at elevated risk of MS [14, 15]. The human nasopharynx can be colonized with bacteria and pathogens such as B. pertussis [16]. But no chronic carrier in humans is reported [17]. Rubin et al. [18] reported that subclinical colonization of B. pertussis in nasopharyngeal of vaccinated individuals may be associated with MS development. In animal models, also Bordetella pertussis has experimentally caused MS.
Kurtzke et al. published one of the most important epidemiological reports on MS in 1993. Based on the MS epidemic in the Faroe Islands during World War II and immediately after the war, they concluded that MS is a late consequence of a particular unknown infection during adolescence and youth [19]. A study showed that 95.47% of MS patients were positive for anti-Bordetella antibodies [20]. Although an association is postulated between nasopharyngeal colonization and MS, no study on isolation of this bacterium from nasopharyngeal was found. Therefore, this case-control study was conducted to investigate the serum level of antibody and the rate of B. pertussis nasopharyngeal colonization in patients with MS and subjects without MS.

Method

This case-control study was conducted on subjects with and without MS, referred to Sina Hospital in Hamadan, west of Iran, in 2018-2019. After obtaining informed consent, participants were enrolled in the study. The cases were selected using convenience and consecutive sampling techniques among eligible patients. The sample size was calculated as 124 subjects, following the study by Sherkat et al. [21]. (Prevalence of positive B. pertussis antibody in adults referred to Isfahan medical centers), with an alpha of 0.5, 0.06 error, and a prevalence of 0.12.
Out of 109 patients with MS were compared with 114 participants without MS. MS patients were enrolled according to clinical symptoms, laboratory findings (increased IgG CSF and oligoclonal band in CSF), and imaging evidence provided by MRI, which all were confirmed by a neurologist. Subjects of the control group (i.e. without MS diagnosis) were selected preferably from healthy people who were referred for normal check-ups. After obtaining their consent, blood samples (5 cc) were taken from subjects of both groups for the B. pertussis antibody test. All samples were sent to the hospital laboratory. Laboratory tests were performed by ELISA method using Human Anti-Bordetella Pertussis-IgG ELISA kit (manufactured by Abcam Company, United States). Laboratory results were reported as positive or negative cutoffs. Optical absorption higher than 10%, compared to the cut-off, was considered positive.
Also, the nasopharyngeal swab was prepared using Dacron swab and cultured on Regan Lu medium (containing “Bordet-Gengou and charcoal agar”). Then, it was incubated in a humid environment for 10-12 days at 36 °C. This culture medium with a shelf-life of 4 to 8 weeks contained charcoal agar with 10% horse blood for better growth of microorganisms as well as 40 mcg of cephalexin in order to inhibit the growth of normal flora of the respiratory tract. In an ideal case, the maximum sensitivity of culture for B. pertussis is 60%. Culture media were stored in a wet incubator for 12 days at 35 °C and after 24 h were examined daily. Suspected colonies were primarily determined according to their forms (fine and shiny spots similar to mercury droplets). Then, suspected cultures were fixed, and after gram staining using counterstain “O” and observing gram-negative Coccobacillus, further experiments were performed using Difco TM B. pertussis Antiserum (BD company; USA) and slide agglutination tests technique in order to differentiate B. pertussis from Bordetella para-pertussis [21]. All tests, including antibody and culture, were performed in Sina Hospital.
In order to perform real-time PCR, another swab was prepared for DNA extraction using a high pure PCR template preparation kit (made by ROCH Company; Germany). Then, the extracted DNA was used for real-time PCR using primers mentioned in the Table 1, after performing quantitative and qualitative tests. Molecular analyses were performed in the microbiology laboratory of the medical school.
Table 1
Characteristics of primers used for examining the genes
Primers
Sequences (5′ → 3′)
Target
Size (bp)
Tm (°C)
F1-BP
TCCGAACCGGATTTGAGAAA
IS481
60
78.5
R1-BP
CCGGGCTCCTTGAGTGAA
   
F1-BpP
ATGCTGGATCGCAAGTTGATG
IS1001
81
85.8
R2-BpP
TGGGTCTTCGGGCCATT
   
F1-16S-TQM
CGTGTCGTGAGATGTTGGGTTA
16S rDNA
60
78.5
R1-16S-TQM
GACGTCATCCCCACCTTCCT
   
In this study, specific primers were used. The blast was performed to select primers, and the accuracy of the primers sequence and their specificity for the target gene was confirmed.

