A novel anti-mycobacterial function of mitogen-activated protein kinase phosphatase-1

It has been reported that many inducers including growth factors, LPS, peptidoglycan, and dexamethasone can stimulate the expression of MKP-1 in human macrophages, microglia, mast cells or fibroblasts [6]. To investigate the role of different TLR inducers in MKP-1 induction process in human blood monocytes, the level of MKP-1 mRNA was measured by quantitative polymerase chain reaction (QPCR) method. PBMo were isolated from primary human blood mononuclear cells and stimulated with Pam₃Cys (TLR2 agonist), poly IC (TLR3 agonist), or LPS (TLR4 agonist) for 1 and 3 hours. Following exposure to Pam₃Cys or LPS, there were significant inductions of MKP-1 mRNA levels within 1 hour of treatment (Figure 1A). These effects on MKP-1 induction continued for 3 hours post-treatment with Pam₃Cys (Figure 1A). In contrast, poly IC did not induce MKP-1 (Figure 1A). The results indicate that different inducers showed differential up-regulation of MKP-1 expression.

LPS has been extensively used to demonstrate the role of MKP-1 in immune response both in vivo and in vitro [9, 12]. To establish a foundation for interpretation of subsequent experimental results, LPS was used as a positive control for the induction of MKP-1 expression. To determine the levels of MKP-1 in response to LPS, kinetics of MKP-1 transcription were determined by QPCR. There was a significant induction of MKP-1 mRNA, which peaked as early as 1 hour upon LPS stimulation, and the levels gradually decreased over a course of 6 hours. These results showed that LPS induced MKP-1 expression (Figure 1B).

Next, to demonstrate the induction of specific phosphatases by BCG, kinetics of MKP-1 expression in PBMo was studied by using QPCR during BCG treatment. Similar to the results produced by LPS, upon the addition of BCG (MOI = 1 CFU/cell), there was a significant induction of MKP-1 mRNA within 1 hour of BCG treatment as determined by Taqman probe specific for MKP-1 (Figure 2A). The effects lasted for at least 6 hours (Figure 2A).

To examine whether the changes of protein production were in parallel to that of the mRNA levels, the protein levels of MKP-1 were measured by Western blotting. In response to BCG, PBMo produced the MKP-1 protein as early as 30 minutes after treatment. The protein levels were maintained for 2 hours and dropped to basal levels at 3 hours (Figure 2B). The results demonstrated that there was MKP-1 induction in response to BCG activation in human monocytes.

It has been shown that inhibition of p38 MAPK either by specific inhibitor or siRNA reduced the expression of MKP-1 in LPS- or peptidoglycan-treated macrophages [14]. To determine the mechanisms involved in the BCG-induced MKP-1 expression, PBMo were pretreated with several inhibitors including PD98059 (inhibitor for MAP kinase kinase [MEK] or ERK1/2), SB203580 (inhibitor for p38 MAPK), SP600125 (inhibitor for JNK), and CAPE (inhibitor for NF-κB) for 1 hour. A range of concentrations of each inhibitor was used to test their optimal concentrations and effects on cell viability and kinase inhibitions. BCG was added afterwards and total RNA was harvested. The results demonstrated that, with the inhibition of ERK1/2 and p38 MAPK activities by their corresponding relatively specific inhibitors, MKP-1 expressions were significantly reduced (Figure 3). In addition, using higher dose of SB203580, we showed that the inhibition is increased further (data not shown). On the contrary, pretreatment of the cells with CAPE and SP600125 did not affect the induction of MKP-1 by BCG (Figure 3). These results suggest that BCG-induced MKP-1 expression is dependent on both p38 MAPK and ERK1/2.

Throughout the above experiments, the primary goal was to examine the induction of MKP-1 by BCG in human monocytes. Thus, to further examine the role of MKP-1 in BCG-induced signaling, transfection of siRNA into PBMo was used to knockdown the activity of MKP-1. To demonstrate that the MKP-1 siRNA can indeed knockdown the target gene, PBMo were first transfected with control or MKP-1 siRNA and then treated with BCG for 3 hours. Levels of MKP-1 mRNA were measured by RT-PCR method. In Figure 4A, BCG stimulated MKP-1 expression (lanes 1 and 2). In MKP-1 siRNA transfected monocytes, induction of MKP-1 by BCG was significantly decreased (lanes 2 and 4). The results showed that the siRNA does abrogate the levels of MKP-1 mRNA.

