nach oben

Erschienen in:

Open Access 01.12.2023 | Research

Virome of wild rats (Rattus norvegicus) captured far from pig farms in Jiangsu province of China reveals novel porcine circovirus type 2d (PCV2d) sequences

verfasst von: Min Zhao, Siwen Bao, Diandian Xu, Jingxian He, Han Zhang, Likai Ji, Shixing Yang, Xiaochun Wang, Quan Shen, Jia Liu, Qing Zhang, Xiao Ma, Wen Zhang, Tongling Shan

Erschienen in: Virology Journal | Ausgabe 1/2023

Abstract

Background

Porcine circovirus type 2 (PCV2) has caused great economic losses in the global pig industry. There have been published records of wild rats acting as the reservoirs of PCV2 (only PCV2a and PCV2b), but almost all of which were related to the PCV2-infected swine herds.

Results

In this study, we carried out the detection, amplification, and characterization of novel PCV2 strains in wild rats that were captured far from pig farms. Nested PCR assay demonstrated that the kidney, heart, lung, liver, pancreas, and large and small intestines of rats were screened positive for PCV2. We subsequently sequenced two full genomes of PCV2 in positive sample pools, designated as js2021-Rt001 and js2021-Rt002. Genome sequence analysis indicated that they had the highest similarity to nucleotide sequences of porcine-origin PCV2 isolates in Vietnam. Phylogenetically, js2021-Rt001 and js2021-Rt002 were a part of the PCV2d genotype cluster, which is a predominant genotype circulating worldwide in recent years. The antibody recognition regions, immunodominant decoy epitope, and heparin sulfate binding motif of the two complete genome sequences coincided with those previously reported.

Conclusions

Our research reported the genomic characterization of two novel PCV2 strains (js2021-Rt001 and js2021-Rt002) and provided the first supported evidence that PCV2d could naturally infect wild rats in China. However, whether the newly identified strains have potential for circulating in nature in vertical and horizontal transmission or inter-species jumping between rats and pigs needs further research.

Additional file 1: Table S1. Genomic sequences of the detected viruses

Additional file 2: Data on detected viral genomic sequences

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s12985-023-02005-2.

Min Zhao and Siwen Bao have equally contributed to this work

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Amino acid

dsDNA

Double-stranded DNA

dsRNA

Double-stranded RNA

Maximum-likelihood

NCBI

National center for biotechnology information

NGS

Next-generation sequencing

nPCR

Nested PCR

Non-redundant protein

Nucleotide(s)

Non-redundant nucleotide

PCV2

Porcine circovirus type 2

PCVAD

PCV-associated disease

PDNS

Porcine dermatitis and nephropathy syndrome

PMWS

Post-weaning multisystemic wasting syndrome

PRDC

Porcine respiratory disease complex

Q30

Phred quality score 30

SRA

Sequence read archive

ssDNA

Single-stranded DNA

ssRNA

Single-stranded RNA

Background

Porcine circovirus type 2 (PCV2) is a small, non-enveloped, single-strand circular DNA (ssDNA) virus with 1766–1768 nucleotides (nt) in length, classified under the genus Circovirus in the family Circoviridae [1]. PCV2 was first isolated from tissues of pigs in western Canada in 1998, many more PCV2 isolates have been reported worldwide since then, posing a continuing threat to veterinary public health [2]. PCV2 can cause a group of diverse multi-factorial syndromes in domestic pigs and wild boars across the globe, collectively named PCV-associated diseases (PCVADs), such as post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephropathy syndrome (PDNS), porcine respiratory disease complex (PRDC), enteritic disease, and reproductive failure [3‐6].

PCV2 is known for its high rates of infection, transmission, and mutation together with inter- and intra-genotype recombination, which is considered to be an important evolutionary mechanism for the emergence of new genotypes [7‐10]. Compared with other DNA viruses, PCV2 has a higher evolutionary rate (1.21 × 10⁻³ to 6.57 × 10⁻³ substitutions/site/year) [4, 11]. Currently, PCV2 has been classified into eight genotypes, PCV2a to PCV2e, and the newly reported PCV2f, PCV2g, and PCV2h [12, 13], of which only three genotypes (PCV2a, PCV2b, and PCV2d) have a persistent and broad worldwide distribution, especially in pig-producing countries, causing significant economic losses and veterinary public health issues [12, 14‐16].

Domestic pigs and wild boars are generally considered as the natural reservoirs of PCV2. But currently, the known host range of this virus has expanded to humans [17] and other non-porcine mammals (such as bovids, minks, foxes, dogs, raccoon dogs, goats, rats, and mice) [18‐25], making it more conducive to virus transmission and prevalence. Experimental mice are generally used as the model to investigate the role of rodents in carrying, replicating, and transmitting PCV2 [19, 26‐29]. It has been reported that PCV2 (genotypes PCV2a and PCV2b) can frequently spillover from pigs to rodents on pig farms [20, 30, 31]. However, there was no report on the presence of the currently predominant genotype PCV2d in wild rats and PCV2 infection in rats outside pig farms. In this study, two PCV2d strains were identified from wild rats (Rattus norvegicus) captured far from pig farms in Jiangsu province, China. This finding provided the first evidence that genotype PCV2d has the capacity to naturally infect rats.

