Background
Glomerulonephritis (GN) is a common cause of renal failure. Tubulointerstitial inflammation is a major contributor of GN progression to renal failure, even in crescentic GN with severe glomerular injury [
1,
2]. Evidences suggest that crescent formation is driven by Th1-dominated nephritogenic immune responses [
3‐
6]. Development of Th1 or Th2 immunity is controlled by dendritic cells (DCs). In different forms of GN, renal function and prognosis closely correlate with the extent of DC infiltration into the tubulointerstitium [
7‐
9].
DCs are critical in the control of immune responses and homoeostasis. Mature DCs induce Th1, Th2 and Th17 effector T-cells, whereas immature DCs drive the development of regulatory T cells (Tregs), which maintain tolerance to self-antigens and inhibit excessive immune responses by producing IL-10 and TGF-β [
9‐
14]. DC maturation is pathogen-specific and exhibits a large degree of plasticity [
15]. The nature of the antigen determines the balance towards immunity or tolerance. DCs express a large array of cell surface lectins and lectin-like molecules which are receptors for cognate antigens [
16‐
20]. DC-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN), a member of the C-type lectin family, mediates DC adhesion and migration, inflammation, activation of primary T cells, contributes to immune responses and the immune escape of pathogens and tumors [
21‐
23]. DC-SIGN is abundantly expressed on immature DCs (iDCs) and is down-regulated during maturation [
21]. DC-SIGN signaling can induce opposite immune responses [
18,
22,
24]. Ligation of DC-SIGN on DCs actively primes DCs to induce Tregs [
25]. Thus, targeting DC-SIGN may be a useful strategy to suppress inflammatory responses, which could be beneficial in managing autoimmunity.
Previously we demonstrated that DCs treated
in vitro with an anti-lectin-EGF domain monoclonal antibody originally developed against P-selectin (PsL-EGFmAb) displayed low expression of co-stimulatory molecules and an impaired capability to stimulate CD4
+ T cells [
26], indicating suppression of DC maturation and function. However, the underlying mechanism remains unclear. Thus, we administered PsL-EGFmAb to a rat model of nephrotoxic nephritis (NTN), an immune-mediated animal model of human crescentic GN, to investigate whether PsL-EGFmAb could affect DC maturation and Treg- and Th1/Th2-related gene expression in renal tissues, and further investigate the mechanism by which this antibody affects DCs
in vitro. We infer that PsL-EGFmAb might interact with DC-SIGN that also contains a lectin domain to inhibit DC maturation and induce Tregs that inhibit effector T cell functions. Our results showed that a lectin-EGF antibody targeting DC-SIGN on dendritic cells promotes regulatory T cells and attenuates nephrotoxic nephritis.
Methods
Animals and treatment protocol
Male 6-8-week old Wistar-Kyoto rats were bred and kept in specific-pathogen-free conditions in an animal facility. Rabbit nephrotoxic serum was generated as described previously [
27,
28]. The amount of nephrotoxic serum per gram of body weight used in this study (2.0 or 2.5 mg immunoglobulin per gram body weight) was within the linear range of a dose response. Eighteen rats were equally and randomly assigned to three groups and received different injection by tail vein: control group rats injected with normal rat serum; NTN group rats injected with two doses of mouse IgG (2 μg per gram of rat body weight) at 0 and 2 h after nephrotoxic serum injection; PsL-EGFmAb-treated group rats received two injections of PsL-EGFmAb, a mouse anti-human monoclonal antibody established in our lab (2 μg per gram of rat body weight) at 0 and 2 h after nephrotoxic serum injection. On day 14, the rats were anesthetized with ketamine and sacrificed. Rats in every group were placed in metabolic cages to collect 24 hours urine and detect urine creatinine. Blood was got from inner canthal vein of rats in every group. Serum creatintine (Scr) and urea nitrogen were detected by automatic biochemical analyzer. Creatinine clearance rate (CCr) was got by the formula according to creatintine and urine output in serum and urine. The kidneys were quickly isolated and fixed in 10% buffered formaldehyde. The study was approved by the Ethics Committee of Ruijin Hospital, Shanghai Jiaotong University School of Medicine.