To further determine whether MKP-1 siRNA affects BCG-induced MKP-1 at protein levels, PBMo were treated as above and MKP-1 proteins were measured by Western blotting. The results showed that BCG could induce MKP-1 proteins as usual for cells transfected with control siRNA (Figure 4B, lanes 1-3). However, the levels of BCG-induced MKP-1 protein expression were reduced in cells transfected with MKP-1 siRNA (Figure 4B, lanes 4-6). Together, the results suggest that MKP-1 siRNA not only reduced the MKP-1 mRNA in BCG treatment but also abrogated the BCG-induced MKP-1 protein.

As stated in the literature [9], MKP-1 KO mice showed increased TNF-α production in response to LPS. On the basis of the above MKP-1 siRNA results, LPS was then used as a control to demonstrate the effects of this MKP-1 siRNA system.

PBMo were first transfected with control or MKP-1 siRNA for 24 hours and then stimulated with LPS for the indicated time periods. Likewise, LPS induced MKP-1 within 1 hour treatment and the effects lasted for at least 6 hours (Figure 4C, lanes 1-4). The use of MKP-1 siRNA can reduce the levels of MKP-1 mRNA induced by LPS (Figure 4C, lanes 5-8). On the contrary, TNF-α levels were increased in MKP-1 siRNA transfected monocytes upon challenge with LPS (Figure 4C, lanes 5-8). The increases in cytokine expression induced by LPS in MKP-1 siRNA transfected cells suggest that the siRNA system is effective in knocking down the MKP-1 expression and MKP-1 acts as a negative regulator in LPS-induced TNF-α expression.

To investigate the effect of MKP-1 siRNA on BCG-induced cytokine expression, the levels of TNF-α, IL-6 and IL-10 mRNA were measured by QPCR method. PBMo were transfected with either control or MKP-1 siRNA. Following exposure to BCG with control siRNA, there were significant inductions of TNF-α, IL-6 and IL-10 mRNA levels for 3 hours after treatment as previously reported ([5] and data not shown). Next, the effects of MKP-1 siRNA were examined on the cytokine expression induced by BCG. Surprisingly, there was a significant abrogation of BCG-induced TNF-α expression by MKP-1 siRNA (Figure 4D). With the knockdown of MKP-1, the level of BCG-induced TNF-α was only 60% compared to that of the control cells, while BCG-induced IL-6 and IL-10 were unchanged in MKP-1 siRNA transfected cells. The results revealed that MKP-1 plays a role in the induction of TNF-α expression upon BCG stimulation, which may be different from that of its conventional functions in which MKP-1 acts as a negative regulator in LPS-induced signaling pathways [7].

The unexpected observations in cytokine expression lead to the investigation on the effects of MKP-1 siRNA on BCG-induced MAPK activation. MKP-1 was found to have a preferential substrate binding to p38 MAPK and JNK than ERK1/2 [7]. The phosphorylation status of MAPKs was assessed in control or MKP-1 siRNA transfected PBMo. Western blotting results demonstrated that BCG-induced both p38 MAPK and ERK1/2 phosphorylation in 15 minutes (data not shown) and peaked at 30 minutes, and then returned to basal levels in cells treated with the control siRNA (Figure 5). Similar to the results of cytokine expression, phosphorylation of both p38 MAPK and ERK1/2 in response to BCG was decreased in monocytes transfected with MKP-1 siRNA instead of the expected increase in phosphorylation (Figure 5). The results suggest that MKP-1 knockdown would result in reduced MAPK phosphorylation by BCG, implying that the reduced level of TNF-α production in BCG stimulated monocytes is due to reduced phosphorylation of MAPKs by MKP-1 siRNA.

BCG vaccine Danish strain 1331 (Statens Serum Institut) was used in all experiments. The vaccine has passed the safety test, in which there are no macroscopic signs of tuberculosis in vaccinated animals, as stated in the Certificate of Analysis provided by Quality Assurance Department, Statens Serum Institut, Copenhagen, Denmark.