Methods

Sample collection, library construction, and next-generation sequencing

In June 2021, a total of 14 tissue samples from two wild rats identified as Rattus norvegicus based on the mitochondrial 12S rRNA and 16S rRNA genes were collected in Jiangsu province. Here the tissue samples were treated as described in our previous research [32] in a biosafety level 2 facility according to strict operating procedures to avoid possible laboratory environment, reagent, and cross-sample contamination. All nucleic acid samples from the same individual were combined into one pool. The total nucleic acid was extracted using QIAamp Viral RNA Mini Kit (QIAGEN) according to the manufacturer’s protocol. Briefly, the nucleic acid sample pools were used for viral metagenomic library construction as described in our previously published papers [32‐34]. To exclude the possibility of cross-library contamination, a blank control, sterile ddH2O (Sangon, Shanghai, China) was prepared and going through the entire library preparation process. Afterward, two rat libraries along with a control library were sequenced on the Illumina NovaSeq 6000 platform with 250 base paired-end reads with dual barcoding.

Bioinformatic analyses

For bioinformatics analyses, the generated reads were debarcoded using vendor software from Illumina. Clonal reads were removed, and low sequencing quality tails were trimmed using Phred quality score 30 (Q30) as the threshold. The cleaned reads were de novo assembly using the Geneious Prime (v2019.2.3) [35]. To find viral-related sequences, the assembled contigs and singlet sequences were then matched against the NCBI non-redundant nucleotide (NT) and protein (NR) databases using BLAST (E-value < 10⁻⁵) [36]. Candidate viral hits were then compared to a non-virus non-redundant protein database to remove false positive viral hits.

PCR detection and amplification of the whole genome of PCV2

We designed nested PCR (nPCR) primers for PCV2 screening and full-genome acquisition based on the assembled PCV2-related contigs and the best hits of them to nucleotide sequences in the NCBI database. Three sets of specific nPCR primers were used to generate three overlapping fragments. Primers used in this study are listed in Table 1. The nPCR conditions are as follows: 95 °C for 5 min for initial denaturation, 31 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C (first round) or 60 °C (second round) for 30 s, and elongation at 72 °C for 40 s, ended with a final elongation at 72 °C for 5 min. PCR products of fragments were purified with MiniBEST Agarose Gel DNA Extraction Kit (TakaRa, Dalian, China), subcloned into the plasmid pMD™-18T vector (TaKaRa, Dalian, China), and subsequently transformed into competent Escherichia coli DH5α cells (TaKaRa, Dalia, China). At least three positive clones of each fragment were sent to Sangon Biotech for Sanger sequencing. Subsequently, the sequencing data were reassembled to generate the complete genomes of PCV2 in Geneious Prime.

Table 1

The primers of nested PCR used for detection and amplification of the PCV2 genome

Fragment	Primer name	Application	Primer sequence (5′–3′)
1	1WF/1NF	1st and 2nd round	TGCTGTGAGTACCTTGCTGG
1	1WR	1st round	CCGTGGATTGTTCTGTAGCA
1	1NR	2nd round	GTAGATCATCCCAGGGCAGC
2	2WF^a	1st round	TGCTGTGAGTACCTTGCTGG
2	2WR^a	1st round	CCATCTTGGCCAGATCCTCC
2	2NF^a	2nd round	GCAGACCCGGAAACCACATA
2	2NR^a	2nd round	GAATGTGGACATGATGAGAT
3	3WF	1st round	GGGTTATGGTATGGCGGGAG
3	3WR	1st round	CAAACGTTACAGGGTGCTGC
3	3NF	2nd round	ATAACAGCAGTGGAGCCCAC
3	3NR	2nd round	CCAGCAAGGTACTCACAGCA

^aThe primers were also used to detect the tissue distribution of PCV2 in wild rats

Phylogeny of viruses and data analysis

All genome and protein sequence alignments were performed using ClustalW in MEGA11 (v11.0.11) [37] with the default settings. The phylogenetic tree of complete genome nucleotide sequences was constructed using the Maximum-likelihood (ML) method in MEGA11 with 1000 bootstrap replicates under the TN93 substitution model and gamma-distributed with invariant sites (G + I). The phylogenetic tree of PCV2 ORF2 genes was generated with the best-fit TN93 + G nucleotide substitution model. Multiple sequence alignment of ORF2-encoded Cap protein amino acid (aa) sequences of PCV2d strains were visualized with JALVIEW (v2.11.2.2) [38].

Results

Virome analysis and identification of rat-associated PCV2

All rat tissue samples were divided into two pools/libraries (Rt001 and Rt002) for next-generation sequencing (NGS), generating a total of 4,309,426 reads, among which 14.20% (n = 611,831) reads showed similarity to known eukaryotic viruses. The remaining 85.80% (n = 3,697,595) of sequencing data aligned to eukaryotes or prokaryotes, bacteriophages and those with no significant similarity to any aa sequence in the NR database. The blank control library generated a small number of raw reads (n = 13,668) which were free of viral sequences. At the family level, eukaryotic viral reads were classified into two families of double-stranded DNA viruses (dsDNA virus: Adenoviridae and Herpesviridae), four families of single-stranded DNA viruses (ssDNA virus: Anelloviridae, Circoviridae, Genomoviridae, and Parvoviridae), two families of double-stranded RNA viruses (dsRNA virus: Reoviridae and Partitiviridae), nine families of single-stranded RNA viruses (ssRNA virus: Astroviridae, Chuviridae, Nodaviridae, Dicistroviridae, Iflaviridae, Picornaviridae, Polycipiviridae, Virgaviridae, and Solemoviridae), Retroviridae family and unassigned viruses (Fig. 1). Compared to RNA viruses, a relatively small number of reads (n = 702) were identified as being homologous to DNA viruses. In particular, BLASTx analysis revealed two contigs assembled from the reads in the family Circoviridae of Rt001 and Rt002 with 665 and 208 nt in length, exhibiting extremely high identity to PCV2 at the nucleotide level (99.85% and 100.00%, respectively).