Renal function studies
For urine sample collection, rats were housed in metabolic cages. Albuminuria was determined by standard ELISA analysis. Blood samples for blood urea nitrogen (BUN) measurement were obtained at the time of sacrifice. Scr and BUN were measured by standard laboratory methods. Ccr (ml/min) was used to estimate glomerular filtration rate (GFR).
Periodic Acid Schiff staining
To evaluate glomerular and tubulointerstitial injury, formalin-fixed rat renal tissue was embedded in paraffin, sectioned at 4 μm, and stained with Periodic Acid Schiff (PAS) for histological analysis. Tubulointerstitial lesions were scored as follows: 0, no tubular damage, no interstitial edema; 0.5, thinning of the brush borders; 1, thinning of the tubular epithelial; 2, denudation of the tubular basement membrane; 3, tubular necrosis.
Analysis of MHC class-II, DC-SIGN and CD80 expressed on renal DCs
DCs were isolated from rat kidneys as previously described [
29]. Briefly, kidneys were finely minced and digested for 45 min at 37°C with 2 mg/ml collagenase D in RPMI 1640 medium with 10% heat-inactivated fetal calf serum. Cell suspensions were filtered through 30 μm nylon mesh, and washed with HBSS without Ca
2+ and Mg
2+ containing 10 mmol/L EDTA, 0.1% BSA and 10 mM Hepes. Density centrifugation was performed at 1700 ×
g for 20 min at 4°C using 1.080 g/ml of Nycodenz (Axis-Shield). The interphase cells were harvested and isolated with anti-rat OX62 micro-beads (Miltenyi Biotec, Bergisch Gladbach, Germany). Isolated cells (5 × 10
5) were stained with FITC- and PE-labeled mAbs specific for MHC class-II and CD80. In addition, 1 × 10
5 DCs were stained indirectly with DC-SIGN using goat anti-rat DC-SIGN polyclonal antibody and PE-conjugated donkey anti-goat IgG mAb. Phenotypic analysis was performed by flow cytometry using a FACS Calibur (BD FACSAria™ Cell Sorter).
Real-time PCR assays
Renal tissue was lysed and total RNA extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, Burlington, Canada), following the manufacturer’s recommendations. The cycle number at which the fluorescence increased above the threshold was designated as the threshold cycle (CT). Primer specificity was assessed by melting curve. These samples were then analyzed for the expression of IFN-γ, TNF-α, IL-6, IL-4, Foxp3, IL-10, TGF-β, and GAPDH genes by PCR using the SYBR GREEN PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA) and the ABI PRISM 7700 Sequence Detection System. The sequences of the specific primer pairs used in each case were listed in Table
1. PCR was performed three times as follows: 40 cycles of denaturing at 95°C for 15 s and annealing/extension at 60°C for 1 min. Results were normalized to GAPDH expression using the 2
–ΔΔCt method.
