We investigate the role of the C-terminal coiled coil of the secondary proline porter ProP in contributing to Cronobacter sakazakii osmotolerance.
Findings
The extended C-terminal domain of ProP1 (encoded by ESA_02131) was spliced onto the truncated C-terminal end of ProP2 (encoded by ESA_01706); creating a chimeric protein (ProPc) which exhibits increased osmotolerance relative to the wild type.
Conclusions
It appears that the C-terminal coiled coil domain tunes ProP at low osmolality, whereas ProP transporters lacking the coiled coil domain are more active at a higher osmolality range.
The online version of this article (doi:10.1186/s13099-014-0046-9) contains supplementary material, which is available to authorized users.
Audrey Feeney, Christopher D Johnston contributed equally to this work.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
AF, CJ and AL carried out the the experimental work. AF drafted the manuscript together with together with CJ, AL and RDS. All authors read and approved the final manuscript.
Introduction
Survival of the foodbourne pathogen Cronobacter sakazakii in low water activity (aw) environments, e.g. powdered infant formula (PIF), is largely attributed to the accumulation of organic compounds termed osmolytes or compatible solutes [1, 2]. Synthesised de novo, or transported from the bathing solution[3], compatible solutes function to increase cell turgor thereby counterbalancing the external osmotic upshift and preventing water loss from the cell, which if left unchecked can lead to plasmolysis and ultimately cell death [4].
In Escherichia coli, a model organism for the study of bacterial osmoadaptation, the transmembrane protein ProP is perhaps the best characterised compatible solute uptake system; facilitating the uptake of both proline and glycine betaine [5]. A member of the major facilitator superfamily (MFS), E. coli ProP is a 500-amino acid protein comprising of 12 transmembrane domains and a characteristic carboxy-terminal extension [5, 6]. In a previous in silico study we identified seven ProP homologues on the C. sakazakii BAA-894 genome; one of which, ESA_02131, encodes a protein exhibiting 90% identity to E. coli ProP [2]. While the remaining six homologues encode proteins exhibiting features of classic secondary transporters, they are all 60–70 amino acids shorter than the E. coli ProP; lacking the extended carboxyl tail [2]. Notwithstanding the lack of structural consistency, particularly at the C-terminal end, we have shown that six of the seven C. sakazakii proP homologues contribute to C. sakazakii osmotolerance, albeit to varying degrees [7].
Anzeige
Culham et al. [5] first described the E. coli ProP as harbouring unusual structural features which appeared unique within the transporter superfamily. This study predicted the formation of an alpha helical coiled coil resulting from the presence of the carboxyl terminal extension [5]. Indeed, a synthetic polypeptide corresponding to the C-terminal extension of ProP formed a dimeric alpha helical coiled coil [6]. Interestingly, when amino acid changes were introduced to the coiled coil, ProP required a larger osmotic upshift to become activated [6], suggesting that the C-terminal domain likely plays a role in osmosensing. Furthermore, a derivative of ProP which lacked the 26 amino acid C-terminal domain was expressed, but inactive [6]. In contrast, despite the structural degeneracy observed between the homologues, C. sakazakii ProP homologues lacking the C-terminal extension do contribute to osmotolerance, albeit to a lesser extent than the extended ProP (which we designate Prop1) encoded by ESA_02131 [7].
While several studies have focused on elucidating the role of the carboxyl extension in E. coli[5, 6, 8], little is known about the role, if any, of the ProP1 carboxyl extension in the far more osmotolerant C. sakzakii. Herein, we investigate the role of the C-terminal coiled coil of ProP1 in contributing to C. sakazakii osmotolerance, by creating a chimeric protein (ProPc) in which the extended C-terminal domain of ProP1 (encoded by ESA_02131) is spliced onto the truncated C-terminal end of ProP2 (encoded by ESA_01706).
Material and methods
Bacterial strains and growth conditions
Bacterial strains and plasmids used in this study are listed in Table 1.
