Background
Facet-Joint Osteoarthritis (FJ-OA) is a common degenerative disease of the lumbar spine accounting for 15–45% of lower back pain (LBP) in 10–15% of young adults with chronic LBP and up to 40% of the older population with pre-existing trauma [
1,
2].The spinal unit consists of intervertebral disc and the facet joint (FJ) [
3]. Different from intervertebral disc, facet joints are the only synovial joints in the spine. Because of its special anatomical structure and location, facet joint play an important role in lumbar spine mobility regulating upper and lower vertebral body activity range, as well as maintaining intervertebral disc stability [
2]. Because of their involvement in rotational kinematics, mobility, and force distribution in the lumbar spine, FJs are susceptible to degenerative changes and also considered as a main cause of low back pain and disability [
1,
4,
5] Current treatment is limited to surgical intervention and analgesic drugs all of which cannot halt dieases progression. Many studies suggested that Wnt/β-catenin signaling pathway plays a critical role in osteoarthritis [
6‐
8]. Di et al. [
9,
10] observed that β-catenin levels were increased in human OA samples, and β-catenin conditional activation (cAct) mice which specifically over-express β-catenin gene in articular chondrocytes showed osteoarthritis-like phenotype and severe defects in intervertebral disc tissue. Janine et al. [
11] report that, in FJ-OA patients the number of beta-catenin-positive chondrocytes in facet joint was significantly increased. In this study we observe that the mice show FJ-OA like phenotype, therefore combined with previous research we use this genetically modified mouse as our FJ-OA animal model.
Velvet antler (
Cervi Cornu Pantorichum) is deer immature-ossification horn with thick hair. According to “Compendium of materia medica”, Velvet antler has been used in traditional Chinese medicine for invigorating the kidney, nourishing bone and prolonging life according. Velvet Antler Polypeptide(VAP)is a active compounds extracted from Velvet Antler (VA). Nowadays VAP is widely used to enhance sexual functioning, inhibit inflammation, promote chondrocyte proliferation and delay the aging process [
12‐
16]. However, the research about the effects of VAP on facet joint osteoarthritis and its biochemical mechanism remains limited. VAP treated chondrocytes exhibits a reduction in metalloproteinases secretion, a balanced cartilage matrix metabolism Furthermore VAP treated chondrocytes exhibits a reduction in the proportion of early apoptotic cells suggesting VAP could play a role of the apoptotic pathway in osteoarthritic chondrocytes [
17]. Based on the following data, we hypothesize VAP may partially rescue β-catenin conditional activation mice FJ-OA-like phenotype by the ECM. In this study, we were able to show VAP partially rescue of β-catenin conditional activation mice facet joint osteoarthritis-like phenotype and relieve the pain related behavior. VAP acts by modulating ECM through the inhibition of MMP13, ADAMTS4 and ADAMTS5 via Wnt /β-catenin signaling pathway and this may be the biochemical mechanism.
Materials and methods
Animals
Mice were generously provided by Pro. Di Chen (Rush university medical center, Chicago, IL,USA). In order to activated β-catenin gene in articular chondrocytes,
β-catenin(ex3)Col2ER mice were generated by breeding
β-catenin(ex3)flox/flox mice with
Col2-CreERT2 transgenic mice [
18,
19].
β-catenin(ex3)Col2ER mice were originally observed by Pro. Chen [
9,
10] they find out this mice model exhibits osteoarthritis-like phenotype in the lumbar disc and knee joint. After tamoxifen (TM) induction, β-catenin gene is overexpress in chondrocyte specific cell in this transgenic mice model. The research was approved by the ethics committee of Liaoning University of Traditional Chinese Medicine experimental animal ethics committee (Shenyang, China). All the mice were housed in a climate-controlled environment (22 ± 1 °C) and had free access to food and water. Mice were sacrificed by overdose anesthesia with sodium pentobarbital (100 mg/kg, IP). Fifty mice were divided into 5 groups of 10 mice per group, mixed sex are used in different groups. Groups included VAP different dosage treatment groups, OA model group and a control group. Mice were injected with TM (1 mg/10 g body weight/day, IP, daily for 5 consecutive days) at 2 weeks old. Control group is WT mouse (cre negative littermates), other 4 groups are cre positive mice with different treatment. After 2 month of normal feeding, 3 groups of cre positive mice were administered different concentrations of VAP (20 mg/kg, 40 mg/kg and 80 mg/kg body weight, IP) daily for 4 weeks, while OA model group and control group were injected with saline (Table