PBMo were isolated from buffy coats of healthy blood donors (source: the Hong Kong Red Cross Blood Transfusion Service) by Ficoll-Paque (Pharmacia Biotech) density gradient centrifugation as before [17‐19] with modification using MACS^® Technology according to the manufacturer's instructions (Miltenyi Biotec, Germany). Approval has been obtained from Hong Kong Red Cross Blood Transfusion Service for the use of donors' blood. Institutional Review Board of the University of Hong Kong has given exemption to this project since it did not involve the use of human or animal subjects. Briefly, the fresh leukocytes were centrifuged at 3000 r.p.m. for 15 minutes and were separated into plasma and cell layers. Plasma was removed and incubated at 56°C for 30 minutes. It was quickly chilled on ice and centrifuged at 3000 r.p.m. for 10 minutes. The supernatant was then filtered through syringe filter and used as the autologous plasma. The cell layer was diluted with PBS in the ratio of 1:1. The diluted cells were overlaid over the Ficoll very slowly and centrifuged at 2300 r.p.m. for 20 minutes. The lymphocyte/monocyte layer was removed and washed with RPMI medium 1640 until the supernatant was clear. The cell pellet was resuspended in PBS with CD14 MicroBeads (Miltenyi Biotec, Germany) and incubated at 4°C for 30 minutes. The cells were washed with PBS and passed through MACS^® LS Columns placed in a MACS^® Separator. The columns were washed with PBS for three times and were removed from the separator. PBMo were flushed out from the columns by applying the plunger. The cells were finally seeded onto the tissue culture plates in RPMI, supplemented with 5% autologous plasma. Cell purity of CD14⁺ monocytes, measured by flow cytometry and antibody conjugated with PE against CD14 (Beckman, France), was >90%.

Total RNA extraction was done by using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. Cells were lysed in TRIzol reagent at room temperature for 5 minutes to allow for complete dissociation of nucleoprotein. Chloroform was then added. The tube was vigorously shaken for 15 seconds and incubated at room temperature for 3 minutes. The sample was centrifuged at 4°C for 15 minutes at 13,200 r.p.m. The colorless upper aqueous phase was transferred to a fresh tube. RNA was precipitated from aqueous phase by mixing with one volume of isopropyl alcohol at room temperature for 10 minutes. The sample was centrifuged again at 4°C for 10 minutes at 13,200 r.p.m. The supernatant was removed and the RNA pellet on the side and bottom of the tube was washed once with 75% ethanol. The sample was mixed by vortexing and centrifuged at 4°C for 5 minutes at 13,200 r.p.m. After removing the ethanol, the RNA pellet was dried in air for 10 minutes. Each RNA sample was dissolved in DEPC-water mixed with RNase inhibitor (Amersham Biosciences, USA). It was finally mixed with DNase buffer [25 mM Tris-HCl (pH 7.4), 5 mM MgCl₂], 1 unit of DNase at 37°C for 15 minutes and then at 70°C for 10 minutes for deactivating the DNase. The samples were stored at -70°C until use.