PCR primers (Table 2) were designed for each proP homologue based on C. sakazakii strain BAA-894 sequence data available from the NCBI database (NC_009778.1). The formation of the chimeric ProP protein (ProPc), which consists of the extended coiled coil region of ProP1 (amino acid position 422 to 505) fused to the C-terminus of ProP2 (encoded by ESA_01706), was performed using a modified SOEing (Splicing by overlap extension) technique [12]. In silico comparative analysis of the native ProP1 and ProP2 sequences, revealed a point of amino acid homology within the twelfth predicted transmembrane domain, a leucine/isoleucine/threonine triplet (LIT) at position 422–424 and 437–439 respectively, which was selected as the splice site. Briefly, the fusion was performed using three separate PCR reactions: the first PCR (primer set Chimeric-01706) resulted in an ESA_01706 (proP2) amplicon lacking the C-terminal extension but containing a 15-bp 3’overhang corresponding to the LIT triplet of the ProP1 C- terminal extension. The second PCR (primer set Chimeric-02131CTE) formed an amplicon of 210-bp encoding ProP1 C-terminal extension with a 5’-overhang, also corresponding to the LIT triplet. The final PCR (primer set Chimeric-01706-F Chimeric-02131tail-R) was performed with the two previous amplicons as template; resulting in a final product of 1,623-bp, representing the ESA_01706 native promoter and modified coding region (encoding the fused ProP1 C-terminal extension after the LIT triplet). This product was digested with restriction enzymes BamHI and HindIII and ligated to a similarly digested pUC18 vector forming pUC18:ESA_01706CTE (C-T ermini E xtension). The integrity of the chimeric sequence was confirmed by sequencing (MWG Operon, Germany and GATC, Germany) and transformed into E. coli MKH13.
Table 2
Primers
Primer name
Primer sequence (5' to 3')
Length
Characteristics
ESA_02131
F
CATCGGCCGACAGGCCAGTCAATGAATGATGC
32
EagI cut site
R
CATTCTAGAGAGTACAACGGAATGCGGGG
29
XbaI cut site
ESA_01706
F
CATTCTAGAGTCGGGCGGCTCTTTATCTGG
30
XbaI cut site
R
CATGGATCCTTGACCAGATGACGCAGTCTTTC
32
BamHI cut site
Chimeric-01706
F
AATAAGCTTGTGGCTTTTTATGCCGGGCTGC
31
HindIII cut site
R
CAGGCCAGTAATCAGCGCCGCGCCCATGAC
30
3' SOEing overhang
Chimeric-02131CTE
F
CGCGGCGCTGATTACTGGCCTGACGATGAAAG
32
5' SOEing overhang
R
AATGGATCCTTACTCGTTAATACGAGGATGCTGG
34
BamHI cut site
pUC18 MCS Check
F
CATTAGCTCACTCATTAGGCACC
23
pUC18 insert check
R
CATTGTAAAACGACGGCCAGTG
22
pUC18 insert check
Anzeige
Osmotolerance assay
Overnight cultures of E. coli MKH13 clones expressing the wild-type and chimeric ProP proteins (ProP1, ProP2 and ProPC respectively) were grown at 37°C with shaking at 200 rpm in either 10 ml LB or M9 minimal media containing 0.5% glucose, 0.04% arginine, 0.04% isoleucine, 0.04% valine (Sigma-Aldrich Co.). Cells were pelleted by centrifugation at 5,000 g, washed and re-suspended in 200 μ l ¼ strength Ringer’s solution. The cell suspension was added to the appropriate filter sterilized media with varying concentrations (0-10%) of added NaCl. Growth was monitored in the relevant media over a 48 hour period, with optical density (OD600) readings being taken every hour. Triplicate readings were taken and graphs were plotted using SigmaPlot version 11.0. E. coli MKH13 harbouring the empty pUC18 plasmid was used as a negative control.
Results
C. sakazakii ProP structures
Based on sequence similarity to the E. coli ProP protein, we identified ProP1 (the product of ESA_02131) as the most likely ProP homolog in C. sakazakii; exhibiting 90% amino acid sequence identity and structural features characteristic of E. coli ProP. Indeed, further analysis using TMHMM and TexTopo software predicted ProP1 to be a membrane protein with 12-transmembrane domains, an extended central hydrophilic loop and carboxy terminal extension (Figure 1). While the remaining five ProP homologues on the C. sakazakii BAA-894 genome were also predicted to encode proteins with 12 transmembrane domains and an extended central hydrophilic loop, they each lacked the extended carboxy-terminal domain identified in ProP1, a feature which likely affects the final protein structure and function.
Figure 1
Predicted transmembrane and tertiary structures of A) ProP2 encoded by ESA_01706, B) ProP1 encoded by ESA_02131 and C) ProPc.
×
Figure 1B illustrates the tertiary structure for ProP1 (predicted using the I-TASSER server [13, 14]). Most notably the presence of a coiled coil domain is evident as a result of the extended carboxy-terminal identified by sequence analysis. The coiled coil domain likely protrudes into the intracellular cytoplasm of the organism where its function remains unclear. By contrast, the tertiary structure of ProP2 (Figure 1A), representative of the remaining 6 ProP homologues and exhibiting 40% identity to E. coli ProP and 49% identity to ProP1, lacks the coiled coil domain at the carboxy-terminal end.
