Animals
Sixty Sprague Dawley male rats weighing 180–220 g and aged 6–8 weeks of specific pathogen-free grade were provided by the Chongqing Animal Center (permit number scxk-2007-0005). Rats were housed five rats/cage at 23 ± 2 °C and humidity of 55 ± 2%. Food and water intake was recorded daily. The litter was replaced daily. The rats were randomized to the sham group (n = 15), unilateral ureteral obstruction (UUO) group (n = 15), UUO + low-dose Tβ4 (1 mg/kg•d) group (n = 15), and UUO + high-dose Tβ4 (5 mg/kg•d) group (n = 15). The UUO and sham groups were given equal volumes of normal saline for intragastric lavage.
The rat model of UUO is currently regarded as the best animal model of progressive chronic renal tubule interstitial fibrosis [
14]. The surgery was performed as described in the literature [
14]. The rats received an intraperitoneal injection of 10% chloral hydrate (0.3 mL/100 g) and were placed laterally on the right side. Skin preparation and disinfection were performed on the left rib on the back. An incision was made 0.5 cm at the left rib on the back. The abdominal cavity was opened and the left kidney and ureter was located and isolated using blunt dissection. The left ureter was held up with a tissue clamp and nipped with a hemostat at the upper middle segment. After the two ends were ligated, the left ureter between the ligated sutures was cut and removed. The incision was closed by suture layer. In the sham group, the abdominal cavity was opened but no tissue was removed.
Culture of tubular epithelial cells
Tubular epithelial cells (NRK-52E) were obtained from Nan Fang Medical University and grown in DMEM medium (Promo Cell, Heidelberg, Germany), containing 5 mM glucose and 10% heat-inactivated FCS at 37 °C in 5% CO2. Tubular epithelial cells were stimulated with 2.5 ng/ml TGF-β for 72 h in the TGF-βgroup,1μg/ml Tβ4 and 5μg/ml Tβ4 in the low dose Tβ4 group and high dose Tβ4 group for 48 h after TGF-β treated cells, respectively.
Sample collection
Blood samples were taken from the carotid artery under anesthesia two weeks after UUO. The serum was separated by centrifugation and was used for detection of blood urea nitrogen (BUN) and creatinine. All rats were sacrificed by cervical dislocation, the left kidney was dissected, and the capsule was peeled off. The kidney was fixed in 10% formaldehyde. Paraffin sections were prepared, routine hematoxylin and eosin (H&E) and periodic acid-Schiff (PAS) staining were performed. The remaining sections were used for immunofluorescence. Remaining kidney tissues were stored at −80 °C.
Real-time qPCR
Total RNA was prepared from the tubular epithelial cells using RNAEasy minikit (Invitrogen, Carlsbad, CA) and reverse transcribed according to the manufacturer’s instructions. Primers for E-cadherin, α-SMA and β-actin were designed and synthesized based on published sequences of these genes as listed in Table
1. Real-time qPCR was performed using SYBR Green PCR Master Mix (Toyobo, Osaka, Japan) and a Rotor- Gene-3000A Real-time PCR System (Corbett, Sydney, Australia) according to the manufacturer’s protocol. The target gene expression was normalized to α β-actin mRNA expression and presented as fold-change compared to the control experiments.
Table 1
Primer sequences, product size and annealing temperatures used in RT-PCR
β-actin | Right | GTTGTCGACGACGAGCG | 93 | 60 |
Left | GCACAGAGCCTCGCCTT | 50 |
E-cadherin | Right | GACCGGTGCAATCTTCAAA | 93 | 59 |
Left | TTGACGCCGAGAGCTACAC | 60 |
α-SMA | Right | GCGTGATTTCCAGCACATAA | 101 | 59 |
Left | ATACTTGACCGGGGTCATCC | 60 |
Western blot
Kidney tissues were placed in radio-immunoprecipitation assay (RIPA) buffer on ice, fully mixed, incubated for 30 min, and centrifuged at 12,000 rpm at 4 °C for 20 min. The supernatant was taken for protein measurement using the bicinchoninic acid assay (BCA) protein detection kit (Sigma, St Louis, Mo, USA). Sodium dodecyl sulfate(SDS) sample buffer (125 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 100 mM dithiothreitol and 0.2% bromophenol blue) was added. The sample was heated at 100 °C for 5 min and stored at −20 °C.
Proteins (50 μg) were separated using 8% or 10% SDS-polyacrylamide gels, and the proteins were transferred to nitrocellulose membranes (Amersham, GE Healthcare, Waukesha, WI, USA). The membranes were incubated with antibodies against E-cadherin (1:2000; GIBCO, Invitrogen Inc., Carlsbad, CA, USA), TGF-β (1:3000 GIBCO, Invitrogen Inc., Carlsbad, CA, USA), α-SMA (1:2000; GIBCO, Invitrogen Inc., Carlsbad, CA, USA),Cleaved Caspase 3 (1:1000, Abcam, UK), Bax(1:1000, Abcam, UK), and Bcl-2 antibodies (1:1500, Abcam, UK) in tris-buffered saline-tween 20 (TBST) containing 2% BSA overnight at 4 °C. After washing, membranes were incubated with horseradish peroxidase-labeled secondary antibody (1:1000;GIBCO, Invitrogen Inc., Carlsbad, CA, USA) in TBST containing 2% BSA at room temperature for 1 h. Enhanced chemiluminescence (Amersham, GE Healthcare, Waukesha, WI, USA) was used for detection. Signal intensity was analyzed using the ScionImage gel image analysis system (Scion Corporation, Frederick, MD, USA). β-actin was used as internal control. Quantitative analysis of the western blot bands was conducted using the Labwork analysis software. The 15 samples per group was detected.
Statistical analysis
SPSS16.0 (IBM, Armonk, NY, USA) was used for statistical analysis. Continuous data are expressed as mean ± standard deviation (SD) and were analyzed using one-way ANOVA followed by the LSD post hoc test. Two-sided P-values <0.05 were considered statistically significant. The data was analyzed in normally distributed by Kolmogorov-Smirnov (P > 0.05), data obeyed the normal distribution.