Table 1
Sequences of specific primer pairs
IFN-γ | 5′-AACCAGGCCATCAGCAACAAC A -3′ | 5′-ACCGACTCCTTTTCCGCTTCCT-3′ |
TNF-α | 5′-GGTGATCGGTCCCAACAAGGA -3′ | 5′-CACGCTGGCTCAGCCACTC-3′ |
IL-6 | 5′-ATATGTTCTCAGGGAGATCTTGGA A-3′ | 5′-GTGCATCATCGCTGTTCATACA-3′ |
IL-4 | 5′-AACACCACGGAGAACGAGCTC ATC-3′ | 5′- AGTGAGTTCAGACCGCTGACACCT -3′ |
Foxp3 | 5′-CCCAGGAAAGACAGCAACCTT -3′ | 5′- CTGCTTGGCAGTGCTTGAGAA -3′ |
IL-10 | 5′-GCCAAGCCTTGTCAGAAATGA -3′ | 5′- TTTCTGGGCCATGGTTCTCT -3′ |
TGF-β | 5′-ACCGGGTGGCAGGCGAGAG -3′ | 5′- CGGGACAGCAATGGGGGTTCT -3′ |
GAPDH | 5′-AGGACCAGGTTGTCTCCTGT -3′ | 5′- TTACTCCTTGGAGGCCATGT -3′ |
Cell isolation
PBMCs were obtained from whole blood of healthy donors by Ficoll density gradient centrifugation (Sigma-Aldrich, St. Louis, MO, USA). Then, monocytes were isolated by positive selection with human anti-CD14 microbeads (Miltenyi Biotec), following the manufacturer’s instructions. To generate imDCs, isolated CD14+ monocytes (5 × 105/ml) were incubated at 37°C for 5–7 days in RPMI 1640 complete medium (Invitrogen), containing 10% fetal calf serum and supplemented with 50 ng/ml human GM-CSF and 20 ng/ml human IL-4 (R&D Systems). To obtain mDCs, imDCs were incubated for 48 h in the presence of 50 ng/ml TNF-α (R&D Systems). PsL-EGFmAb (10 μg/ml) was added to the culture 2 h before TNF-α addition to obtain PsL-EGFmAb-treated DCs. The expression of HLA-DR, CD80, CD86, CD83 and DC-SIGN on the surface of DCs was confirmed by flow cytometry analysis.
Human CD4+ T cells were isolated from PBMCs by negative selection and the fraction of remaining cells were used to further isolate CD4+CD25- T and CD4+CD25+ T cells by negative and positive selection using a human CD4+CD25+ Treg isolation kit (Miltenyi Biotec), following the manufacturer's instructions.
Flow cytometry analysis
Expressions of surface antigens on DCs (1 × 105) were assessed with the following mAbs: anti-human HLA-DR and CD83, PE-labeled anti-rat CD80, anti-human CD80 and DC-SIGN, allophycocyanin-labeled anti-human CD86, goat anti-rat DC-SIGN antibody and PE-conjugated donkey anti-goat IgG. Appropriate isotype antibodies were used as controls. The proportion of CD4+CD25+Foxp3+ T cells in the CD4+ T cell population was determined using a human Treg staining kit (eBioscience), according to manufacturer’s instructions. In brief, after CD4 and CD25 surface staining, cells (5 × 105) were washed and fixed at 4°C for 60 min in the dark using fixation/permeabilization solution. Cells were then stained intracellularly for Foxp3.
To investigate whether PsL-EGFmAb can bind to DC-SIGN, flow cytometry analysis was performed. First, we used PE-labeled anti-DC-SIGN mAb and PsL-EGFmAb together with FITC-labeled anti-mouse IgG mAb to detect expression of DC-SIGN on imDCs (1 × 105) separately. Then imDCs were incubated with goat anti-human DC-SIGN antibody for 2 h before detection of DC-SIGN expression by PsL-EGFmAb together with FITC-labeled anti-mouse IgG mAb. The percentage of positive cells was analyzed in a FACSCalibur flow cytometer (BD Biosciences), using Flowjo software (v. 5.7.2, Tree Star Inc., Ashland, OR, USA).
Cytokine assays
Levels of IFN-γ, IL-12, TGF-β, IL-10 and IL-6 in cell cultures were determined by ELISA (Biosource, Carlsbad, CA, USA). Briefly, cell culture supernatants were collected and the cytokine concentration was analyzed by a specific solid phase sandwich enzyme immunoassay, following the manufacturer’s instructions.
Allogeneic mixed cell proliferation assays
The ability of DCs to stimulate CD4+ T cells was assayed by mixed lymphocyte reaction. Allogeneic CD4+ T cells (2 × 105) isolated from rat peripheral blood mononuclear cells by magnetic bead-labeled anti-rat CD4 mAb (Miltenyi Biotec) were incubated with irradiated (30 Gy) DCs (2 × 104) isolated from rat kidneys in control, NTN and PsL-EGFmAb-treated groups with anti-rat OX62 micro-beads as mentioned above at a 10:1 ratio in a 96-well U-bottomed plate at 37°C for five days. T cell proliferation was assessed after five days of co-culture by [methyl-3H]thymidine ([3H]TdR, 5.0 μCi/ml) incorporation in a 16-h pulse. For this purpose, cells were harvested with a semi automated device, and the incorporation of [3H]TdR was determined in a liquid scintillation counter. Triplicate wells were cultured for each group.
