Introduction
Acute myeloid leukemia (AML) is a relatively aggressive myeloid malignancy, typically accompanied by strikingly heterogenous outcomes [
1]. AML is characterized by abnormal proliferation of myeloid cells [
2] and accounts for high morbidity and mortality particularly among older AML patients, with poor prognosis [
3]. While the large majority of AML patients respond to chemotherapy, drug resistance remains a persistent problem and contributes to rising mortality [
4]. For example, arabinocytosine (AraC) serves as the backbone for AML therapy [
5]. However, treatment failure underlies approximately 50% of relapse incidence in AML [
6]. Therefore, understanding the mechanism of reducing the chemoresistance could help exert the antileukemic effects of AraC in AML regimens.
LncRNA maternally expressed gene 3 (MEG3) has a length of ~ 1.6 kb [
7], and downregulation of its expression may be associated with poor prognosis of AML patients [
8]. Moreover, MEG3 methylation has been shown as a potential biomarker of leukemia [
9], implying a putative high pathophysiological relevance in similar malignant conditions. Whether MEG3 has a role in mediating the chemotherapy efficacy in AML has not been researched. Notably, microRNA-lncRNA interactions are widely documented [
10]. The potential roles of miRNAs in AML pathogenesis have been documented in considerable analysis [
11]. Notably, aberrantly expressed miR-493-5p has been found correlated with hypermethylation of MEG3 in liver cancer cells and tissues [
12]. Altered expression of miR-493-5p has been observed in chronic myeloid leukemia cells [
13]. Gain-function assay of miR-493-3p could elevate the N6-methyladenosine (m6A) levels to downregulate YTH N6-methyladenosine RNA binding protein 2 in prostate cancer [
14].
Methyltransferase-like 3 (METTL3) serves as a main constituent of the m6A methyltransferase complex [
15]. Moreover, we found from the dataset analysis that METTL3 was enriched in T cell differentiation and methyltransferase complex and highly expressed in myeloid leukemia. METTL3 can mediate the myeloid differentiation of leukemia cells [
16]. Therefore, we speculated that MEG3/miR-493-5p/METTL3 might act as a network that affects the pathogenesis of AML in regulation of the anti-leukemic effect of AraC. Therefore, we aimed to explore their effects and identified their interaction as these investigations may enable the development of novel chemotherapy regimens for AML.
Materials and methods
Ethics
This study was ratified by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University. All participants or their guardians provided written informed consents prior to enrollment. Animal experiments were conducted in line with the Guide for the Care and Use of Laboratory Animals.
AML-related miRNA expression dataset GSE62137 was retrieved from the Gene Expression Omnibus database, including 3 normal samples (control) and 15 AML samples. Differential analysis was conducted using the R “limma” package (version 3.4.1) to screen the differentially expressed miRNAs with |log2FC|> 0.5 and adjusted p < 0.05 (PFDR < 0.05) as the threshold after multiple testing by the Benjamini and Hochberg method.
Differentially expressed genes (DEGs) in normal samples and AML samples from TCGA and GTEx databases were analyzed using “Differential Expression Analysis” module. miR-493-5p downstream genes were predicted using the mirDIP and TargetScan databases. Correlation analysis between miRNA and MEG3 in the AML samples in the TCGA database was performed using LinkedOmics.
DEGs were then subjected to gene ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analysis using the “clusterprofiler” package (version 3.14.3) in R software, followed by visualization of results with the “ggplot2” package (version 1.26.0). A p < 0.05 described statistically significant.
Collection of bone marrow samples
Bone marrow samples were extracted from 35 AML patients (20 males and 15 females). The enrolled patients were confirmed with AML in the light of the classification criteria of French, American, Britain (FAB), the World Health Organization (WHO), and the immunophenotypic and cytogenetic analysis. Patients conforming to the following criteria were enrolled in this study: (1) Patients diagnosed by FAB diagnostic criteria for AML; (2) Patients diagnosed by WHO diagnostic criteria; (3) Patients without autoimmune diseases; (4) Patients without historical records of exposure to toxic substances; (5) Patients without history of radiation or other malignancy; and (6) Patients without historical records of anti-leukemic therapy. Bone marrow samples from 35 health volunteers (24 males and 11 females; aged from 14–72 years, the bone marrow donors of hematopoietic stem cells) were served as the control. The detailed information is shown in Additional file
1: Table S1. Bone marrow samples were stored at − 80℃ before RNA purification.