Preparation and dilatation of primers

The synthesized primers were prepared as lyophilized from Bioneer by Pishgam Company. According to the guideline published by the producer, the primers were diluted with a certain sterile distilled water (analysis sheet for each primer). Afterward, in order to be used in PCR reaction, each primer was diluted 10 times. So that 10 μl of primer was mixed with 90 μl of sterile distilled water using a 0.2 ml Micro Tube, which yielded a 10 Piko Molar concentration.

Real-time PCR and MCA to measure the sensitivity of primers

Applied Biosystem Real-Time PCR and Fermentas Master Mix Kit (Cat No. K0221) were used to perform real-time PCR reactions [22]. In this reaction, for each sample, the materials inside the final mix were added as the reaction material table, 1 μl of the extracted DNA was added to each microtube. Then, it was spin for 15 s and put into the device according to the Table 1, and the program was run. The temperature cycle used in this device was planned for three stages. The first stage, which led to DNA denaturation and contained activation of the polymerase enzyme, was performed at 95 °C for 10 min. The second stage contained a DNA proliferation reaction at 95 °C for 15 s, and a temperature of 58 °C continued for 1 min for 40 cycles. The final stage was performed to draw the melting curve, which is necessary for differentiation of the required genes, at 95 °C for 15 s, 58 °C for 1 min, and 95 °C for 15 s.
Data were analyzed using SPSS. Descriptive data were displayed as tables, diagrams, central indices, and dispersion. For data analysis, the mean B. pertussis colonization in MS patients and control group, if the data were distributed normally, was compared using the chi-squared test, Independent Sample t-test, and the Mann-Whitney test was applied for data that were not distributed normally. Statistical significance was considered when p-value< 0.05.

Ethical considerations

The current study is approved by the Ethics Committee of the Hamadan University of Medical Sciences (HUMS) with an ethical code: IR.UMSHA.REC.1396.544.

Results

The current study aimed to compare the serum level of B. pertussis antibody and the level of Bordetella nasopharyngeal colonization in 109 patients with MS and 114 healthy individuals. According to Table 2, the case and control groups were matched in terms of vaccination history, age, sex and weight.
Table 2
Basic characteristics of subjects, separated by the group
Variable
Groups
P.value
Cases (N = 109)
Control (N = 114)
Sex
N(%)
N(%)
 
 Male
17(15.6)
29(25.4)
0.07*
 Female
92(84.4)
85(74.6)
 
Hx of pertussis vaccination
109(100)
114(100)
*0.44
 
mean ± Sd
mean ± Sd
 
Age (year)
10.5 ± 37.6
9.5 ± 35.8
0.17**
Diseases Duration (year)
9.92 ± 4.97
 
*Chi-squared test
**Independent Sample t-test
The study’s main results, including colonization rate of the nasopharynx by B. pertussis and antibody levels against this bacteria, are listed in Table 3.
Table 3
Frequency of B. pertussis antibody serum level, colonization rate, and PCR result in patients with MS and control group
Variables
Cases (N = 109)
Control (N = 114)
P.value
Serum B.pertussis Ab
37.8%
35.1%
0.74
Nasopharynx culture
0%
0%
PCR
0%
0%
For 8 (7.3%) patients with MS and 27 (23.7%) subjects of the control group, the nasopharyngeal culture was positive for microbes other than B. pertussis. For patients with MS, cultured microbes included gram-negative bacilli (n = 1), gram-positive coccus (n = 6), and Penicillium fungus (n = 1). For subjects of the control group, non-gram negative bacilli (n = 3), gram-positive coccus (n = 21), and yeast and Penicillium fungus (n = 3) were observed.
The frequency of B. pertussis antibody in MS patients depends on their age and gender. The mean duration of the disease in patients with MS who were positive and negative for B. pertussis antibody was 10.88 ± 5.38 and 9.93 ± 4.96 years, respectively. According to the results of the Mann-Whitney nonparametric test, there was no significant association between serum level of B. pertussis in patients with MS and duration of the disease.

