Background
Excessive mucus secretion is one of the major clinical manifestations of chronic airway diseases such as asthma, chronic bronchitis, and cystic fibrosis [
1]. The excessive mucus is attributed to goblet cell hyperplasia (GCH) and submucosal gland hypertrophy, which are hallmarks of airway remodeling in chronic airway diseases [
2,
3]. Air pollution aggravates respiratory symptoms in patients with chronic airway diseases. Chronic obstructive pulmonary disease (COPD) patients living in communities exposed to high levels of air pollution have faster rates of decline in lung function than patients living in areas with low pollution [
4]. The level of environmental particles is also positively correlated with exacerbation of asthma [
5].
Airborne particulate matter less than 10 μm in aerodynamic diameter (PM10) is a complex mixture of organic and inorganic compounds containing sulfates and various metals such as aluminum, calcium, copper, iron, lead, magnesium, titanium, and zinc [
6]. Clinically, PM10 particles are thought to provoke airway inflammation with the release of mediators that are capable of exacerbating lung disease in susceptible individuals [
5,
7]. This assumption is based on experimental evidence of airway inflammation following direct instillation or inhalation of PM10 particles in animal models [
8]. Furthermore, inhaled particles directly stimulate macrophages and epithelial cells to produce inflammatory cytokines such as TNF-α, GM-CSF and IL-8 [
9,
10], which induce neutrophil- and eosinophil-mediated airway inflammation, and eventually lead to GCH. Recently, particle exposure favors the antigen – sensitized lung toward Th2 environment with over secretion of IL-13, IL-4 [
11] and IL-5 [
12]. Beside the inflammatory cell mediated – GCH, IL-13 directly induces GCH and Muc5AC gene expression through the signaling of IL-4Rα and IL-13Rα [
13,
14]. Therefore, we hypothesized that particles induce GCH via over-production of IL-13 by recruited inflammatory cells.
Titanium dioxide (TiO
2) particles, one component of PM10, are found in dusty workplaces such as industries involved in the crushing and grinding of the mineral ore rutile [
15]. It was reported that 50% of TiO
2-exposed workers had respiratory symptoms accompanied by reduction in pulmonary function [
16]. Because acute and chronic exposure to TiO
2 particles induces inflammatory responses in the airways and alveolar spaces of rats [
17,
18], TiO
2 – instilled rat may be a good model to study the particle induced – airway injury. In this study, we evaluated the role of neutrophilic and eosinophilic inflammation by pretreatment with cyclophosphamide inducing neutropenia [
19] and the association of IL-13 by pretreatment with dexamethasone suppressing IL-13 gene expression [
20].
Methods
Treatment protocols
Particles of TiO2 (mean diameter = 0.29 μm, DuPont, Wilmington, DE) were suspended in endotoxin-free saline. The endotoxin concentration of the TiO2 suspension was less than <0.32 EU/ml as measured with a limulus amebocyte lysate kit (QCL-1000; BioWhittaker, Inc., Walkersville, MD). Seven-week-old male Sprague-Dawley rats (Charles River Technology Inc.) received a single intratracheal instillation of homogeneous suspension of TiO2 particles (4 mg/kg in 200 μl of endotoxin free water). In a pretreatment group, cyclophosphamide (CPA) (100 mg/kg, i.p.) was given 5 days before instillation of TiO2 and a second injection of CPA (50 mg/kg, i.p.) 1 day before TiO2 instillation. In the second pretreatment group, dexamethasone (DEX) (0.25 mg/kg, i.p.; Sigma, St. Louis, MO) was administered 24 h before TiO2 instillation. The Institutional Animal Care and Use Committee of Soonchunhyang University approved the study protocols.
Preparation of lung tissues and morphological analysis
Rats were sacrificed at 4, 24, 48 and 72 hr after TiO2 instillation by being anesthetized with pentobarbital sodium (65 mg/kg, i.p.) and bronchoalveolar lavage (BAL) was performed by 5 times instillation of 1 ml normal saline and gentle retrieval. Cell numbers were measured using a hemacytometer and differential cell counts were performed on slides prepared by cyto-centrifugation and Diff-Quik staining (Scientific Products, Gibbstowne, NJ). Immediately following BAL, the trachea was snap-frozen for RNA extraction or fixed with 4% paraformaldehyde in PBS and embedded in paraffin. The tissues were subjected to periodic acid-Schiff (PAS) and toluidine blue staining to permit measurement of goblet cells and mast cells, respectively. Morphometric analysis was performed under light microscopy at ×400 magnification. PAS positive epithelial cells and total epithelial cells were counted on the length of 250 μm basement membrane at each of four predetermined sites (12, 3, 6, 9 o'clock; 12 o'clock was the membranous portion) using a soft program (Nikon DXM 1200, Nikon Inc. N.Y. USA & Image Pro Plus 4.01 software, Media Cybernetics, Maryland, USA). Results are expressed as the percentage of goblet cells among the epithelial cells. Mast cells in the airway wall were counted on the membranous portion. The results are expressed as the number of cells staining positive for toluidine blue per area of 0.01 mm2.
Reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was isolated using the modified guanidium thiocyanate-phenol-chloroform extraction method [
21]. DNase I (10,000 U/ml; Stratagene, La Jolla, CA)-treated RNA was reverse-transcribed by incubating with 0.5 mM dNTP, 2.5 mM MgCl
2, 5 mM DTT, 1 μl of random hexamer (50 ng/μl) and SuperScript II RT (200 unit/μl; Life Technologies, Grand Island, NY) at 42°C for 50 min, and heat inactivated at 70°C for 15 min. cDNA was aliquoted into tubes containing specific primer pairs for rat GAPDH, Muc1, Muc2 and Muc5ac genes for amplification (300, 403, 421, and 382-bp fragments, respectively). Nucleotide sequences of the primers were as follows. GAPDH-forward ; 5'GGCATTGCTCTCAATGACAA3', GAPDH-reverse; 5'AGGGCCTCTCTCTTGCTCTC3', Muc1-forward; 5' AGAGCTATGGGCAGCTGG 3', Muc1-reverse; 5' ACTACCCCAGTGTCCCTC 3', Muc2-forward; 5' TACTGCTGATGACTGTAT 3', Muc2-reverse; 5'GGCCACAGGCCTGATACT3', Muc5ac-forward; 5' TACAAGCCTGGTGAGTTC 3', Muc5ac-reverse; 5' TCACAGTGCAGCGTCACA 3'. Amplification was performed for 40 cycles (one cycle: 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C) with initial denaturation at 94°C for 5 min and a final extension at 72°C for 10 min.
Immunohistochemical identification of Muc5ac-expressing epithelial cells and IL-13-expressing cells
Muc5ac-positive (+) epithelial cells and IL-13-positive (+) cells were identified by immunohistochemical staining. Three-micron tissue sections of the trachea were treated with 0.3% H2O2-methanol for 20 min to block endogenous peroxidase, and then incubated at 4°C overnight with anti-rat Muc5ac mouse monoclonal antibody (1:200 dilution; Neomarkers, Fremont, CA) or biotinylated anti-rat IL-13 antibody (1:5 dilution; Biosource, Camarillo, CA). After the slides had been incubated with avidin-biotin peroxidase complex (ABC kit, Vector Laboratories, Burlingame, CA), color was developed with 3,3'-diaminobenzidine tetrachloride (DAB, Zymed Laboratories, South San Francisco, CA). The Muc5ac expressing epithelial cells and total epithelial cells were counted on the length of 250 μm epithelial basement membrane at each of four predetermined sites (12, 3, 6, 9 o'clock; 12 o'clock was the membranous portion). Results are expressed as the percentage of Muc5ac (+) cells among the epithelial cells. IL-13 (+) cells was counted on the membranous portion in the same way as mast cells were counted. The results are expressed as the positive rate of mast cells for IL-13 stain per area of 0.01 m2.
Measurement of IL-13 concentration in BAL fluids
The levels of IL-13 in the BAL fluids were measured with a quantitative sandwich enzyme-linked immunoassay kit (Biosource, Camarillo, CA). The lower limit of detection was approximately 1.5 pg/ml. Values below this limit were considered as zero for statistical analysis. Inter- and intra-assay coefficients of variance were less than 10%.
Statistical analysis
Differences between independent samples were compared using the Spearman test for continuous data. If differences were found significant, the Mann-Whitney U test was applied to compare differences between two samples. Differences were considered significant when the p value was less than 0.05. Results are expressed as means ± standard error of the mean (SEM) unless otherwise stated. The correlations were analyzed between the ratio of Muc5ac (+) expressing epithelial cell and the concentration of IL-13 in BAL fluid and the number of mast cell and the IL-13 positive rate of mast cells by Spearman's non-parametric correlation using SPSS (version 10.0, Chicago, USA)
Discussion
Although air pollution contains heavy metallic environmental particles that increases morbidity and mortality of the patients with chronic airway diseases [
4,
5], the underlying mechanisms of mucus hyperproduction causing airway obstruction has not been revealed in detail. In this study, we demonstrated that a single instillation of TiO
2 is able to induce GCH within 24 h. The TiO
2-induced GCH is associated with a dramatic increase in Muc5ac gene and protein expression in the present study (Figure
1 &
2). Up regulation of Muc5ac gene in TiO
2 – induced GCH is thought to be a common pathway in the process of GCH because MUC5AC has been demonstrated to be a major MUC gene during the process of GCH observed in the other non-particulates experimental model of airway diseases [
22‐
25] and the asthmatics [
26]. GCH is known as associated with airway inflammation and can be experimentally induced by various inflammatory agents such as LPS [
22], neutrophil elastase [
27], cathepsin B [
23], IL-4 [
25], IL-9 [
28], and IL-13 [
29,
30].