PCV2 detection and generation of the whole genome of rat-associated PCV2

To determine the tissue distribution and genome sequence of PCV2 in the infected rats, a total of 14 nucleic acid samples were screened using the nPCR method. The PCR results showed that half of the 14 tissue samples were positive for PCV2. The positive tissue types included the kidney, heart, lung, liver, pancreas, and large and small intestines. Two distinct rat-associated PCV2 (namely js2021-Rt001 and js2021-Rt002) genomes of 1767 nt in length were amplified and sequenced successfully from positive samples from different individuals. Their G + C contents are 48.4% and 48.6%, respectively. Three open reading frames, ORF1 (945 nt), ORF2 (705 nt), and ORF3 (315 nt), in the two genomes were of the same length (Fig. 2). Pairwise-sequence alignment analysis indicated that js2021-Rt001 and js2021-Rt002 were closely related to each other, sharing 99.26% nucleotide sequence identity (13 nt differences) in full genome sequences, 99.37% (6 nt differences) in their ORF1 sequences and 99.01% (7 nt differences) in their ORF2 sequences. BLASTn analyses indicated they showed the highest nucleotide sequence identity, 99.77% and 99.55%, respectively, with the complete genome of porcine-origin PCV2 strains Han8 (GenBank no. JQ181600) and PCV2/PhuTho/G40312/2018 (GenBank no. LC602996).

Evolutionary relationship of rat-associated PCV2

A total of 77 PCV2 representative genome sequences were downloaded from the GenBank database to determine the genetic relationships of the newly discovered PCV2 strains. Owing to the competence to reconstruct the same tree as the full genome, ORF2 is also used as a phylogenetic marker for PCV2 strains. Pairwise-sequence comparisons of complete genomes and ORF2 gene sequences revealed that the nucleotide sequence identity between the two rat-associated PCV2 strains and 77 reference strains varied from 91.79% to 99.77% and 82.71% to 99.72%, respectively. Phylogenetic analyses revealed that the two complete genome sequences in Jiangsu province belonged to the recently prevalent genotype PCV2d, but js2021-Rt002 formed a monophyletic branch in both trees (Fig. 3).

ORF2 sequence comparison

Compared to amino acid sequences of other PCV2d isolates (n = 23), the 234 aa encoded by the ORF2 genes of the two novel rat-associated circoviruses were relatively conservative without any specific substitution (Fig. 4). In this study, we tried to examine the typical motifs ⁵³IGYTVK⁵⁸, ¹³⁰VTKAN¹³⁴, and ¹⁸⁵LRLQTT¹⁹⁰ for PCV2d instead of ⁸⁶SNPLTV⁹¹ which is also present in PCV2c strains [39]. Consistent with previous studies, four antibody recognition domains (labeled as epitopes A–D), an immunodominant decoy epitope within epitope C, and a heparin sulfate binding motif were observed in the predicted amino acid sequences of the two rat-associated PCV2d Cap proteins [40‐42]. As previously reported [41], we also identified key residues within the four epitopes: D-70, M-71, N-77 and D-78 in epitope A, Q-113, D-115 and D-127 in epitope B, Y-173, F-174, Q-175 and K-179 in epitope C, and E-203, I-206 and Y-207 in epitope D. Remarkably, there was one amino acid difference (R/G-169) in the immunodominant decoy epitope between js2021-Rt001 and js2021-Rt002.

Discussion

Rodents rank as the largest mammalian species (approximately 43% of all mammal species). They are widely distributed and the natural reservoirs of a diverse group of pathogenic viruses [43]. In our study, the classified eukaryotic viral reads were mainly related to the genus Picornavirales occupying 97.31% (n = 595,373) of the total reads, while most of which were assigned to the family Dicistroviridae (n = 313,196) and picorna-like viruses (n = 236,984) of probable insect and environmental origin. A total of 21 viral sequences were subsequently characterized in the two rat pools after extension of contigs and nPCR amplification (Additional file 1: Table S1 and Additional file 2). Pairwise-sequence comparisons showed that these sequences shared sequence identities with their closest genetic relatives ranging from 42.2% to 99.8% at the nucleotide level, and their lengths ranged from 431 to 9787 nt. Apart from invertebrate, plant and uncultured environmental viruses, several vertebrate-infecting viral sequences were detected, including anellovirus, picornavirus, astrovirus, and retrovirus sharing > 80% nucleotide identity with previously reported viruses in rats or rat cells [44‐46], together with porcine circovirus 2, known as pathogenic to pigs [47].