To analyze the stimulatory potential of human DCs on allogeneic CD4+ T, CD4+CD25+ T and CD4+CD25- T cells, T cells (2 × 105) were co-cultured for five days with imDCs, mDCs or PsL-EGFmAb-treated DCs (2 × 104). T cells without DC or PsL-EGFmAb treatment were used as a control. T cell proliferation was assessed as mentioned above. All of these experiments were conducted in triplicate.
Suppression assays
To analyze the suppressive function of the Tregs induced
in vitro by DCs, autologous mixed cell cultures were performed [
30]. Briefly, CD4
+CD25
+ T cells recovered after five days of co-culture with DCs (T1 cells), were maintained in culture for two additional days in the presence of IL-2 (50 U/ml) (R&D Systems). T1 cells or MACS freshly isolated normal human CD4
+CD25
+ Tregs (2 × 10
5) were mixed with autologous CD4
+ CD25
- T cells (1 × 10
5) and stimulated with anti-CD3 (5 μg/ml) mAb plus anti-CD28 (1 μg/ml) mAb. After two days of cell culture, 5.0 μCi/ml [
3H]TdR was added and the cells were harvested 16 h later. Results were expressed as fold increases in [
3H]TdR incorporation.
Neutralization assays
To determine which cytokines secreted by PsL-EGFmAb-treated DCs were involved in CD4+CD25+ Treg priming, anti-IL-6 (5 μg/ml), anti-IL-10 (10 μg/ml), anti-TGF-β (10 μg/ml), anti-IL-4 (10 μg/ml), anti-TNF-α (5 μg/ml), anti-IL-12 (10 μg/ml) and anti-IFN-γ (5 μg/ml) mAbs were used. PsL-EGFmAb-treated DCs (2 × 104) were co-cultured with MACS freshly isolated human CD4+CD25+ T cells (2 × 105) for five days in the presence of the different neutralizing antibodies mentioned above. Mouse IgG was also added as an isotype control. CD4+CD25+ T cells alone were used as a negative control. T cell proliferation was assessed by [3H]TdR (5.0 μCi/ml) incorporation in a 16-h pulse. Cells were harvested with a semi automated device, and the incorporation of [3H]TdR was determined in a liquid scintillation counter.
Next, to determine which cytokines secreted by T1 cells inhibited CD4+CD25- effector T cell proliferation, the same neutralizing antibodies at similar doses were used. PsL-EGFmAb-treated DC-induced T1 cells (2 × 105) were co-cultured with 1 × 105 MACS freshly isolated human CD4+CD25- T cells for five days in the presence of different neutralizing antibodies. Mouse IgG was also added as an isotype control, while CD4+CD25- T cells alone were used as a negative control. T cell proliferation was assessed using the method mentioned above. All of these experiments were conducted in triplicate and the results were expressed as fold increases in [3H]TdR incorporation.
siRNA Sequences (DC-SIGN)
Sequences of various siRNAs used are as follows: DC-SIGN antisense, 5′-ATT TGT CGT CGT TCC AGC CAT-3′; DC-SIGN sense, 5′-ATG GCT GGA ACG ACA CAA A-3′; DC-SIGN antisense scrambled control, 5′-CAC ACC ACA TCT TTC CGT CAC-3′; DC-SIGN sense scrambled control, 5′-GTG ACG GAA AGA TGT GGT G-3′. RNA oligonucleotides were custom synthesized by Dharmacon Research Inc (Lafayette, CO, USA) with an overhang of 2 thymidine residues (dTdT) at the 3′ end. The RNA oligonucleotides were dissolved in Tris-EDTA (10 mM Tris–HCl, pH 8.0; and 1 mM EDTA) as 200 μM solutions and were stored at -20°C. Double-stranded siRNA molecules were generated by mixing the corresponding pair of sense and antisense RNA oligonucleotides in annealing buffer (30 mM HEPES-KOH, pH 7.9; 100 mM potassium acetate; and 2 mM magnesium acetate) at 20 μM and then by incubating the reaction mixture at 95°C for 2 min, followed by gradual cooling to room temperature. The siRNAs were then aliquoted and stored at -20°C.