1)
Table 1Mice group name, strain and treatment
Control group | Cre- littermates | normal saline 4 weeks(i.p.) |
Model group | β-catenin(ex3)Col2ER | normal saline 4 weeks(i.p.) |
VAP low dose group | β-catenin(ex3)Col2ER | 20 mg/kg VAP 4 weeks(i.p.) |
VAP medium dose group | β-catenin(ex3)Col2ER | 40 mg/kg VAP 4 weeks(i.p.) |
VAP high dose group | β-catenin(ex3)Col2ER | 80 mg/kg VAP 4 weeks(i.p.) |
Drug
The drug used in this study was the Velvet Antler Polypeptide which was identified and extracted from the Red deer antler (Cervus elaphus Linnaeus) by Pro. Feng Li (School of Pharmacy, Liaoning University of TCM, Shenyang, China) (Data Unpublished).First, we carefully removed the villi of the antler, sawing antler into pieces and crushing them into grains. Water was used as the solvent to combine ultrasonic extraction with ethanol precipitation. To maximize VAP extraction and purification, the L9 (34) orthogonal design experiment was carried out by using Bradford protein assay to determine the content of valvet antler polypeptides as the evaluation index. According to the orthogonal test result, the water extraction optimum technological conditions is as follows, size (80–100 mesh), solid-liquid ratio(1:12), extract 3 times, 20 min each time. We then used the Kay nitrogen analyzer to detect the content of protein polypeptide on antler powder and water residue after extraction. This step was to further verify the result of Bradford protein assay. After water extraction we used alcohol precipitation technology to extract VAP, the relative concentration of the liquid was 0.5 g/ml (crude drug), concentration of ethanol was 65%, precipitate time was 4 h. Tricine-SDS-PAGE gel electrophoresis analysis showed 9 higher resolution bars. Then we used different MFL-B membrane(PP-100、PS-50、HPS-10、HPS-5、HPS-3) to separate and purify VAP at different concentrated solutions weight different molecular weight. The highest content VAP fragment under 10 kDa is 3-5 kDa (20.6%), therefore we chose VAP (3-5 kDa) as our experiment drug. At last, 3–5 kDa VAP concentrated solution was placed in - 80 °C Ultra-low temperature refrigerator (DW86W100, Haier, China) for 24 h, and then put in lyophilizer ALPHA 1-4Dplus(CHRIST, German) for 46 h to get lyophilized powder. With the pre-column derivatization method, the contents of amino acids in the velvet antler peptide segment was determined by amino acid analyzer and ODS column. The column temperature was set at 27 °C, wavelength was 360 nm and flow rate was 1.2 mL/ min. The results indicate that the correlation coefficients of amino acids in velvet antler peptide segment were all greater than 0.997.The precision, stability and repeatability of RSD were less than 3% and the recovery was all between 96.6–104.7% with RSD less than 2.4%. The content of binding amino acid in 3-5 kDa VAP is 266.3 mg/g, the content of binding essential amino acid in 3-5 kDa VAP is 39.5 mg/g.
Micro-computed tomography (μCT)
Spine tissues from 5 groups were subjected to analysis of the changes in bone structure using a μCT 80 Specimen micro-computed tomography scanner (Scanco Medical, Brüttisellen, Switzerland) with a 55 kVp source and a 72 μAmp current. We scanned the lumbar spine at a resolution of 10 μm. The scan images from each group were evaluated at the same thresholds to allow 3-dimensional structural rendering of each sample.
Histology and Histomorphometry
After μCT analysis, part of disc tissues was frozen with liquid nitrogen immediately for western-blot and RT-PCR analysis. Part were fixed in 10% NB-formalin for 3 days, decalcified in 14% EDTA for 14 days, and then embedded in paraffin. Several facet joint sections (3 μm thick) were cut for histology and IHC analysis. Histology test was stained with Alcian Blue Hematoxylin/Orange G (ABH/OG).
Histomorphometry measurements were performed using OsteoMeasure software (OsteoMetrics, Inc. Atlanta, GA, USA). Alcian blue-stained articular cartilage areas were outlined on projected images of each histology section to show facet joint’s articular cartilage area.
Immunohistochemistry (IHC) and immunofluorescence (IF) analysis
IHC analysis was performed using non-phospho (active) β-catenin (Ser45) (1:800 dilution; CAT#:19807, Cell signaling technology, USA), collagen II antibody (1:200 dilution; CAT#: ab34712, abcam, Britain).
IF analysis detected MMP13 antibody (1:300 dilution; CAT#: ab39012, abcam, Britain), Admts4 (1:400 dilution; CAT#:ABT178, Millipore, Billerica, MA), and Adamts5 antibody (1:500 dilution; CAT#: ab41037, abcam, Britain).