Discussion

In the present study, serum levels of B. pertussis antibody in the case and control groups were 37.8 and 35.1%, respectively. All subjects were negative for nasopharyngeal colonization and PCR. There was no significant association between B. pertussis antibody titer and age, sex, and duration of the disease. The study by Eslamifar et al. [23] in Iran reported that more than half of children aged 8 months to 6 years were negative for B. pertussis antibody. However, there was a direct correlation between B. pertussis antibody and age.
In the study by Hashemi et al. [24] about half of the students had positive B. pertussis titer, which was not different between males and females. In the present study, the frequency of B. pertussis positive antibody in the serum of patients was 37.8%, which is lower than the findings of the aforementioned studies. This discrepancy can be attributed to the gradual decline of serum antibodies overtime after developing the disease or vaccination [25], particularly worth noting that subjects of the present study were older than the abovementioned studies.
In the present study, nasopharyngeal colonization and PCR revealed no case of B. pertussis. However, there were cases of gram-positive coccus colonization (n = 6), gram-positive bacilli (n = 1), and Penicillium (n = 1). The hypothesis of the association between infectious agents and the likelihood of developing MS was initially suggested based on the ecological study of Kurtzke et al. [19].
According to the study by Zarkesh-Esfahani et al., infectious agents play a significant role in the etiology of MS. However, no researcher has mentioned the contribution of specific microbial agents in the pathogenesis of MS [7]. Infectious agents may cause secretion of cytokines, Gliosis, and leukocyte infiltration due to inflammation and loss of integrity in CNS tissue [26]. Chlamydia pneumonia, HH6, EBV, and Mycoplasma are mentioned as infectious agents that may have a role in MS pathogenesis [11, 2628]. Antigen similarity between these pathogens and CNS tissue has been suggested as a probable cause for the onset of myelin damage [27, 29]. Fiore et al. [20], in a study on 92 patients with a definite diagnosis of MS, reported that 95.47% of subjects were positive for anti- B. pertussis antibodies. Researchers reported that high pathogenic toxin may be directly attached to Nero-Epithelium, causing damage to the CNS.
Considering the effect of subclinical colonization of B. pertussis on nasopharynx of vaccinated individuals and the influence of B. pertussis, as a potential adjuvant agent with neural antigens, in the induction of neuropathology of autoimmune encephala and development of MS in the animal model, as well as based on epidemiological and biological evidence, Rubin et al. concluded that colonization of B. pertussis can be an important cause of MS [18]. However, contrary to the studies by Fiore [20] and Rubin [8], Sen et al. [30], in a study on mice, concluded that administration of pertussis toxin did not affect phenotype induction similar to MS.

Conclusion

There was no difference between B. pertussis antibody titer in MS patients and the healthy control group. None of the participants in both case and control groups presented nasopharyngeal colonization of B. pertussis. Therefore, it seems that probably B. pertussis has not a role in MS development.

Acknowledgments

This study was approved and received financial support by the Vice-chancellor of Research and Technology, Hamadan University of Medical Sciences, Hamadan, Iran under the number 9609215879.