Transfection of siRNAs
Twenty-four-hours before siRNA transfection, DCs (1 × 106) were seeded in 6-well plates in OPTI-minimal essentials medium (OptiMEM; Invitrogen, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS) with no antibiotics. Cells were seeded per 6-well plate to give 30% to 50% confluency at the time of the transfection. The siRNAs were transfected at a final concentration of 50 nM using Oligofectamine (Invitrogen) according to the manufacturer’s recommendations. The control (untransfected) cells received either Oligofectamine alone or Oligofectamine plus scrambled sequence. The siRNAs added to control cells were incubated for 24–48 and 72 hours and the cells were harvested and RNA was extracted.
Immunoprecipitation
ImDCs (5 × 105) were lysed in lysis buffer (1% Triton-X-100, 10 mM TEA pH 8.2, 150 mM NaCl, 1 mM MgCl2 and 1 mM CaCl2) containing a cocktail of EDTA-free protease inhibitors for 1 h at 4°C. Cell lysates were immunoprecipitated with PsL-EGFmAb-coated or mouse IgG-coated Agarose A/G beads (Pierce, Appleton, WI, USA), following the manufacturer's instructions. Briefly, cell lysates were incubated with PsL-EGFmAb-coated or mouse IgG-coated beads overnight at 4°C on an orbital shaker. The beads were then collected and washed three times with 800 μl of ice-cold PBS followed by pulse centrifugation. After washing, beads were resuspended in 60 μl of 2 × sample buffer and gently mixed. DC-SIGN was detected by western blotting using the protocol mentioned above. Cell lysates without immunoprecipitation were used as positive controls.
Statistical analysis
SPSS software, version 11.0, was used for statistical analyses. Data are presented as the mean ± SD. Statistically significant differences between groups were determined using the Student’s t test or Mann–Whitney U- test, as appropriate. A value of p < 0.05 was considered significant.
Discussion
NTN is an animal model of human crescentic GN, characterized by glomerular crescent formation, tubulointerstitial inflammation, impaired renal function and proteinuria [
1,
2,
33]. Several studies demonstrated that a Th1-dominated nephritogenic immune response is responsible for the formation of crescents [
1,
2]. Recently, the protective role of Tregs in GN has been demonstrated [
34]. It is well established that DCs play a critical role in the development of tubulointerstitial inflammation by modulating Th0 cells to Th1, Th2 or Th17 polarization [
35], or limiting inflammation by promoting Tregs [
36].
In the present study, we demonstrated that treatment with PsL-EGFmAb led to a reversal of the Th1-dominated cytokine mRNA expression profile and attenuation of renal lesions in a rat model of NTN. This was accompanied by improvement of renal function indicating that the protective effect likely involved the inhibition of DC maturation, and subsequent T cell differentiation. DCs have an important role in peripheral tolerance by various mechanisms, including activation of Tregs, induction of T cell anergy and skewed Th1/Th2 differentiation [
37,
38]. Increasing evidence suggests that DC functions are associated with maturation status [
39,
40]. Fully matured DCs are efficient activators of T cells, while imDCs have been implicated in anergy induction [
41]. An intermediate stage of DC maturation was recently described, where DCs express relatively high levels of MHC class-II and co-stimulatory molecules, but do not secrete proinflammatory cytokines [
42]. Previously we showed that treatment of DCs with PsL-EGFmAb, an anti-lectin-EGF domain monoclonal antibody originally developed against P-selectin, led to suppression of DC maturation and inhibition of CD4
+ T cell proliferation
in vitro[
24]. In the present study we further demonstrated the suppression of DC maturation and T cell stimulation after PsL-EGFmAb treatment
ex vivo, and interestingly observed an upregulation of Foxp3 and IL-10 expression in renal tissues from rat NTN. Together, treatment of PsL-EGFmAb inhibited DC maturation, which could in turn induce Treg differentiation and regulate Th1/Th2 bias.