At present, porcine epidemic virus, PCV2, is one of the most economically important swine pathogens that has a significant impact on animal performance and production [48]. Prior to 2003, PCV2 was dominated by the PCV2a genotype [49]. On a global scale, the first genotype shift from PCV2a to PCV2b occurred around 2003 [50]. Since 2009, there has been a second genotype shift in the predominant prevalence of PCV2 [51]. Until now, PCV2d has been the predominant genotype in swine populations in China, North America, South Korea, and Uruguay [52, 53]. Since China is known for only importing swine, the reason for this genotype's global popularity remains unclear. In recent years, several studies have investigated the epidemiology of PCV2d in pigs in China: Henan, where 1283 (72.90%) of the 1760 tested samples were PCV2 positive and 47.06% (8/17) of the discovered strains belonged to PCV2d [53], Yunnan, where the percentage of PCV2 positive samples was 60.93% (170/279) and 80% (12/15) of the isolates were PCV2d [54], shanghai, in which 104 out of 199 (52.26%) were screened positive for PCV2d [52], and Jiangsu, where 34 of the 120 (28.33%) tested samples were PCV2 positive and PCV2d accounted for 47.06% of the 34 isolates [55]. The epidemiological data reveal that PCV2d has been circulating in pig-producing provinces of China for many years and recognized as a severe threat to the Chinese pig industry.

Phylogenetic trees constructed based on the full genome and ORF2 sequences showed that the two rat-associated PCV2 strains in this study belonged to the genotype PCV2d. When using js2021-Rt001 and js2021-Rt002 as query sequences, the closest hits in the BLASTn search were both the porcine-origin PCV2 isolates in Vietnam. Meantime, the detection of other genotypes in rodents inhabiting PCV2-infected pig farms [20, 30, 31] makes possible cross-species transmission of the PCV2d between porcine and rodent hosts. PCV2 ORF2 gene encodes the capsid protein, the major immunogenic protein involved in virus attachment to the host cellular receptor(s) and immune responses [40]. No aa changes were found in previously reported antibody recognition domains, an immunodominant decoy epitope, and a heparin sulfate binding motif of the rat-associated PCV2d Cap proteins [40‐42]. Meantime, the ORF2 sequences of js2021-Rt001 and js2021-Rt002 were 100.00% aa identical to the Vietnam isolates, Han8 and PCV2/PhuTho/G40312/2018, respectively. Even with these evidence, the origin of the viruses remains elusive and further studies are required to confirm the potential cross-species transmission of diverse genotypes PCV2 existing between rat and porcine hosts.

It has been demonstrated that PCV2 could replicate in mice with distribution in multiple organs [26, 27, 31]. In this study, multiple tissue samples were found positive for PCV2, indicating that the two PCVs were capable of infecting the wild rats rather than only passing through the gut. Of particular note, the two highly similar PCV2 strains were present in samples collected from two wild rat individuals on different dates at the adjacent sampling sites. Horizontal and vertical transmissions were confirmed to be efficient ways for PCV2 onward spread among rodent populations [19]. This suggests the possibility of the long-term prevalence of PCV2 in the local rat populations.

PCV2 host jumps may also be a potential threat to human health. Zoonotic transmission of PCV2 has been proposed and reported in a few studies [17, 56, 57]. Rodents on swine farms have a high potential for contact with humans, posing the possibility of zoonotic transmission of PCV2 from rodents to personnel with professional occupation with pigs indirectly via contamination of water or food products. Therefore, it is necessary to capture or kill rodents on swine farms to avoid virus spread and zoonotic transmission of PCV2.

Conclusion

In sum, to our best knowledge, this is the first report of the identified PCV2d in wild rats that were captured far from pig farms in China. This finding will help to elucidate the evolutionary relationship and epidemiology of rat-associated PCV2. But, the pathogenicity of PCV2 in rats remains unclear. More studies are needed to clarify the infectious mechanism of PCV2 in rats and the possible cross-species transmission of PCV2 between rats and pigs.

Acknowledgements

We are grateful for the generous support of our colleagues regarding sample collection and technical assistance.

Declarations

This work was approved by the Ethical Committee of Jiangsu University, China. All animals were treated strictly according to the guidelines for the Rules for the Implementation of Laboratory Animal Medicine (1998) from the Ministry of Health, China, under the protocols approved by the National Institute for Communicable Disease Control and Prevention. All surgery was performed under ether anesthesia, and all efforts were made to minimize suffering.

Not applicable.

Competing interests

The authors declare that they have no conflict of interest.

Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Table S1. Genomic sequences of the detected viruses

Additional file 2: Data on detected viral genomic sequences

Tischer I, Gelderblom H, Vettermann W, Koch MA. A very small porcine virus with circular single-stranded DNA. Nature. 1982;295:64–6. https://doi.org/10.1038/295064a0.CrossRefPubMed

Ellis J, Hassard L, Clark E, Harding J, Allan G, Willson P, Strokappe J, Martin K, McNeilly F, Meehan B, et al. Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. Can Vet J = La revue veterinaire canadienne. 1998;39:44–51.