Western-blot
Lumbar disc tissues were ground in liquid nitrogen. Total protein was extracted using RIPA buffer (Beyotime, Biotechnology). Sample was separated in 10% SDS-PAGE and transferred to a PVDF membrane then subjected to immunoblotting with non-phospho (active) β-catenin antibody (1:200 dilution) overnight. HRP conjugated secondary antibodies (1:10000 dilution; Vazyme, Biotech) for 1 h and the protein existence was detected by ECL (Beyotime, Biotechnology).
Total RNA extraction and real-time RT-PCR analysis
Lumber disc tissues were harvested to extract total RNA using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Total RNA was used to synthesize cDNA by GoTaq® 1-Step RT-qPCR System (CAT#:A6001, Promega, USA). Primer names and sequences for real-time PCR are listed in Table
2.
Table 2RT-PCR primer sequence
GAPDH F | GACATGCCGCCTGGAGAAAC |
GAPDH R | AGCCCAGGATGCCCTTTAGT |
mmp13 F | GCAGCTCCAAAGGCTACAA |
mmp13 R | CATCATCTGGGAGCATGAAA |
Adamts4 F | GGCAGATGACAAGATGGCAGCATT |
Adamts4 R | AGACGAGTCACCACCAAGTTGACA |
Adamts5 F | CCAAATGCACTTCAGCCACGATCA |
Adamts5 R | AATGTCAAGTTGCACTGCTGGGTG |
Statistical analysis
Data were regression analysis with SPSS13.0 by one-way ANOVA. Results were considered significantly different at P < 0.05 or P < 0.01. Values are expressed as mean ± standard deviation (SD).
Discussion
Deer antler is a precious traditional Chinese medicine. According to compendium of materia medica, deer antler is deer unossified juvenile horn, with a rate of 1, 2 cm daily rapid growt. It can complete the whole process from bone cell differentiation development to mature in just 90 days, making it an effective and readily available treatment for invigorating the kidney, nourishing the blood, bones and bone morrow. Some researches indicate the VAP has an effect on the apoptosis of chondrocytes and may inhibit reduction of glycosaminoglycan and type II collagen in cartilage matrix. But the animal study remains scarce due to lack of mice model.
In the former study we examined β-catenin expression in patients with disc degeneration and we found that β-catenin protein was up-regulated in most disc samples, especially in the area with chondrocyte cluster formation. Furthermore, we have demonstrated that OA and IVD degeneration can occur through activation of Wnt/β-catenin signaling. β-catenin is the critical modulator in Wnt/β-catenin signaling pathway. In our study, we showed VAP cause continuous β-catenin degradation which prevents β-catenin accumulation and translocation to the nucleus. But how VAP inhibit β-catenin expression needs further exploration, therefore in vitro experiment should be perform to mimic the in vitro experimental.
Facet joints are the only synovial joint at the spine that contains in intervertebral joint. Two facet joints of the posterior column and one endplate-disk endplate joint of the anterior column formed intervertebral joint as a three-joint complex. Because of the high level of mobility and the large forces influencing lumbar FJ [
2], FJ-OA is one of the main cause of low back pain and can result in immobility in the patients. The intervertebral disk and the facet joints interactively degenerate, causing altered stresses on the integrity and mechanical properties of the spinal ligaments, which results in degeneration of the spinal unit as a whole [
20‐
22].
Articular cartilage contains chondrocytes and ECM secreted by chondrocytes. ECM mainly consist of collagen(mostly are typy II callagen) and proteoglycans (aggrecan is the main form). Collagen II, IX and XI connected to form a web, then proteoglycan fill in the web gap and bind to a large amount of water, these all work together to ensure the structural integrity and elasticity of articular cartilage. Aggrecanases and collagenase are key enzymes related to the degradation of ECM [
23]. ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs), are extracellular, multidomain enzyme [
24], among the family members, ADAMTS4 (aggrecanases-1) and ADAMTS5(aggrecanases-2) make the most contribution to aggrecan degradation [
25‐
27]Besides ADAMTSs,,matrix metalloproteinases (MMPs) is another key enzyme, the process of collagen cleavage is mainly regulated by MMPs [
28]. MMP13 is one of the most important MMPs, it cleaves fibrillar collagens with preference to type II collagen over type I and III collagens, and displays stronger gelatinase activity than other MMPs [
29,
30] In this case, we displayed that VAP could partially modulate ECM synthesis by down regulate MMP-13, ADAMTS-4 and ADAMTS-5 mRNA expression, thus rescuing FJ-OA like phenotype suggesting VAP might be a potential medicine for FJ-OA .
Conclusion
Taken together, VAP may modulate ECM by inhibits MMP13, ADAMTS4 and ADAMTS5 via Wnt /β-catenin signaling pathway. Velvet Antler Polypeptide may be a potential medicine for FJ-OA. Both inflammatory factors and nerve growth factors should be test to explore the mechanism of VAP release mice pain related behavior in our further study.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.