Cell culture
Human AML cell lines (HL-60 and Molm13) and normal bone marrow cell line HS-5 (Meisen CTCC, Zhejiang, China) were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (GIBCO, California) replenished with 10% fetal bovine serum (FBS) at 37 °C in a 5% CO2 incubator.
Construction of AraC (PHR1787, Sigma) resistant cell line: AML cell lines were cultured under a gradual increasing dose of AraC (initial dose of 25 nM) for one year (AraC dose increased by about 6–10 times) to produce AML cell lines stably resistant to AraC (HL-60 R and Molm13 R). The successfully constructed drug-resistant cell lines were cultured in RPMI-1640 complete medium under a humid environment containing 5% CO2 at 37 °C.
Plasmid transfection and drug treatment
HL-60, Molm13, HL-60 R, and Molm13 R cells were seeded in a 6-well plate at a density of 3 × 105 cells/well. When reaching 50% confluence, the cells were transfected according to Endo-Porter delivery reagent from Gene Tools Inc (Philomath, OR). AraC was dissolved in PBS to the required concentration for culturing cells. The culture medium was changed after 6 h, and the cells were collected 48 h after transfection.
HL-60 and Molm13 cells were transfected with short hairpin RNA targeting negative control (sh-NC), sh-MEG3-1, sh-MEG3-2, inhibitor NC, miR-493-5p inhibitor, overexpression (oe)-NC, oe-METTL3, oe-MYC, AraC, mimic NC, miR-493-5p mimic, sh-METTL3, or sh-MYC.
HL-60 R and Molm13 R cells were treated with oe-NC, oe-MEG3, mimic NC, miR-493-5p mimic, sh-NC, sh-METTL3-1, sh-METTL3-2, sh-MYC-1, sh-MYC-2, AraC, oe-NC, inhibitor NC, miR-493-5p inhibitor, oe-METTL3, or oe-MYC.
The required plasmids or sequences were chemically synthesized by Shanghai GenePharma Co. Ltd. (Shanghai, China). The cells were collected after transfection for 48 h, then pre-incubated with AraC for 2 h, and finally used for subsequent experimentations. The silencing sequences are listed in Additional file
2: Table S2.
Lentivirus transduction
Molm13 and Molm13 R cells stably expressing luciferase (luc) and green fluorescent protein (GFP) were constructed. Firefly luciferase sequence after codon optimization was separated from pGL4.51 (E1320; Promega, Madison, WI) and cloned into the lentiviral vector pCDH-CMV-MCS-EFS-copGFP to produce pCDH-luc-CopGFP (#72,485; Addgene, Cambridge, MA), while pMIF-cGFP-Zeo-MEG3 (System Biosciences, Irvine, CA) was sub-cloned into the pGIPZ vector. Lentivirus was transduced into Molm13 and Molm13 R cells at a multiplicity of infection of 20. Then, 1 μg/mL puromycin was applied for 3 days to establish stable cells [
17].
Animal experiments
A total of 64 NSG mice (Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China) were housed in SPF animal laboratory individually with humidity of 60–65% at 22–25℃ under a 12 h light/dark cycle, free access to food and water. The mice were acclimated for one week.
Mice were injected with Molm13-luc-GFP AML cells treated with sh-NC, sh-MEG3, sh-NC + AraC, sh-MEG3 + AraC, oe-NC, oe-MEG3, oe-NC + AraC, or oe-MEG3 + AraC, respectively (n = 8 in each group).