Chae C. A review of porcine circovirus 2-associated syndromes and diseases. Vet J. 2005;169:326–36. https://doi.org/10.1016/j.tvjl.2004.01.012.CrossRefPubMed

Firth C, Charleston MA, Duffy S, Shapiro B, Holmes EC. Insights into the evolutionary history of an emerging livestock pathogen: porcine circovirus 2. J Virol. 2009;83:12813–21. https://doi.org/10.1128/JVI.01719-09.CrossRefPubMedPubMedCentral

Opriessnig T, Meng XJ, Halbur PG. Porcine circovirus type 2 associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn. 2007;19:591–615. https://doi.org/10.1177/104063870701900601.CrossRef

Ramamoorthy S, Meng XJ. Porcine circoviruses: a minuscule yet mammoth paradox. Anim Health Res Rev. 2009;10:1–20. https://doi.org/10.1017/s1466252308001461.CrossRefPubMed

Cadar D, Cságola A, Lorincz M, Tombácz K, Spînu M, Tuboly T. Detection of natural inter- and intra-genotype recombination events revealed by cap gene analysis and decreasing prevalence of PCV2 in wild boars. Infect Genet Evol. 2012;12:420–7. https://doi.org/10.1016/j.meegid.2012.01.014.CrossRefPubMed

Cheung AK. Homologous recombination within the capsid gene of porcine circovirus type 2 subgroup viruses via natural co-infection. Arch Virol. 2009;154:531–4. https://doi.org/10.1007/s00705-009-0329-5.CrossRefPubMed

Hesse R, Kerrigan M, Rowland RR. Evidence for recombination between PCV2a and PCV2b in the field. Virus Res. 2008;132:201–7. https://doi.org/10.1016/j.virusres.2007.10.013.CrossRefPubMed

10.

Rajkhowa TK, Lalnunthanga P, Rao PL, Subbiah M, Lalrohlua B. Emergence of porcine circovirus 2g (PCV2g) and evidence for recombination between genotypes 2g, 2b and 2d among field isolates from non-vaccinated pigs in Mizoram, India. Infect Genet Evol. 2021;90:104775. https://doi.org/10.1016/j.meegid.2021.104775.CrossRefPubMed

11.

Pérez LJ, de Arce HD, Cortey M, Domínguez P, Percedo MI, Perera CL, Tarradas J, Frías MT, Segalés J, Ganges L, et al. Phylogenetic networks to study the origin and evolution of porcine circovirus type 2 (PCV2) in Cuba. Vet Microbiol. 2011;151:245–54. https://doi.org/10.1016/j.vetmic.2011.03.022.CrossRefPubMed

12.

Franzo G, Segales J. Porcine circovirus 2 (PCV-2) genotype update and proposal of a new genotyping methodology. PLoS ONE. 2018;13:e0208585. https://doi.org/10.1371/journal.pone.0208585.CrossRefPubMedPubMedCentral

13.

Xu Q, Zhang Y, Sun W, Chen H, Zhu D, Lu C, Yin Y, Rai KR, Chen JL, Chen Y. Epidemiology and genetic diversity of PCV2 reveals that PCV2e is an emerging genotype in Southern China: a preliminary study. Viruses. 2022. https://doi.org/10.3390/v14040724.CrossRefPubMedPubMedCentral

14.

de Sousa MA, Santos-Silva S, Mega J, Palmeira JD, Torres RT, Mesquita JR. Epidemiology of porcine circovirus type 2 circulating in wild boars of portugal during the 2018–2020 hunting seasons suggests the emergence of genotype 2d. Animals (Basel). 2022. https://doi.org/10.3390/ani12040451.CrossRefPubMedPubMedCentral

15.

Franzo G, Ustulin M, Zanardelli P, Castellan A, Villa N, Manfredda A, Vio D, Drigo M. First detection of porcine circovirus type 2e in Europe. Vet J. 2022;279:105787. https://doi.org/10.1016/j.tvjl.2022.105787.CrossRefPubMed

16.

Vidigal PM, Mafra CL, Silva FM, Fietto JL, Silva Junior A, Almeida MR. Tripping over emerging pathogens around the world: a phylogeographical approach for determining the epidemiology of Porcine circovirus-2 (PCV-2), considering global trading. Virus Res. 2012;163:320–7. https://doi.org/10.1016/j.virusres.2011.10.019.CrossRefPubMed

17.

Li L, Kapoor A, Slikas B, Bamidele OS, Wang C, Shaukat S, Masroor MA, Wilson ML, Ndjango JB, Peeters M, et al. Multiple diverse circoviruses infect farm animals and are commonly found in human and chimpanzee feces. J Virol. 2010;84:1674–82. https://doi.org/10.1128/JVI.02109-09.CrossRefPubMed

18.

Wang GS, Sun N, Tian FL, Wen YJ, Xu C, Li J, Chen Q, Wang JB. Genetic analysis of porcine circovirus type 2 from dead minks. J Gen Virol. 2016;97:2316–22. https://doi.org/10.1099/jgv.0.000529.CrossRefPubMed

19.

Deng ZB, Yuan AW, Luo W, Wang ND, Gong QL, Yu XL, Xue LQ. Transmission of porcine circovirus type 2b (PCV2b) in Kunming mice. Acta Vet Hung. 2013;61:234–43. https://doi.org/10.1556/AVet.2013.004.CrossRefPubMed

20.

