A loss-of-function variant in SSFA2 causes male infertility with globozoospermia and failed oocyte activation

A patient with primary infertility and his family were recruited from West China Second University Hospital, Sichuan University. His 26-year-old wife with normal ovulatory cycles was also recruited for ICSI treatment. A total of 220 healthy Chinese volunteers, as healthy controls, who had medical check-ups without evidence of any infertility were obtained from the Physical Examination Center in our hospital. This study was conducted following the tenets of the Declaration of Helsinki, and ethical approval was obtained from the Ethical Review Board of West China Second University Hospital, Sichuan University. All subjects signed an informed consent form.

Peripheral blood samples were obtained from all subjects, and the genomic DNA was isolated by DNeasy Blood & Tissue Kits (69,504, QIAGEN) according to the manufacturer’s protocol. Next-generation sequencing was carried out using the SureSelectXT Human All Exon Kit (5190-8864, Agilent) and Illumina HiSeq X-TEN. The reads were mapped to the human reference sequence (UCSC hg19) using BWA 0.7.9a from the BWA-MEM algorithm. After quality filtering by the Genome Analysis Toolkit [17], functional annotation was performed using ANNOVAR through a series of databases, including the 1000Genomes Project, gnomAD, HGMD and ExAC. Next, PolyPhen-2, SIFT, MutationTaster and CADD were used for functional prediction. The SSFA2 variant identified by WES was confirmed by Sanger sequencing. The PCR primers were as follows: F 5′ GCATCGGTGGCTCTAACGCCAACAG 3′; R 5′ TGGGACTACAGGCACATGCCACCAC 3′.

For scanning electron microscopy (SEM), the sperm cells were fixed onto slides using 2.5% glutaraldehyde and refrigerated overnight at 4 °C. After rinsing the slides with 1 × PBS buffer three times, the slides were gradually dehydrated with an ethanol gradient (30, 50, 75, 95, and 100% ethanol) and dried by a CO₂ critical-point dryer. After metal spraying by an ionic sprayer meter (Eiko E-1020, Hitachi), the samples were observed by SEM (S-3400, Hitachi).

For transmission electron microscopy (TEM), the sperm cells were washed with SpermRinse™ (10,101, Vitrolife) three times, fixed in 3% glutaraldehyde, phosphate-buffered to pH 7.4 and postfixed with 1% OsO4. After embedding in Epon 812, ultrathin sections were stained with uranyl acetate and lead citrate and observed under a TEM (TECNAI G2 F20, Philips) with an accelerating voltage of 120 kV.

Spermatogenic cells were coated on the slides and fixed in 4% paraformaldehyde for 15 min. Then, they were permeabilized with 3% bovine serum albumin (A1933, Sigma–Aldrich) and 0.1% Triton X-100 for 30 min at room temperature. Next, the samples were incubated overnight at 4 °C with primary antibodies against SSFA2 (1:200; 14,157-1-AP, Proteintech), GSTM3 (1:100; 67,634-1-Ig, Proteintech), F-Actin (1:500; ab205, Abcam), PLCζ (1:200; A65778-050, EpiGentek) and Peanut agglutinin (PNA) conjugated AlexaFluor 488 (1:100; L21409, Thermo Fisher Scientific); After washing with 1 × PBS buffer twice, the samples were incubated for 1 hour with Alexa Fluor 488 (1:1000; A21206, Thermo Fisher Scientific)- or Alexa Fluor 594 (1:1000; A11005, Thermo Fisher Scientific)-labeled secondary antibodies at room temperature; Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (D9542, Sigma–Aldrich).

For the staining of testicular tissues, samples were fixed in 3.7% buffered formaldehyde. After fixation, the tissues were first embedded in paraffin. The samples were sectioned at a thickness of 5 μm. After deparaffinization and rehydration, the sections were treated with 3% hydrogen peroxide for 10 min at room temperature and with 20 mM sodium citrate for 15 min at 95 °C. Subsequently, after being washed twice with 1 × PBS buffer for 5 minutes, the sections were blocked with goat serum (16,210,072, Thermo Fisher Scientific) at 37 °C for 1 hour and then incubated with primary antibodies overnight at 4 °C, followed by 1 hour of incubation at 37 °C with secondary antibodies and 0.5% DAPI. Images were captured with a confocal microscope (Olympus FV3000).