Chimeric protein (ProPc) expression in E. coli MKH13
The osmoprotective properties of ProP1, ProP2 and ProPc were measured and compared in E. coli MKH13; an osmosensitive mutant incapable of growth in high osmolality environments (≥4%). The pUC18 plasmid containing each gene of interest was transformed to E. coli MKH13. Transformation efficiencies of 60 CFU/μg DNA were achieved, with successful transformation being confirmed by colony PCR, followed by sequencing. Transformants were screened for osmotolerance on media (both LB and M9 plus 1 mM proline) containing between 4% and 10% added NaCl.
Assessment of osmotolerance
To determine the effect of each ProP homologues, both native (ProP1 and ProP2) and chimeric (ProPc), on the osmotolerance of E. coli MKH13, each of the strains was grown in media containing varying concentrations of NaCl. Growth was monitored over a 48 hour period in minimal media supplemented with 1 mM proline and containing 0-10% added NaCl.
Media containing 5% NaCl yielded the most discriminatory results. While E. coli MKH13 expressing the empty pUC18 vector showed no growth at 5%, each of the other three strains tested conferred some degree of osmotolerance on the host (Figure 2A). The strain expressing ProP1 was the most osmotolerant, with a maximum optical density (OD600) of 0.326 after 37 hours growth at 5% NaCl. The strain possessing ProPc grew to an OD significantly higher than the strains expressing either ProP1 or ProP2. E. coli MKH13 expressing ProP2 in 5% NaCl grew to a maximum OD of 0.111 after 48 hours, whereas E. coli MKH13 containing ProPc grew to a final OD of 0.189 at the same time point. Interestingly, growth of the stains expressing ProP2 and the chimeric protein continued to increase up to 48 hours, while growth of E. coli MKH13 expressing ProP1 reached maximum OD after only 37 hours.
Figure 2
Physiological analysis ofE. coliMKH13 expressingProP1,ProP2,ProPc andthe empty pUC18 plasmid. A) Optical density was measured over a 48 hour period in media supplemented with 0-10% added NaCl. B) The growth rate of E. coli MKH13 expressing each of the proteins of interest was measured in media supplemented with 0-10% added NaCl.
×
Each E. coli MKH13 strain expressing a proP gene of interest conferred osmotolerance (Figure 2B). As expected, E. coli MKH13 demonstrated a significant reduction in growth rate as NaCl concentrations increased, with a final growth rate of 0.0004 hr−1 recorded in media supplemented with 4% NaCl and no subsequent growth recorded thereafter. E. coli MKH13 expressing ProP1 demonstrated the highest osmotolerance of all the strains tested with growth rates of 0.009 hr−1 to 0.004 hr−1 recorded in media supplemented with 5% to 10% NaCl respectively. The next most osmotolerant strain was that expressing ProPc. Growth rates of 0.004 hr−1 to 0.003 hr−1 were recorded in media supplemented with 5% to 10% NaCl respectively (Table 3). This was higher than the growth rates observed when E. coli MKH13 expressing the native ESA_01706 gene (ProP2) was grown in a high osmolality environment, suggesting an important role for the C. sakazakii ProP C-terminal extension in osmotolerance.
Table 3
Growth rate and optical density @ 600 nm
Protein expressed
Gene locus tags
Name
5%
6%
7%
8%
9%
10%
Max. OD
Growth rate (hr−1)
Max. OD
Growth rate (hr−1)
Max. OD
Growth rate (hr−1)
Max. OD
Growth rate (hr−1)
Max. OD
Growth rate (hr−1)
Max. OD
Growth rate (hr−1)
Native
ESA_02131
ProP1
0.326
0.009
0.144
0.005
0.152
0.004
0.177
0.004
0.181
0.004
0.204
0.004
Native
ESA_01706
ProP2
0.111
0.003
0.096
0.002
0.083
0.002
0.074
0.002
0.127
0.002
0.171
0.002
Chimeric
ESA_02131 ESA_01706
ProPc
0.189
0.004
0.130
0.003
0.113
0.003
0.117
0.003
0.124
0.003
0.141
0.003
Discussion
A unique feature of the neonatal pathogen C. sakazakii is its ability to survive for prolonged periods in environments of low aW, such as powdered infant formula (PIF), making it a significant cause for concern [15]. Indeed, up to 80% of infants infected with C. sakazakii die within days of birth, while survivors often suffer delayed neurological symptoms, brain abscesses or hydrocephalus [16, 17]. However, despite this, little is known about the molecular mechanisms that allow this organism to survive in environments such as PIF where it is subject to extreme hyper-osmotic stress.