Declarations

The current study is approved by the Ethics Committee of the Hamadan University of Medical Sciences (HUMS) with an ethical code: IR.UMSHA.REC.1396.544 and all the methods were carried out in accordance with relevant guidelines and regulations.
All authors gave their consent for publication.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Eskandarieh S, Heydarpour P, Elhami S-R, et al. Prevalence and incidence of multiple sclerosis in Tehran, Iran. Iran J Public Health. 2017;46(5):699.PubMedPubMedCentral Eskandarieh S, Heydarpour P, Elhami S-R, et al. Prevalence and incidence of multiple sclerosis in Tehran, Iran. Iran J Public Health. 2017;46(5):699.PubMedPubMedCentral
2.
Zurück zum Zitat Etemadifar M, Sajjadi S, Nasr Z, et al. Epidemiology of multiple sclerosis in Iran: a systematic review. Eur Neurol. 2013;70(5-6):356–63.CrossRef Etemadifar M, Sajjadi S, Nasr Z, et al. Epidemiology of multiple sclerosis in Iran: a systematic review. Eur Neurol. 2013;70(5-6):356–63.CrossRef
3.
Zurück zum Zitat Kingwell E, Marriott JJ, Jette N, et al. Incidence and prevalence of multiple sclerosis in Europe: a systematic review. BMC Neurol. 2013;13(1):128.CrossRef Kingwell E, Marriott JJ, Jette N, et al. Incidence and prevalence of multiple sclerosis in Europe: a systematic review. BMC Neurol. 2013;13(1):128.CrossRef
4.
Zurück zum Zitat Leray E, Moreau T, Fromont AS, et al. Epidemiology of multiple sclerosis. Rev Neurol. 2016;172(1):3–13.CrossRef Leray E, Moreau T, Fromont AS, et al. Epidemiology of multiple sclerosis. Rev Neurol. 2016;172(1):3–13.CrossRef
5.
Zurück zum Zitat Aminoff M, Greenberg D, Simon RP. Clinical neurology. 8th ed. China: McGraw-Hill; 2012. p. 285–91. Aminoff M, Greenberg D, Simon RP. Clinical neurology. 8th ed. China: McGraw-Hill; 2012. p. 285–91.
6.
Zurück zum Zitat Vosoughi R, Freedman MS. Therapy of MS. Clin Neurol Neurosurg. 2010;112(5):365–85.CrossRef Vosoughi R, Freedman MS. Therapy of MS. Clin Neurol Neurosurg. 2010;112(5):365–85.CrossRef
7.
Zurück zum Zitat Zarkesh-Esfahani SH, Nasab HZ, Jabalameli MR, et al. The role of infectious agents in etiology of multiple sclerosis. J Isfahan Med Sch. 2010;28(108):364–76. Zarkesh-Esfahani SH, Nasab HZ, Jabalameli MR, et al. The role of infectious agents in etiology of multiple sclerosis. J Isfahan Med Sch. 2010;28(108):364–76.
8.
Zurück zum Zitat Willer CJ, Dyment DA, Risch NJ, et al. Twin concordance and sibling recurrence rates in multiple sclerosis. Proc Natl Acad Sci. 2003;100(22):12877–82.CrossRef Willer CJ, Dyment DA, Risch NJ, et al. Twin concordance and sibling recurrence rates in multiple sclerosis. Proc Natl Acad Sci. 2003;100(22):12877–82.CrossRef
9.
Zurück zum Zitat Sotgiu S, Pugliatti M, Sanna A, et al. Multiple sclerosis complexity in selected populations: the challenge of Sardinia, insular Italy 1. Eur J Neurol. 2002;9(4):329–41.CrossRef Sotgiu S, Pugliatti M, Sanna A, et al. Multiple sclerosis complexity in selected populations: the challenge of Sardinia, insular Italy 1. Eur J Neurol. 2002;9(4):329–41.CrossRef
10.
Zurück zum Zitat Vandvik B, Norrby E, Nordal HJ, et al. Oligoclonal measles virus specific IgG antibodies isolated from cerebrospinal fluids, brain extracts, and sera from patients with subacute sclerosing panencephalitis and multiple sclerosis. Scand J Immunol. 1976;5(8):979–92.CrossRef Vandvik B, Norrby E, Nordal HJ, et al. Oligoclonal measles virus specific IgG antibodies isolated from cerebrospinal fluids, brain extracts, and sera from patients with subacute sclerosing panencephalitis and multiple sclerosis. Scand J Immunol. 1976;5(8):979–92.CrossRef
11.
Zurück zum Zitat Gilden DH. Infectious causes of multiple sclerosis. Lancet Neurol. 2005;4(3):195–202.CrossRef Gilden DH. Infectious causes of multiple sclerosis. Lancet Neurol. 2005;4(3):195–202.CrossRef
12.
Zurück zum Zitat Ward JI, Cherry JD, Chang S-J, et al. Efficacy of an acellular pertussis vaccine among adolescents and adults. N Engl J Med. 2005;353(15):1555–63.CrossRef Ward JI, Cherry JD, Chang S-J, et al. Efficacy of an acellular pertussis vaccine among adolescents and adults. N Engl J Med. 2005;353(15):1555–63.CrossRef
13.
Zurück zum Zitat Zhang Q, Yin Z, Li Y, et al. Prevalence of asymptomatic Bordetella pertussis and Bordetella parapertussis infections among school children in China as determined by pooled real-time PCR: a cross-sectional study. Scand J Infect Dis. 2014;46(4):280–7.CrossRef Zhang Q, Yin Z, Li Y, et al. Prevalence of asymptomatic Bordetella pertussis and Bordetella parapertussis infections among school children in China as determined by pooled real-time PCR: a cross-sectional study. Scand J Infect Dis. 2014;46(4):280–7.CrossRef
14.
Zurück zum Zitat Long SS, Welkon CJ, Clark JL. Widespread silent transmission of pertussis in families: antibody correlates of infection and symptomatology. J Infect Dis. 1990;161(3):480–6.CrossRef Long SS, Welkon CJ, Clark JL. Widespread silent transmission of pertussis in families: antibody correlates of infection and symptomatology. J Infect Dis. 1990;161(3):480–6.CrossRef
15.