In our study, HEK293T cells were obtained from the American Type Culture Collection (ATCC® CRL-11268™). HEK293T cells were grown in DMEM (11965092, Gibco) supplemented with 10% fetal bovine serum (FBS) (F8318, Sigma–Aldrich). The expression plasmids encoding wild-type SSFA2 (pENTER-Flag-WT-SSFA2) were constructed by Vigene Biosciences (Jinan, China), and the mutant plasmids of SSFA2 were generated by the Mut Express II Fast Mutagenesis Kit V2 (C214-01, Vazyme) following the instructions. The GSTM3 plasmids were synthesized and cloned into pCMV-MCS-Myc by Origene (Rockville, USA).

Protein mixtures including SSFA2 and its interacting proteins were pulled down using the SSFA2 primary antibody by immunoprecipitation (IP) from total proteins extracted from human testes. The sample preparations and liquid chromatography–mass spectrometry/mass spectrometry (LC–MS/MS) analysis were then conducted by Hangzhou Jingjie Biotechnology Co., Ltd. (Hangzhou, China) according to standard methods, including in-gel digestion, LC–MS/MS analysis, and data processing.

Total proteins were extracted using RIPA lysis buffer (P0013C, Beyotime) supplemented with Halt™ Protease Inhibitor Cocktail (78,425, Thermo Fisher Scientific). Samples were mixed with SDS Sample loading buffer (P0015, Beyotime) and boiled for 10 min, and then separated by electrophoresis in 7.5% or 12% SDS-PAGE gels. Subsequently, the proteins were blotted onto PVDF membranes (Millipore, Boston, USA). After an incubation with TBST containing 5% milk for 1 h, the membranes were incubated with primary antibody and horseradish peroxidase (HRP)-conjugated secondary antibodies diluted in TBST containing 5% milk. Chemiluminescence with ECL chemical substrate (WBKLS0100, Millipore) was applied for immunoblot analyses. For Western blotting, the following antibodies were used: anti-SSFA2 (1:1000; 14,157-1-AP, Proteintech); anti-Flag (1:2000; TA-05, ZSGB-Bio); anti-α-Tubulin (1:5000; ab52866, Abcam); anti-GAPDH (1:5000; ab ab8245, Abcam); HRP-conjugated Affinipure Goat Anti-Rabbit IgG (1:10000; SA00001-2, Proteintech); HRP-conjugated Affinipure Goat Anti-Mouse IgG (1:10000; SA00001-1, Proteintech).

For coimmunoprecipitation, samples were lysed in RIPA buffer (P0013C, Beyotime) supplemented with Halt™ Protease Inhibitor Cocktail (78,425, Thermo Fisher Scientific). Next, extracted total proteins were incubated with target antibodies overnight at 4 °C. Protein A/G magnetic beads (B23201, Bimake) were added to each sample and incubated for 1 hour at room temperature. After being washed three times and resuspended with 1 × PBS, the coimmunoprecipitated proteins were eluted with standard 1× SDS sample buffer and heated for 10 minutes at 95 °C. Finally, the proteins analyzed by immunoblotting as indicated. For Co-IP, the following antibodies were used: anti-SSFA2 (14157-1-AP, Proteintech); anti-F-Actin (1:1000; ab205, Abcam); anti-GSTM3 (1:1000; 67,634-1-Ig, Proteintech); anti-Flag (1:2000; TA-05, ZSGB-Bio); anti-Myc (1:2000; TA-01, ZSGB-Bio); Anti-rabbit IgG for IP Nano-secondary antibody (HRP) (1:10000; NBI01H, NBbiolab); Anti-mouse IgG for IP Nano-secondary antibody (HRP) (1:10000; NBI02H, NBbiolab).

Spermatogenic cells were obtained through cell density-gradient centrifugation using the STA-PUT velocity sedimentation method as previously described [18].

GraphPad Prism 9.0 software was used for statistical analysis. All data are shown as the means ± standard errors of the means (SEMs). Statistical significance between two groups was calculated using an unpaired, parametric, two-sided Student’s t test. Statistical significance was set at P < 0.05.