The exact mechanism of GCH, however, may differ in the experimental models. Neutrophils or eosinophils have been implicated in the induction of GCH in some animal models [
30,
31]. Neutrophils and eosinophils depleted rats using CPA or specific antibodies inhibit granulocyte in agarose plug-induced and IL-13-induced GCH model [
29,
31]. The epidermal growth factor receptor cascades are showed to be involved in underlying mechanism of the neutrophils – induced GCH [
29,
31]. However, in the present study we showed that depletion of these inflammatory cells by pretreatment with CPA similar dose used in the previously study [
29,
31] did not prevent TiO
2-induced GCH (Figure
4). Because cyclophosphamide effectively suppressed the number of neutrophils and eosinophils in peripheral blood (data not shown) and airways in the present study although not complete (Figure
4), our data indicates that these inflammatory cells may be not responsible for the TiO
2-induced GCH. The dissociation of GCH from airway eosinophilia has been well documented in murine asthma models, in which anti-IL-5 (TRFK-5) [
32], or IL-5 deficiency [
33] reduced airway eosinophilia without affecting the induction of GCH. Therefore, depending on the experimental models investigated, the induction of GCH may not require neutrophils and eosinophils. Furthermore, IL-13 is known to induce GCH without any help of other inflammatory cells [
24] and has been clearly shown to play a single, common pathway by which GCH is induced by CD4+ cells and IL-9 [
34]. This process needs IL-4 receptor alpha, but not IL-4 or IL-5 [
33,
34]. These data suggested a possibility that IL-13 is also involved in the particle – induced GCH.
In the present study, the levels of IL-13 in BAL fluids increased after TiO
2 instillation concomitantly with the development of GCH and the increase of IL-13 was completely abolished by pretreatment with DEX (0.25 mg/Kg), but not by that with CPA (Figure
4). These results suggest that the elevation of IL-13 may be associated with particles such as TiO
2-induced GCH without any assistance of neutrophils or eosinophils. The in vivo effect of dexamethasone has been also demonstrated in allergic asthma model [
35]. Dexamethasone (4 mg / kg) effectively abolishes allergic airway inflammation in mice by suppression of IL-13 m-RNA and protein expression [
35]. The exact biochemical mechanism of GCH induction by IL-13 is not fully understood. One possible explanation is that IL-13 converts the bronchial epithelium from an absorptive to a secretory phenotype through loss of an amiloride-sensitive current and an increase in calcium-sensitive apical anion conductance [
36]. The increase in apical anion conductance in the airway epithelium is most likely due to the ability of IL-13 to induce expression of hCLCA1/mCLCA3, which encodes a calcium-activated chloride channel. This channel is necessary and sufficient for the development of GCH and mucus hypersecretion in some experiments [
37].
Besides Th2 cells, IL-13 is produced by mast cells, eosinophils [
38,
39], and macrophages [
40]. Since IL-13 was not decreased in rats of which eosinophils depleted by pretreatment of CPA (Figure
4), we can exclude eosinophils as the source of IL-13. Interestingly, serial thin section slides revealed that the IL-13 positive cells are mast cells, as shown by staining with toluidine blue. Also, we found the significant correlation between the IL-13 (+) rate of mast in tissue, concentration of IL-13 in BAL fluid and Muc5ac positive cells (Figure
5 and table
1). Based on these data, mast cells may be the cellular source for IL-13 present in the airways of TiO
2-treated rats. It is well known that mast cells produce IL-13 when stimulated with antigen [
39] and that the synthesis can be suppressed by dexamethsone [
20]. Our finding showed that TiO
2 instillation increased the numbers of IL-13 expressing mast cells and Muc5ac (+) goblet cells, both of which were decreased by dexamethsone pretreatment is a novel finding to our knowledge. It is not known whether TiO
2 – induced IL-13 overproduction is specific to TiO
2 or generally related to other particulates. However, base on the findings of particles such as diesel exhaust particles or carbon black particle – induced the deviation to Th2 environment in antigen sensitized lung [
11,
12], TiO
2 – induced GCH via over production of IL-13 may be a general finding attributed to the particulate matters, but it remains unproven.