To further characterize the effect of PsL-EGFmAb on DCs, we used human DCs that comprehensively reflected DC maturation and functions. Our results suggested that treating DCs with PsL-EGFmAb could drive DCs to an intermediate maturation stage assessed by expression of intermediate levels of co-stimulatory molecules. DCs at this maturation stage may be capable of inducing immune tolerance.
Promotion of Tregs is one mechanism by which DCs regulate immune tolerance. We therefore investigated whether PsL-EGFmAb-treated DCs could promote CD4+CD25+ Treg development. PsL-EGFmAb-treated DCs suppressed CD4+ T cell proliferation by stimulating the expansion of CD4+CD25+ Tregs. This raised the question of whether PsL-EGFmAb-treated DCs promoted CD25+ Treg proliferation or induced CD25+ Treg differentiation from CD25– T cells. To address this question, we sorted CD4+CD25– T cells and cultured them with PsL-EGFmAb-treated DCs. PsL-EGFmAb-treated DCs failed to differentiate CD4+CD25– cells into CD4+CD25+ Tregs, but stimulated the expansion of primary CD4+CD25+ Tregs. Furthermore, the expanded CD4+CD25+ Tregs displayed the same ability to suppress T cell function as freshly isolated CD4+CD25+ Tregs.
IL-10 and TGF-β are immunoregulatory cytokines which facilitate the generation of murine and human Tregs [
32]. Chronic activation of murine and human CD4
+ T cells in the presence of IL-10 results in the generation of Tregs [
43]. When polarized, these cells can inhibit
in vitro and
in vivo alloresponses [
43]. In the present study, the addition of neutralizing anti-IL-10 mAb significantly inhibited CD4
+CD25
+ T cell proliferation induced by PsL-EGFmAb-treated DCs, and attenuated their suppressive function on CD4
+CD25
- T cells. Antibodies against other cytokines had no effect, indicating a critical role of IL-10 in the promotion of Tregs by PsL-EGFmAb-treated DCs. Conversely, the above phenomenon was not seen with neutralizing anti-TGF-β mAbs.
According to the in vivo and in vitro data, we speculated that PsL-EGFmAb treatment could inhibit DC maturation in renal tissue or draining lymph nodes, to induce the generation of tolerogenic DCs, which can inhibit Th1/Th2 polarization and promote Treg proliferation by IL-10. These events together could lead to the alleviation of inflammation in renal tissue.
Next we determined which molecule on DCs interacted with PsL-EGFmAb. As PsL-EGFmAb affected DC maturation and function, this indicated that it might interact directly with DCs. As DC-SIGN has a similar lectin domain to P-selectin in its molecular structure, it may interact with PsL-EGFmAb. To test this, we compared the binding of PsL-EGFmAb and DC-SIGN mAb to DCs by flow cytometry, and found that both mAbs showed similar levels of binding. Furthermore, DCs, in which DC-SIGN was blocked by anti-DC-SIGN goat antiserum, led to dramatically reduced binding of PsL-EGFmAb. This was also supported by results from the immunoprecipitation study using PsL-EGFmAb-labeled micro beads which clearly showed that PsL-EGFmAb bound to DC-SIGN. Together, our data clearly demonstrate that PsL-EGFmAb binds to DC-SIGN on imDCs, although it can also bind to molecules containing a lectin domain. Besides DC-SIGN, PsL-EGFmAb might interact with other molecules possessing lectin or EGF domains on DCs, contributing to the immune regulation of DCs. All above are required further studies to analyze such functions.
Competing interests
All the authors declared no competing interests.
Authors’ contributions
TZ and CDX conceived the study design, participated in its design and in the acquisition of data. MCC, JW and CMM carried out the experiments, participated in the acquisition of data, analysis and interpretation, drafted the manuscript. PL have been involved in analyzing the data and provided critical advice. JMR have been involved in revising figures. JCZ and XL helped to draft and revise the manuscript. All authors read and approved the final manuscript.