Zhai SL, Chen SN, Liu W, Li XP, Deng SF, Wen XH, Luo ML, Lv DH, Wei WK, Chen RA. Molecular detection and genome characterization of porcine circovirus type 2 in rats captured on commercial swine farms. Arch Virol. 2016;161:3237–44. https://doi.org/10.1007/s00705-016-3004-7.CrossRefPubMed

21.

Song T, Hao J, Zhang R, Tang M, Li W, Hui W, Fu Q, Wang C, Xin S, Zhang S, et al. First detection and phylogenetic analysis of porcine circovirus type 2 in raccoon dogs. BMC Vet Res. 2019;15:107. https://doi.org/10.1186/s12917-019-1856-2.CrossRefPubMedPubMedCentral

22.

Song T, Zhang S, Hao J, Xin S, Hui W, Tang M, Li W, Tian R, Liu X, Rui P, et al. First detection and genetic analysis of fox-origin porcine circovirus type 2. Transbound Emerg Dis. 2019;66:1–6. https://doi.org/10.1111/tbed.13004.CrossRefPubMed

23.

Zhai SL, Chen RA, Chen SN, Wen XH, Lv DH, Wu DC, Yuan J, Huang Z, Zhou XR, Luo ML, et al. First molecular detection of porcine circovirus type 2 in bovids in China. Virus Genes. 2014;49:507–11. https://doi.org/10.1007/s11262-014-1117-1.CrossRefPubMed

24.

Herbst W, Willems H. Detection of virus particles resembling circovirus and porcine circovirus 2a (PCV2a) sequences in feces of dogs. Res Vet Sci. 2017;115:51–3. https://doi.org/10.1016/j.rvsc.2017.01.014.CrossRefPubMedPubMedCentral

25.

Wang X, Li W, Xu X, Wang W, He K, Fan H. Phylogenetic analysis of two goat-origin PCV2 isolates in China. Gene. 2018;651:57–61. https://doi.org/10.1016/j.gene.2018.01.095.CrossRefPubMed

26.

Deng ZB, Wang ND, Xu DJ, Yuan AW, Ge M, Luo W, Xue LQ, Yu XL. Viral distribution and lesions in Kunming mice experimentally infected with porcine circovirus type 2b. Vet Res Commun. 2011;35:181–92. https://doi.org/10.1007/s11259-011-9461-2.CrossRefPubMed

27.

Li J, Yuan X, Zhang C, Miao L, Wu J, Shi J, Xu S, Cui S, Wang J, Ai H. A mouse model to study infection against porcine circovirus type 2: viral distribution and lesions in mouse. Virol J. 2010;7:158. https://doi.org/10.1186/1743-422X-7-158.CrossRefPubMedPubMedCentral

28.

Sun Y, Zhang J, Liu Z, Zhang Y, Huang K. Swine influenza virus infection decreases the protective immune responses of subunit vaccine against porcine circovirus type 2. Front Microbiol. 2021;12:807458. https://doi.org/10.3389/fmicb.2021.807458.CrossRefPubMedPubMedCentral

29.

Quintana J, Balasch M, Segales J, Calsamiglia M, Rodriguez-Arrioja GM, Plana-Duran J, Domingo M. Experimental inoculation of porcine circoviruses type 1 (PCV1) and type 2 (PCV2) in rabbits and mice. Vet Res. 2002;33:229–37. https://doi.org/10.1051/vetres:2002011.CrossRefPubMed

30.

Lorincz M, Cságola A, Biksi I, Szeredi L, Dán A, Tuboly T. Detection of porcine circovirus in rodents—short communication. Acta Vet Hung. 2010;58:265–8. https://doi.org/10.1556/AVet.58.2010.2.12.CrossRefPubMed

31.

Pinheiro AL, Bulos LH, Onofre TS, de Paula GM, de Carvalho OV, Fausto MC, Guedes RM, de Almeida MR, Silva JA. Verification of natural infection of peridomestic rodents by PCV2 on commercial swine farms. Res Vet Sci. 2013;94:764–8. https://doi.org/10.1016/j.rvsc.2012.10.006.CrossRefPubMed

32.

Zhao M, Yue C, Yang Z, Li Y, Zhang D, Zhang J, Yang S, Shen Q, Su X, Qi D, et al. Viral metagenomics unveiled extensive communications of viruses within giant pandas and their associated organisms in the same ecosystem. Sci Total Environ. 2022;820:153317. https://doi.org/10.1016/j.scitotenv.2022.153317.CrossRefPubMed

33.

Shan T, Yang S, Wang H, Wang H, Zhang J, Gong G, Xiao Y, Yang J, Wang X, Lu J, et al. Virome in the cloaca of wild and breeding birds revealed a diversity of significant viruses. Microbiome. 2022;10:60. https://doi.org/10.1186/s40168-022-01246-7.CrossRefPubMedPubMedCentral

34.

Zhang W, Yang S, Shan T, Hou R, Liu Z, Li W, Guo L, Wang Y, Chen P, Wang X, et al. Virome comparisons in wild-diseased and healthy captive giant pandas. Microbiome. 2017;5:90. https://doi.org/10.1186/s40168-017-0308-0.CrossRefPubMedPubMedCentral

35.

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, et al. Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28:1647–9. https://doi.org/10.1093/bioinformatics/bts199.CrossRefPubMedPubMedCentral

36.