NSG mice were intravenously injected with cells treated by Molm13-luc-GFP or Molm13 R-luc-GFP (2 × 106 cells/100 μL). After injection of the luciferase substrate colenterazine (BIOTIUM, CA), mice were subjected to anesthetization and non-invasively imaging using an in vivo imaging system (IVIS-200; Xenogen Inc., Alameda). Whole-body bioluminescence was quantified in the selected regions. After injection of AML cells for 7 days, mice were administered with AraC (100 mg/kg body weight) twice a week. The control mice were injected with PBS. At day 18, mice injected with AML cells were euthanized using CO2 asphyxiation.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted using TRIzol reagent (15596018, Invitrogen). miRNA and mRNA were reversely transcribed into cDNA with TaqMan™ MicroRNA RT Kit (4366596, Thermo Fisher Scientific) and High-Capacity cDNA RT Kit (4368813, Thermo Fisher Scientific), respectively. RT-qPCR was conducted using an ABI7500 quantitative PCR instrument (Thermo Fisher Scientific) with SYBR Premix Ex Taq™ (Tli RNaseH Plus) kit (RR820A, TaKaRa, Japan), where beta-actin (β-actin) and U6 were used as normalizers. The relative mRNA expression was determined using the 2
−ΔΔCt method. The primer sequences are shown in Additional file
3: Table S3.
Immunoblotting
Immunoblotting was performed with diluted antibodies (Abcam Inc., Cambridge, UK) against Bcl-2 (1: 1000, ab196495), Bax (1: 1000, ab32503), cleaved caspase-3 (1: 500, ab32042), and β-actin (1: 5000, ab8227) as well as goat anti-rabbit IgG antibody (ab97051, 1: 2000, Abcam) [
18].
Immunohistochemistry (IHC)
IHC was carried out with the help of the primary antibodies against MYC (1: 100, ab32072, Abcam) and METTL3 (1: 500, ab195352, Abcam). Finally, observation of sections was implemented under an inverted microscope (CX41, Olympus). Each sample was photographed randomly with 5 different visual fields. Dark brown indicated the target cell infiltration labeled by antibody. The target infiltration degree of each picture was analyzed by Image J software to draw the statistical result map.
Dual-luciferase reporter assay
The constructed METTL3 3’untranslated region (3’UTR) wild type (WT) and mutant type (MUT) (CUGAAGAGUGAUAUUACAUGUAU) gene fragments were introduced into pMIR-reporter (Huayueyang Biotechnology, Beijing, China) and co-transfected with human miR-493-5p mimic or NC-mimic into HEK293T cells (BN Biotech, Shanghai, China), respectively. After 48 h, the cells were lysed followed by the detection of the luciferase signal with Dual-Luciferase Reporter Assay System (Promega) and a Glomax20/20 luminometer (Promega).
Dot blot analysis
Total RNA extraction was performed with the help of the Trizol method followed by purification through PolyATtract mRNA Isolation Systems (No. A-Z5300, AD Technology, Beijing, China). Then, mRNAs were subjected to denaturation for 7 min under ultraviolet irradiation and placed on an Amersham Hybond-N+ membrane (GE Healthcare, Waukesha, WI) optimized based on nucleic acid transfer. After UV cross-linking, the membrane was subjected seal with 5% skim milk powder, and incubation with anti-m6A antibody (1: 5000, ab284130, Abcam) at 4 °C, followed by visualization using Immobilon Western Chemilum HRP Substrate (Merck Millipore, Darmstadt, Germany).
Me-RIP-qPCR
RIP assay was implemented with anti-m6A antibody (1: 500, ab151230, Abcam) and IgG antibody (ab109489, 1: 100, Abcam). RT-qPCR detection was carried out using Qiagen’s RT kit and × SYBR green qPCR Master Mix. Cycle threshold value was adopted to calculate the mRNA enrichment. The sequences for MYC-m6A were: Forward: 5′-GCATACATCCTGTCCGTCCA-3'; Reverse: 5′-TGAGCGAAAAAGAGGTTGCTG-3′.
Flow cytometry
Cell apoptosis measurement was performed utilizing FITC Annexin V Apoptosis Detection Kit I (556547, BD Biosciences, Franklin Lakes, NJ) through a flow cytometer (FACSVerse/Calibur/AriaIISORP, BD) [
19].
Cell counting kit-8 (CCK-8) assay
Cells under different treatments were seeded into 96-well plates (1 × 103 cells/well) in 100 μL medium containing 10% FBS. The number of cells was measured using a CCK-8 kit (CK04, Dojindo, Kumamoto, Japan) with absorbance at 450 nm with a microplate reader.
Statistical analysis
SPSS 21.0 software (IBM corporation, Armonk, NY) was applied for data analysis with the obtained data (from three independent repeated experiments) shown as mean ± standard deviation. Two group comparisons were studied by independent sample t test. Multiple group comparisons were carried out with one-way analysis of variance (ANOVA) and Tukey’s post-hoc test or repeated measures ANOVA and Bonferroni’s post hoc test. Correlation was studied using Pearson’s correlation coefficient. p < 0.05 manifested statistical significance.