Zurück zum Zitat Warfel JM, Zimmerman LI, Merkel TJ. Acellular pertussis vaccines protect against disease but fail to prevent infection and transmission in a nonhuman primate model. Proc Natl Acad Sci. 2014;111(2):787–92.CrossRef Warfel JM, Zimmerman LI, Merkel TJ. Acellular pertussis vaccines protect against disease but fail to prevent infection and transmission in a nonhuman primate model. Proc Natl Acad Sci. 2014;111(2):787–92.CrossRef
16.
Zurück zum Zitat Saffar MJ, Ghorbani G, Hashemi A, et al. Pertussis resurgence in a highly vaccinated population, Mazandaran, North of Iran 2008 - 2011: an epidemiological analysis. Indian J Pediatr. 2014;81(12):1332–6.CrossRef Saffar MJ, Ghorbani G, Hashemi A, et al. Pertussis resurgence in a highly vaccinated population, Mazandaran, North of Iran 2008 - 2011: an epidemiological analysis. Indian J Pediatr. 2014;81(12):1332–6.CrossRef
17.
Zurück zum Zitat Shojaei J, Saffar MJ, Hashemi A, et al. Clinical and laboratory features of pertussis in hospitalized infants with confirmed versus probable pertussis cases. Ann Med Health Sci Res. 2014;4(6):910–4.CrossRef Shojaei J, Saffar MJ, Hashemi A, et al. Clinical and laboratory features of pertussis in hospitalized infants with confirmed versus probable pertussis cases. Ann Med Health Sci Res. 2014;4(6):910–4.CrossRef
18.
Zurück zum Zitat Rubin K, Glazer S. The potential role of subclinical Bordetella pertussis colonization in the etiology of multiple sclerosis. Immunobiology. 2016;221(4):512–5.CrossRef Rubin K, Glazer S. The potential role of subclinical Bordetella pertussis colonization in the etiology of multiple sclerosis. Immunobiology. 2016;221(4):512–5.CrossRef
19.
Zurück zum Zitat Kurtzke JF. Epidemiologic evidence for multiple sclerosis as an infection. Clin Microbiol Rev. 1994;7:141.CrossRef Kurtzke JF. Epidemiologic evidence for multiple sclerosis as an infection. Clin Microbiol Rev. 1994;7:141.CrossRef
20.
Zurück zum Zitat Fiore D. Diagnosis and treatment of multiple sclerosis and amyotrophic lateral sclerosis: neuropathies from Bordetella pertussis. Am J Ther. 2003;10(5):377–9.CrossRef Fiore D. Diagnosis and treatment of multiple sclerosis and amyotrophic lateral sclerosis: neuropathies from Bordetella pertussis. Am J Ther. 2003;10(5):377–9.CrossRef
21.
Zurück zum Zitat Sherkat R, Salehi H, Yazdani R, et al. Bordetella pertussis infection in adolescents. Mil Med. 2009;10(4):269–72. Sherkat R, Salehi H, Yazdani R, et al. Bordetella pertussis infection in adolescents. Mil Med. 2009;10(4):269–72.
23.
Zurück zum Zitat Eslamifar A, Aghakhani A, Banifazl M, et al. Seroprevalence of Bordetella pertussis antibodies in different age groups. Iran J Inf Dis Trop Med. 2010;15(49):43–9. Eslamifar A, Aghakhani A, Banifazl M, et al. Seroprevalence of Bordetella pertussis antibodies in different age groups. Iran J Inf Dis Trop Med. 2010;15(49):43–9.
24.
Zurück zum Zitat Hashemi SH, Ranjbar M, Hajilooi M, et al. Seroprevalence of immunoglobulin G antibodies against pertussis toxin among asymptomatic medical students in the west of Iran: a cross sectional study. BMC Infect Dis. 2009;9(1):58.CrossRef Hashemi SH, Ranjbar M, Hajilooi M, et al. Seroprevalence of immunoglobulin G antibodies against pertussis toxin among asymptomatic medical students in the west of Iran: a cross sectional study. BMC Infect Dis. 2009;9(1):58.CrossRef
25.
Zurück zum Zitat Cherry JD, Heininger U, Richards DM, et al. Antibody response patterns to Bordetella pertussis antigens in vaccinated (primed) and unvaccinated (unprimed) young children with pertussis. Clin Vaccine Immunol. 2010;17(5):741–7.CrossRef Cherry JD, Heininger U, Richards DM, et al. Antibody response patterns to Bordetella pertussis antigens in vaccinated (primed) and unvaccinated (unprimed) young children with pertussis. Clin Vaccine Immunol. 2010;17(5):741–7.CrossRef
26.
Zurück zum Zitat Hemmer B, Archelos JJ, Hartung H-P. New concepts in the immunopathogenesis of multiple sclerosis. Nat Rev Neurosci. 2002;3(4):291–301.CrossRef Hemmer B, Archelos JJ, Hartung H-P. New concepts in the immunopathogenesis of multiple sclerosis. Nat Rev Neurosci. 2002;3(4):291–301.CrossRef
27.
Zurück zum Zitat Loma I, Heyman R. Multiple sclerosis: pathogenesis and treatment. Curr Neuropharmacol. 2011;9(3):409–16.CrossRef Loma I, Heyman R. Multiple sclerosis: pathogenesis and treatment. Curr Neuropharmacol. 2011;9(3):409–16.CrossRef
30.
Zurück zum Zitat Sen M, Shortland PJ, Myers SJ, et al. Treatment with pertussis toxin does not induce a multiple sclerosis-like phenotype in cuprizone-treated mice. In: Abstracts Book of the 2107 Society for Neuroscience Annual Meeting, November 11-15, 2017, Washington DC; 2017. Sen M, Shortland PJ, Myers SJ, et al. Treatment with pertussis toxin does not induce a multiple sclerosis-like phenotype in cuprizone-treated mice. In: Abstracts Book of the 2107 Society for Neuroscience Annual Meeting, November 11-15, 2017, Washington DC; 2017.
Metadaten
Titel
The role of Bordetella pertussis in the development of multiple sclerosis
verfasst von
Mohammad Mahdi Majzoobi
Mohammad Reza Macvandi
Hamidreza Ghasemi Basir
Zahra Sanaei
Shahir Mazaheri
Maryam Afza
Mohammad Reza Arabestani
Publikationsdatum
01.12.2022
Verlag
BioMed Central
Erschienen in
BMC Neurology / Ausgabe 1/2022
Elektronische ISSN: 1471-2377
DOI
https://doi.org/10.1186/s12883-022-02606-4