First-strand cDNA was reverse-transcribed in a 20 μl reaction. DNase-treated RNA and 0.5 μg oligo(dT) primer (Invitrogen, USA) were heated at 70°C for 10 minutes and chilled quickly on ice. The product was then mixed with first strand buffer (50 mM Tris-HCl [pH 8.3], 75 mM KCl, 3 mM MgCl₂), 10 mM dithiothreitol (DTT), 0.5 mM deoxyribonucleoside triphosphates (dATP, dTTP, dCTP and dGTP) and 100 units of SuperScript™ II Reverse Transcriptase (Invitrogen, USA) at 42°C for 1 hour. The product was stored at -20°C until use for PCR and QPCR assays. Amplification of the reverse-transcribed cDNA was performed in a 25 μl reaction. PCR assays contained 5 pmol of each upstream and downstream primer, 1 unit of Taq DNA polymerase (Amersham Biosciences, USA), 0.2 mM each dNTP, and PCR reaction buffer [50 mM KCl, 1.5 mM MgCl₂, and 10 mM Tris-HCl (pH 9.0)]. PCR were allowed to proceed for various cycles (94°C for 30 s, melting temperature (TM) for 30 s, and 72°C for 1 min). PCR primer sets used and assay conditions were as follows: (1) GAPDH, 25 cycles (TM = 60°C), upstream, 5'-ACCACAGTCCATGCCATCAC-3', downstream, 5'-TCCACCACCCTGTTGCTGTA-3'; (2) MKP-1, 35 cycles (TM = 52°C), upstream, 5'-GCTGTGCAGCAAACAGTCGA-3'; downstream, 5'-CGATTAGTCCTCATAAGGTA-3' and (3) TNF-α, 30 cycles (TM = 56°C), upstream, 5'-GGCTCCAGGCGGTGCTTGTTC-3', downstream, 5'-AGACGGCGATGCGGCTGATG-3'. PCR products were analyzed on a 1% agarose gel with ethidium bromide and visualized under ultraviolet light. In order to check the size of the PCR products, 1 kb Plus DNA Ladder™ (Invitrogen, USA) was run along with the PCR products.

To perform QPCR, the levels of MKP-1, and TNF-α mRNA as well as the reference gene GAPDH (as internal control) were assayed by the gene-specific Assays-on-Demand reagent kits (Applied Biosystems, USA). All samples were run in duplicates or triplicates and with no template controls on an ABI Prism 7700 Sequence Detector. The analysis method of QPCR was the comparative cycle number to threshold (C_T) method as described in user bulletin no. 2 of the ABI Prism 7700 Sequence Detection System. The number of C_T of the targeted genes was normalized to that of GAPDH in each sample (ΔC_T). The C_T value of the treated cells was compared with that of the untreated or mock-treated cells (ΔΔCT). The relative gene expression of the targeted genes (fold induction) was calculated as 2^-ΔΔCT.

Total cellular proteins were extracted by lysing cells in lysis buffer containing 1% Triton X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 1 mM EGTA (pH 8.0), 1% SDS, 0.2 mg/ml PMSF, 1 μg/ml aprotinin, 1 mM sodium orthovanadate, 2 μg/ml pepstatin, 2 μg/ml leupeptin, and 50 mM sodium fluoride for 5 minutes. The homogenate was then boiled for 10 minutes and stored at -70°C until use. The concentrations of total protein in cell extracts were determined by BCA™ Protein Assay Kit (Pierce, IL, USA).

Western blot was done as described [20]. Equal amounts of protein were separated by 10% SDS-PAGE, electroblotted onto nitrocellulose membranes (Schleicher & Schuell), and followed by probing with specific antibodies for Actin, MKP-1 (Santa Cruz Biotech., USA), phospho-p38 MAPK, phospho-ERK1/2 (Cell Signaling, USA). After three washes, the membranes were incubated with the corresponding secondary antibodies. The bands were detected using the Enhanced Chemiluminescence System (Amersham Pharmacia Biotech) as per the manufacturer's instructions.

Transfection of siRNA into human monocytes was done as described [21]. MKP-1 siRNA included (i) MKP1-HSS102982, AAACGCUUCGUAUCCUCCUUUGAGG; (ii) MKP1-HSS102983, UUAUGCCCAAGGCAUCCAGCAUGUC; and (iii) MKP1-HSS102984, UGAUGGAGUCUAUGAAGUCAAUGGC. MKP-1 knockdown in PBMo was conducted by using MKP1-HSS102983 only or a pool of the above three different MKP-1 Stealth™ Select RNAi (ratio = 1:1:1, 200 nM, Invitrogen, USA). Stealth™ RNAi Negative Control Duplex (200 nM) was used as a control for sequence independent effects for the siRNA transfection. Transfection of monocytes was done by using jetPEI™ DNA transfection reagent (Polyplus Transfection, USA) according to the manufacturer's instructions. After transfecting the cells for 24 h, the transfectants were treated with different inducers as described above.

Statistical analysis was performed by Student's t test. Differences were considered statistically significant when p values were less than 0.05.