Anzeige
In a previous in silico study we identified seven copies of an E. coli proP homolog on the BAA-894 genome. Physiological analysis confirmed that six of the proP homologues identified played a role in osmotolerance. The availability of osmolytes in the media also had an effect on the osmotolerance of the host, with growth rates varying depending on the type or variety of compatible solutes present [7]. While all six ProP proteins exhibited features characteristic of classic secondary transporters, five of the proteins were between 60–70 amino acids shorter than ProP1; lacking the characteristic C-terminal cytoplasmic extension Previous studies in our lab have demonstrated that the six C. sakazakii ProP homologues lacking the C-terminal coiled coil are significantly less osmoprotective than ProP1 [7], suggesting an important role for this domain in modulating C. sakazakii osmotolerance.
In the current study, the C. sakazakii ProP2 (encoded by ESA_01706) was chosen as the prototypical ProP homologue to study the role of the alpha helical coiled coil in osmotolerance. Genetic splicing yielded a chimeric protein structure (ProPc) possessing the native ProP2 domains in addition to the C-terminal alpha helical coiled coil domain from ProP1 (Figure 1C). E. coli MKH13 expressing ProPc grew to a higher OD in minimal media supplemented with proline, when compared to the native protein ProP2 which lacked the extended coiled coil domain (Figure 2A). These data demonstrate that the addition of the coiled coil domain from ProP1 to ProP2 results in a protein with an increased osmoprotective effect on the usually osmotically sensitive E. coli MKH13. However, as the osmolality of the medium increased, this trend appeared to reverse with OD readings becoming similar at 9% NaCl and the chimeric protein growing to a higher OD than the native in 10% NaCl, suggesting that the extent of osmotic pressure also has a role to play in the activity of the proteins.
The role of the C-terminal domain of other osmolyte transporters, such as BetP (Corynebacterium glutamicum) and OpuA (Bacillus subtilis), was demonstrated to be important for the activation of these proteins during an increase in the osmolality of the surrounding medium [18]. Furthermore, Culham et al. created a synthetic polypeptide corresponding to the C-terminal domain of E. coli ProP which formed a dimeric alpha helical coiled coil structure [6], similar to the coiled coil structure of ProP1 (illustrated in Figure 1A). In the same study ProP proteins from both E. coli and Agrobacterium tumefaciens, possessing the characteristic alpha helical coiled coil, were activated at a lower osmolality than orthologues lacking the coiled coil structure. C. glutamicum possesses a ProP protein which lacks the C-terminal alpha helical coiled coil domain and, presumably as a result of this, requires a higher osmolality for activation [6]. E. coli ProP variants lacking the coiled coil or with an amino acid substitution disrupting the formation of the alpha helical coiled coil, also require a larger osmotic upshift than the wild-type transporter [6, 19]. This study demonstrates that the activity of these ProP orthologues is dependent on the osmolality of the surrounding medium, and the alpha helical coiled coil is believed to tune the transporter to osmoregulate the cell over a low osmolality range [19]. These data may therefore offer an explanation for the increased growth observed in E. coli MKH13 expressing ProP2, which lacks the coiled coil domain, in media supplemented with 10% NaCl relative to either ProP1 or ProPc (Figure 2). It is likely that the coiled coil domain of C. sakazakii ProP1 has a similar tuning function. Furthermore, the presence of multiple ProP porters lacking the C-terminal coiled coil domain, and therefore only active at a higher osmolality, may well explain the extreme osmotolerance unique to C. sakazakii; allowing the pathogen to survive in environments like PIF. The ProP1 protein, on the other hand possessing the coiled coil, may be the only osmolyte transporter required to respond to low or moderate hyperosmotic challenge.
Conclusion
The addition of the coiled coil domain from ProP1 to ProP2 resulted in a chimeric protein (ProPc) which demonstrated higher osmotolerance compared to the native ProP2 (under moderate osmotic stress conditions). Furthermore, the growth rate of E. coli MKH13 expressing ProP2 increased in minimal media supplemented with 10% NaCl; suggesting that, as is the case in E. coli[19], the coiled coil domain tunes ProP at low osmolality, whereas ProP transporters lacking the coiled coil domain are more active at a higher osmolality range.
Anzeige
Acknowledgements
RDS is Coordinator of the EU FP7 ClouDx-i project (grant number 324365). AF is funded by an IRCSET EMBARK Postgraduate Scholarship RS/2010/2300, AL is funded by an IRC fellowship (RS/2012/219), CJ is funded by the Department of Agriculture under the Food Institutional Research Measure (08RDCIT617).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The authors declare that they have no competing interests.
Authors’ contributions
AF, CJ and AL carried out the the experimental work. AF drafted the manuscript together with together with CJ, AL and RDS. All authors read and approved the final manuscript.
Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren.
Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.
Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.
Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.