Weitere Artikel der Ausgabe 1/2022

BMC Neurology 1/2022 Zur Ausgabe

Neu in den Fachgebieten Neurologie und Psychiatrie

Chirurginnen und Chirurgen sind stark suizidgefährdet

07.05.2024 Suizid Nachrichten

Der belastende Arbeitsalltag wirkt sich negativ auf die psychische Gesundheit der Angehörigen ärztlicher Berufsgruppen aus. Chirurginnen und Chirurgen bilden da keine Ausnahme, im Gegenteil.

Ein Drittel der jungen Ärztinnen und Ärzte erwägt abzuwandern

07.05.2024 Medizinstudium Nachrichten

Extreme Arbeitsverdichtung und kaum Supervision: Dr. Andrea Martini, Sprecherin des Bündnisses Junge Ärztinnen und Ärzte (BJÄ) über den Frust des ärztlichen Nachwuchses und die Vorteile des Rucksack-Modells.

„Restriktion auf vier Wochen Therapie bei Schlaflosigkeit ist absurd!“

06.05.2024 Insomnie Nachrichten

Chronische Insomnie als eigenständiges Krankheitsbild ernst nehmen und adäquat nach dem aktuellen Forschungsstand behandeln: Das forderte der Schlafmediziner Dr. Dieter Kunz von der Berliner Charité beim Praxis Update.

Endlich: Zi zeigt, mit welchen PVS Praxen zufrieden sind

IT für Ärzte Nachrichten

Darauf haben viele Praxen gewartet: Das Zi hat eine Liste von Praxisverwaltungssystemen veröffentlicht, die von Nutzern positiv bewertet werden. Eine gute Grundlage für wechselwillige Ärzte und Psychotherapeuten.