A 29-year-old man was recruited for our study who was diagnosed with 7 years of primary infertility at the West China Second University Hospital. Somatic cell karyotype (46, XY) (Supplemental Fig. 1), bilateral testicular size, secondary sex characteristics and hormone levels were normal (Supplementary Table SI). Semen analysis was performed in the clinical laboratories according to WHO guidelines [19]. The results of semen analysis are shown in Table 1. Remarkably, the sperm parameters determined by computer-assisted sperm analysis (CASA) showed that although the semen volume, sperm concentration and motility of spermatozoa in this patient were normal, all sperm heads were deformed, consisting of 100% round-headed acrosome-less spermatozoa. The patient was diagnosed with type I globozoospermia.

An evaluation of sperm morphology using Papanicolaou staining revealed abnormal sperm head development but normal sperm flagella (Fig. 1A and B). To further define the morphology of the patient’s spermatozoa, SEM was employed and exhibited aberrant sperm head morphology (Fig. 1C). To investigate whether the ultrastructure of sperm was damaged, we used TEM on this affected individual. The results showed that compared with healthy control sperm, the patient’s sperm flagella displayed a regular classic “9 + 2” structure and well-arranged mitochondria (Fig. 1D and E). The sperm heads were all round, with only a layer of plasma membrane covering them. Neither the acrosome nor the acroplaxome, which is a structure found between the acrosomal membrane and the nuclear membrane that anchors the acrosome to the nucleus during shaping of the spermatid head [21], was observed in the patient (Fig. 1F). The equatorial segment, a unique membranous structure in the middle of the sperm head that has a rather important function for fertilization [22], was also missing (Fig. 1F). Taken together, these observations suggested that this patient suffered from serious globozoospermia that further caused infertility.

In this study, we screened for gene variants in infertile males through WES. Consequently, a novel deleterious SSFA2 missense variant (c.3671G > A) was suggested to be the genetic cause of globozoospermia for this patient through bioinformatics analysis. The variant was absent or rare in public exome databases (dbSNP, ExAC, 1000Genomes project, and gnomAD) and was predicted to be potentially pathogenic according to SIFT, polyphen2, CADD, and MutationTaster (Supplementary Table SII), in keeping with it being a rare recessive pathogenic variant. Sanger sequencing in this family showed a cosegregation of genotype with the disease phenotype. His parents and sibling (IV-3) harbored a heterozygous variant of c.3671G > A, and his other sibling was not affected (Fig. 2A and B). Sanger sequencing verification of 220 healthy controls did not reveal the variant. The variant identified in the patient was located in exon 16 and altered a highly conserved amino acid in one unknown domain (residues E1209-S1247) of the SSFA2 protein (Fig. 2C).

To explore the adverse effects of the c.3671G > A variant on the expression of SSFA2, we first investigated the distribution of SSFA2 in sperm cells from the patient and healthy controls by immunofluorescence analysis. The results showed that SSFA2 was expressed in the acrosome from normal spermatozoa and merged with the acrosome marker peanut agglutinin-lectin (PNA). However, SSFA2 was not detected in the patient’s sperm (Fig. 3A). Expectedly, the expression of SSFA2 was almost undetectable in the patient’s sperm by western blot analysis (Fig. 3B). These results implied that SSFA2 plays a vital role in spermatogenesis. Subsequently, immunofluorescence staining of human testis sections showed that SSFA2 expression was obvious in different spermatogenic cells (Supplemental Fig. 2A). To further understand the localization of SSFA2 in different steps of sperm development, the STA-PUT velocity sedimentation method was used to isolate different stages of germ cells in human testes. Specifically, the SSFA2 protein was mainly distributed in the cytoplasm of spermatogonia. With the morphological transformation of spermatids, SSFA2 gradually translocated from the cytoplasm to the sperm acrosome (Supplemental Fig. 2B). In short, these results indicated that SSFA2 is essential for the development and maintenance of sperm acrosomes and that this homozygous missense variant in SSFA2 seriously affects the expression of SSFA2.

To uncover the molecular mechanism of the c.3671G > A variant involved in SSFA2 expression, we initially predicted the conformational changes of the mutant SSFA2 by the RoseTTAFold web tool (https://​robetta.​bakerlab.​org/​submit.​php) and the I-Mutant server (http://​gpcr.​biocomp.​unibo.​it/​cgi/​predictors/​I-Mutant3.​0/​I-Mutant3.​0.​cgi). The molecular simulation showed that the Gibbs free-energy gap (ddG) and stability of mutant SSFA2 were reduced compared to those of the wild type (Fig. 3C). Next, for the analysis of mutant proteins, we established eukaryotic expression vectors of wild-type (Flag-WT-SSFA2) and mutant SSFA2 (Flag-mut-SSFA2) including the variant site, and then transfected them into HEK293T cells. Markedly reduced protein levels of SSFA2 were observed in cells overexpressing the Flag-mut-SSFA2 plasmid compared to cells overexpressing the Flag-WT-SSFA2 plasmid by western blot analysis (Fig. 3D). Collectively, these results suggested that this missense variant of c.3671G > A in SSFA2 significantly reduced SSFA2 expression and impaired the development of the sperm acrosome and further led to the globozoospermia phenotype.