Deng X, Naccache S, Ng T, Federman S, Li L, Chiu C, Delwart E. An ensemble strategy that significantly improves de novo assembly of microbial genomes from metagenomic next-generation sequencing data. Nucleic acids Res. 2015;43:e46. https://doi.org/10.1093/nar/gkv002.CrossRefPubMedPubMedCentral

37.

Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38:3022–7. https://doi.org/10.1093/molbev/msab120.CrossRefPubMedPubMedCentral

38.

Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. Jalview version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009;25:1189–91. https://doi.org/10.1093/bioinformatics/btp033.CrossRefPubMedPubMedCentral

39.

Xiao CT, Halbur PG, Opriessnig T. Global molecular genetic analysis of porcine circovirus type 2 (PCV2) sequences confirms the presence of four main PCV2 genotypes and reveals a rapid increase of PCV2d. J Gen Virol. 2015;96:1830–41. https://doi.org/10.1099/vir.0.000100.CrossRefPubMed

40.

Misinzo G, Delputte PL, Meerts P, Lefebvre DJ, Nauwynck HJ. Porcine circovirus 2 uses heparan sulfate and chondroitin sulfate B glycosaminoglycans as receptors for its attachment to host cells. J Virol. 2006;80:3487–94. https://doi.org/10.1128/JVI.80.7.3487-3494.2006.CrossRefPubMedPubMedCentral

41.

Trible BR, Rowland RR. Genetic variation of porcine circovirus type 2 (PCV2) and its relevance to vaccination, pathogenesis and diagnosis. Virus Res. 2012;164:68–77. https://doi.org/10.1016/j.virusres.2011.11.018.CrossRefPubMed

42.

Trible BR, Kerrigan M, Crossland N, Potter M, Faaberg K, Hesse R, Rowland RR. Antibody recognition of porcine circovirus type 2 capsid protein epitopes after vaccination, infection, and disease. Clin Vaccine Immunol. 2011;18:749–57. https://doi.org/10.1128/CVI.00418-10.CrossRefPubMedPubMedCentral

43.

Wu Z, Lu L, Du J, Yang L, Ren X, Liu B, Jiang J, Yang J, Dong J, Sun L, et al. Comparative analysis of rodent and small mammal viromes to better understand the wildlife origin of emerging infectious diseases. Microbiome. 2018;6:178. https://doi.org/10.1186/s40168-018-0554-9.CrossRefPubMedPubMedCentral

44.

Du J, Li Y, Lu L, Zheng D, Liu B, Yang L, Su H, Dong J, Sun L, Zhu Y, et al. Biodiversity of rodent anelloviruses in China. Emerg Microbes Infect. 2018;7:38. https://doi.org/10.1038/s41426-018-0037-x.CrossRefPubMedPubMedCentral

45.

Lau SK, Woo PC, Li KS, Zhang HJ, Fan RY, Zhang AJ, Chan BC, Lam CS, Yip CC, Yuen MC, et al. Identification of novel rosavirus species that infects diverse rodent species and causes multisystemic dissemination in mouse model. PLoS Pathog. 2016;12:e1005911. https://doi.org/10.1371/journal.ppat.1005911.CrossRefPubMedPubMedCentral

46.

Villanueva RA, Campbell S, Roth MJ. Molecular analysis of a recombinant M-MuLV/RaLV retrovirus. Virology. 2003;315:195–208. https://doi.org/10.1016/S0042-6822(03)00518-X.CrossRefPubMed

47.

Guo LJ, Lu YH, Wei YW, Huang LP, Liu CM. Porcine circovirus type 2 (PCV2): genetic variation and newly emerging genotypes in China. Virol J. 2010;7:273. https://doi.org/10.1186/1743-422X-7-273.CrossRefPubMedPubMedCentral

48.

Yang L, Wang Z, Ouyang H, Zhang Y, Xiao W, Liu Y, Deng J, Li M, Ma L, Qi C, et al. Porcine ZC3H11A is essential for the proliferation of pseudorabies virus and porcine circovirus 2. ACS Infect Dis. 2022. https://doi.org/10.1021/acsinfecdis.2c00150.CrossRefPubMedPubMedCentral

49.

Huang Y, Chen X, Long Y, Yang L, Song W, Liu J, Li Q, Liang G, Yu D, Huang C, et al. Epidemiological analysis from 2018 to 2020 in China and prevention strategy of porcine circovirus type 2. Front Vet Sci. 2021;8:753297. https://doi.org/10.3389/fvets.2021.753297.CrossRefPubMedPubMedCentral

50.

Beach NM, Meng XJ. Efficacy and future prospects of commercially available and experimental vaccines against porcine circovirus type 2 (PCV2). Virus Res. 2012;164:33–42. https://doi.org/10.1016/j.virusres.2011.09.041.CrossRefPubMed

51.

Li N, Liu J, Qi J, Hao F, Xu L, Guo K. Genetic diversity and prevalence of porcine circovirus type 2 in China during 2000–2019. Front Vet Sci. 2021;8:788172. https://doi.org/10.3389/fvets.2021.788172.CrossRefPubMedPubMedCentral

52.

Kang L, Wahaab A, Shi K, Mustafa BE, Zhang Y, Zhang J, Li Z, Qiu Y, Li B, Liu K, et al. Molecular epidemic characteristics and genetic evolution of porcine circovirus type 2 (PCV2) in Swine Herds of Shanghai. China Viruses. 2022. https://doi.org/10.3390/v14020289.CrossRefPubMed

53.