Discussion
AML is a complicated disease attributed to the considerable molecular diversity of AML, the older age of the majority of AML patients, and, more commonly, resistance to treatment [
25]. Targeting the resistance to treatment, efforts are increasingly directed towards increasing sensitivity to chemotherapy, among which analysis of the lncRNA-miRNA regulatory network can help identify molecules of prognostic or therapeutic relevance in AML [
26]. Our study thus focused on the regulatory network of MEG3/miR-493-5p/METTL3 in AML, aiming to determine a target pathway that could potentially be leveraged to enhance the sensitivity of AML cells to chemotherapy.
As a prior study showed, an inhibitory effect of MEG3 on the onset and progression of AML has been identified [
20]. Low expression of MEG3 has been detected in AML cells [
27]. Consistently, we also found that MEG3 was poorly expressed in AML cells and tissues and that MEG3 overexpression could induce the apoptosis of AML cells while repressing their viability. It was shown that overexpressed MEG3 could elevate the expression of Bax, and cleaved caspase-3 but reduce that of Bcl-2, further demonstrating its pro-apoptotic effect. Bax, and cleaved caspase-3 are known as pro-apoptosis markers while Bcl-2 is considered as an anti-apoptosis marker [
28]. Furthermore, we found that overexpressed MEG3 could promote the sensitivity of AML cells to AraC. AraC is the key element of all cytostatic AML treatments [
29]. The theoretical basis for AraC therapy was developed in the 1970s and has since been utilized in AML treatment [
30]. The findings of this study demonstrated that overexpressed MEG3 and AraC facilitated the apoptosis of AML cells treated with AraC.
Furthermore, the pertinence between MEG3 and miR-493-5p in AML was studied with positive relation found. Such correlation has been reported earlier, where the silencing of miR-493-5p was related to MEG3-DMR hypermethylation [
12]. In addition, MEG3 can inhibit the proliferation of neural stem cells after ischemic stroke via positive regulation of miR-493-5p [
31]. However, interactions between MEG3 and miR-493-5p impacting AML cells have not been identified before. Our study proposed that overexpressed MEG3 promoted miR-493-5p expression to further heighten the sensitivity of AML cells to AraC. Interestingly, the depletion of miR-493 is capable of inducing the resistance to cisplatin in lung cancer cells by TCRP1 [
32]. Consistently, here we found that the inhibition of miR-493 could reverse the promotive effects of MEG3 on the sensitivity of AML cells to AraC by restraining AML cell apoptosis.
Data collected from the starBase database and luciferase reporter assay revealed that miR-493-5p might target METTL3 and downregulate its expression. Emerging evidence demonstrates that miRNAs can interact with the 3’UTR of specific target mRNAs and subsequently result in inhibition of their expression [
33,
34]. This represents the first evidence for the post-transcriptional regulation of METTL3 by miR-493-5p in AML cells and might have importance in regulating AML progression. METTL3 is able to mediate myeloid differentiation of leukemia cells [
16]. Increased sensitivity to anticancer reagents including 5-fluorouracil and cisplatin, and irradiation has been observed in METTL3-depleted pancreatic cancer cells [
35], which is consistent with our findings showing that METTL3 knockdown could enhance the sensitivity of AML cells to chemotherapy. This study also demonstrated that METTL3 promoted MYC expression through MYC m6A methylation. METTL3 can induce m6A modification of MYC mRNA and consequently increases its expression in bladder cancer [
23]. Overexpression of MYC has been demonstrated to exacerbate the resistance of AML cells to chemotherapy [
24], which is in line with our findings. Conclusively, we reasoned that the loss of miR-493-5p could elevate METTL3 expression, which promoted MYC expression and, furthermore, the resistance of AML cells to AraC. This finding was validated in the AML cells by performing rescue experiments. Finally, animal experiments substantiated the anti-tumor effect of MEG3 and its promotive effect on the sensitivity to chemotherapy. It was also verified that MEG3 exerted an effect through miR-493-5p-dependent inhibition of METTL3 and subsequent suppression of MYC.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.