To further explore the potential mechanism of SSFA2 in spermatogenesis, immunoprecipitation of SSFA2 from normal human testes followed by LC–MS/MS analysis was adopted and revealed 58 interactors of SSFA2. Among them, GSTM3 and Actin were relatively highly abundant. Previous research showed that the N-terminal region of SSFA2 may interact with IP3 receptors (IP3Rs), while the C-terminal region may interact with Actin. SSFA2 tethers IP3Rs to Actin alongside sites where store-operated Ca²⁺ entry occurs, licensing them to evoke cytosolic Ca²⁺ signals [14, 23]. Immunofluorescence staining showed that SSFA2 and Actin colocalized in the sperm acrosome (Fig. 4A). We further confirmed their interactions by Co-IP and immunofluorescence analyses in human testes (Fig. 4B and C). GSTM3 is abundantly expressed in human testes and is involved in sperm-zona pellucida binding events in which GSTM3 binds to ZP4 during the first steps of gamete recognition to allow fertilization to occur [24‐26]. GSTM3, located in the tail and equatorial subdomain, has been recently established as a fertility and cryotolerance biomarker in boar sperm [27‐29]. As expected, GSTM3 was also located on the tail and equatorial plate of humans and colocalized with SSFA2 on the equatorial plate of sperm (Fig. 4D). Co-IP and immunofluorescence analyses also demonstrated the interactions in human testis (Fig. 4E and F). Furthermore, the Myc-WT-GSTM3 plasmid and the Flag-WT-SSFA2 plasmid were cotransfected into the HEK293T cell line, and immunofluorescence staining showed that they were colocalized in the cytoplasm (Fig. 4G). Co-IP also proved that GSTM3 and SSFA2 can interact in vitro (Fig. 4H).

Primarily, a regular ICSI cycle was attempted for the couple, and an informed consent form was signed for the ICSI procedure. The basal hormone data of the patient’s wife were regular (Table 2). Ovulation induction was performed, and the long protocol is presented in Table 2. Consequently, 24 mature oocytes were aspirated during follicular puncture, and the ejaculated sperm from the patient were injected into the 24 oocytes for the ICSI cycle. As shown in Table 2, the cycle achieved 16.7% fertilization; apparently, the sperm obtained from this patient failed to activate most MII oocytes (Fig. 5A). Three of the four embryos reached the cleavage stages (Fig. 5B). Unfortunately, none of them developed into high-quality embryos for transfer. The outcome of regular ICSI treatment suggested that the patient’s sperm defect caused oocyte activation failure. Phospholipase C zeta (PLCζ), an important sperm factor, is widely considered to be one of the physiological stimuli responsible for the generation of Ca²⁺ oscillations that induce egg activation and early embryonic development [30, 31]. It has been shown that defects in PLCζ in infertile male patients lead to failure of egg activation following ICSI [32‐39]. Therefore, we examined the expression of PLCζ in the patient’s sperm. Immunofluorescence staining showed that the expression of PLCζ in the patient’s sperm was significantly lower than that in healthy controls (Fig. 5C). This observation was further confirmed by western blotting analysis (Fig. 5D).

A previous study revealed that PLCζ defect-associated oocyte activation failure was rescued by ICSI with AOA [40]. After the first failed ICSI attempt, we performed AOA with a calcium ionophore (A23187) after the second ICSI attempt. Delightfully, in the AOA-ICSI cycle, 10 MII oocytes were injected with sperm from the patient, all of them achieved successful normal fertilization after AOA, and eight transferable embryos were obtained (with five good-quality embryos) (Table 2). After embryo selection, we transferred embryos (one eight-cell embryo) on Day 3 and achieved pregnancy, and a healthy baby was born to the couple. These results suggest that SSFA2 variant-associated infertility could be successfully rescued by ICSI with AOA.