Jia Y, Zhu Q, Xu T, Chen X, Li H, Ma M, Zhang Y, He Z, Chen H. Detection and genetic characteristics of porcine circovirus type 2 and 3 in Henan province of China. Mol Cell Probes. 2022;61:101790. https://doi.org/10.1016/j.mcp.2022.101790.CrossRefPubMed

54.

Lv N, Zhu L, Li W, Li Z, Qian Q, Zhang T, Liu L, Hong J, Zheng X, Wang Y, et al. Molecular epidemiology and genetic variation analyses of porcine circovirus type 2 isolated from Yunnan Province in China from 2016–2019. BMC Vet Res. 2020;16:96. https://doi.org/10.1186/s12917-020-02304-8.CrossRefPubMedPubMedCentral

55.

Chen N, Xiao Y, Li X, Li S, Xie N, Yan X, Li X, Zhu J. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound Emerg Dis. 2021;68:1615–24. https://doi.org/10.1111/tbed.13833.CrossRefPubMed

56.

Meng XJ. Porcine circovirus type 2 (PCV2): pathogenesis and interaction with the immune system. Annu Rev Anim Biosci. 2013;1:43–64. https://doi.org/10.1146/annurev-animal-031412-103720.CrossRefPubMed

57.

Turlewicz-Podbielska H, Augustyniak A, Pomorska-Mol M. Novel porcine circoviruses in view of lessons learned from porcine circovirus type 2-epidemiology and threat to pigs and other species. Viruses. 2022;14:261. https://doi.org/10.3390/v14020261.CrossRefPubMedPubMedCentral

Titel: Virome of wild rats (Rattus norvegicus) captured far from pig farms in Jiangsu province of China reveals novel porcine circovirus type 2d (PCV2d) sequences
verfasst von: Min Zhao
Siwen Bao
Diandian Xu
Jingxian He
Han Zhang
Likai Ji
Shixing Yang
Xiaochun Wang
Quan Shen
Jia Liu
Qing Zhang
Xiao Ma
Wen Zhang
Tongling Shan
Publikationsdatum: 01.12.2023
Verlag: BioMed Central
Erschienen in: Virology Journal / Ausgabe 1/2023
Elektronische ISSN: 1743-422X
DOI: https://doi.org/10.1186/s12985-023-02005-2

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

^{Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag}

Kostenlos registrieren

Neu im Fachgebiet Innere Medizin

25.04.2024 | Hypotonie | Nachrichten

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Newsletter bestellen

Springer Medizin

Virome of wild rats (Rattus norvegicus) captured far from pig farms in Jiangsu province of China reveals novel porcine circovirus type 2d (PCV2d) sequences

Abstract

Background

Results

Conclusions

Supplementary Information

Publisher's Note

Background

Methods

Sample collection, library construction, and next-generation sequencing

Bioinformatic analyses

PCR detection and amplification of the whole genome of PCV2

Phylogeny of viruses and data analysis

Results

Virome analysis and identification of rat-associated PCV2

PCV2 detection and generation of the whole genome of rat-associated PCV2

Evolutionary relationship of rat-associated PCV2

ORF2 sequence comparison

Discussion

Conclusion

Acknowledgements

Declarations

Competing interests

Publisher's Note

Supplementary Information

Leitlinien kompakt für die Innere Medizin

Neu im Fachgebiet Innere Medizin

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

Viel Bewegung in der Parkinsonforschung

Adjuvante Immuntherapie verlängert Leben bei RCC

Update Innere Medizin

Springer Medizin

Abstract

Background

Results

Conclusions

Supplementary Information

Publisher's Note

Background

Methods

Sample collection, library construction, and next-generation sequencing

Bioinformatic analyses

PCR detection and amplification of the whole genome of PCV2

Phylogeny of viruses and data analysis

Results

Virome analysis and identification of rat-associated PCV2

PCV2 detection and generation of the whole genome of rat-associated PCV2

Evolutionary relationship of rat-associated PCV2

ORF2 sequence comparison

Discussion

Conclusion

Acknowledgements

Declarations

Ethics approval and consent to participate

Consent for publication

Competing interests

Publisher's Note

Supplementary Information

Weitere Artikel der Ausgabe 1/2023

Real-world evidence with a retrospective cohort of 15,968 COVID-19 hospitalized patients suggests 21 new effective treatments

Insights into SARS-CoV-2-associated subacute thyroiditis: from infection to vaccine

Genetic variants of Dabie bandavirus: classification and biological/clinical implications

Multicenter analysis of epidemiological and clinical features of pediatric acute lower respiratory tract infections associated with common human coronaviruses in China, 2014–2019

A review of foot-and-mouth disease in Ethiopia: epidemiological aspects, economic implications, and control strategies

Studying temporal titre evolution of commercial SARS-CoV-2 assays reveals significant shortcomings of using BAU standardization for comparison

Leitlinien kompakt für die Innere Medizin

Neu im Fachgebiet Innere Medizin

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

Viel Bewegung in der Parkinsonforschung

Adjuvante Immuntherapie verlängert Leben bei RCC

Update Innere Medizin