Skip to main content
Erschienen in: Virology Journal 1/2019

Open Access 01.12.2019 | Research

A novel avian isolate of hepatitis E virus from Pakistan

verfasst von: Tahir Iqbal, Umer Rashid, Muhammad Idrees, Amber Afroz, Saleem Kamili, Michael A. Purdy

Erschienen in: Virology Journal | Ausgabe 1/2019

Abstract

Background

Avian hepatitis E virus (aHEV) has been associated with hepatitis-splenomegaly syndrome (HSS) in chickens along with asymptomatic subclinical infection in many cases. So far, four genotypes have been described, which cause infection in chickens, specifically in broiler breeders and layer chickens. In the present study, we isolated and identified two novel aHEV strains from the bile of layer chickens in Pakistan evincing clinical symptoms related to HSS.

Methodology

Histology of liver and spleen tissues was carried out to observe histopathological changes in these tissues. Bile fluid and fecal suspensions were used for viral RNA isolation through MegNA pure and Trizol method which was further used for viral genome detection and characterization by cDNA synthesis and amplification of partial open reading frame (ORF) 1, ORF2 and complete ORF3. The bioinformatics tools; Molecular Evolutionary Genetics Analysis version 6.0 (MEGA 6), Mfold and ProtScale were used for phylogenic analysis, RNA secondary structure prediction and protein hydropathy analysis, respectively.

Results

Sequencing and phylogenetic analysis on the basis of partial methyltranferase (MeT), helicase (Hel) domain, ORF2 and complete ORF3 sequence suggests these Pakistani aHEV (Pak aHEV) isolates may belong to a Pakistani specific clade. The overall sequence similarity between the Pak aHEV sequences was 98–100%. The ORF1/ORF3 intergenic region contains a conserved cis-reactive element (CRE) and stem-loop structure (SLS). Analysis of the amino acid sequence of ORF3 indicated two hydrophobic domains (HD) and single conserved proline-rich domain (PRD) PREPSAPP (PXXPXXPP) with a single PSAP motif found in C-terminal. Amino acid changes S15 T, A31T, Q35H and G46D unique to the Pak aHEV sequences were found in the N-terminal region of ORF3.

Conclusions

Our data suggests that Pak aHEV isolates may represent a novel Pakistani clade and high sequence homology to each other support the supposition they may belong to a monophyletic clade circulating in the region around Pakistan. The data presented in this study provide further information for aHEV genetic diversity, genotype mapping, global distribution and epidemiology.
Hinweise

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
aHEV
Avian hepatitis E virus
BLS
Big Liver and Spleen
CRE
Cis-reactive element
Gt
Genotype
HD
Hydrophobic domain
Hel
Helicase
HSS
Hepatitis-splenomegaly syndrome
HVR
Hypervariable region
MeT
Methyltranferase
ORF
Open reading frame
Pak aHEV
Pakistani aHEV
PRD
Proline-rich domain
SLS
Stem-loop structure

Background

The family Hepeviridae, contains genetically diverse hepatitis E virus (HEV) strains, and is currently divided into two genera – Orthohepevirus and Piscihepevirus. The genus Orthohepevirus is subdivided into four species; Orthohepevirus A (containing HEV from humans, wild boar, pig, mongoose, deer, rabbits and camels), Orthohepevirus B (avian HEV), Orthohepevirus C (rat, ferret, bandicoot, shrew and mink HEV) and Orthohepevirus D (bat HEV). The genus Piscihepevirus includes a single species with a single member from cutthroat trout. HEV strains detected in little egret, kestrel, moose and foxes are currently unclassified [13].
The aHEV was first isolated and identified from chickens suffering from HSS in the United States in 2001 [4]. Another chicken disease, Big Liver and Spleen (BLS), was also found to be associated with aHEV [5]. The genome of aHEV consists of a single-stranded positive sense RNA that is approximately 6.6 kb in length that is 600 bp smaller than Orthohepevirus A genomes. Like other HEV species, the aHEV genome consists of three open reading frames (ORFs). Non-structural genes necessary for viral replication (methyltransferase, putative papain-like cysteine protease, hypervariable region (HVR), macro domain, helicase and replicase), are encoded by ORF1. ORF2 encodes the capsid, and ORF3 codes for a small regulatory protein required for virion egress [6, 7]. The shortened portion of the aHEV genome is ORF1, which has a truncated region between MeT and the HVR [8], as compared to the Orthohepevirus A genome. So far, four aHEV genotypes (Gt) have been isolated from avians; Gt1 (Australia and Korea), Gt2 (USA), Gt3 (Hungary and China), and Gt4 (Taiwan and Hungary) [9]. Interestingly, all four genotypes belong to a single serotype, which may facilitate development of a vaccine effective against all four genotypes [10]. Apart from chickens, novel avian-like HEVs have been isolated from little egrets (Egretta garzetta) and a sparrow [8, 11]. No zoonotic risk has been associated with aHEV. Attempts to experimentally infect mice and rhesus macaques with aHEV have been unsuccessful [6, 12]. However, experimental infection in turkeys (Meleagris gallopavo) with aHEV was successful with subsequent passage to naive turkeys [13]. The isolation of aHEV genotypes 1 and 3 from 62 different wild bird species indicates a broad host range for aHEV in avians [14].
To the best of our knowledge, this is the first description of an aHEV from South Asia. The current study was designed to isolate and characterize aHEV from layer chickens in Pakistan, and we report a novel aHEV strain that appears to belong to a previously unknown Pakistani clade.

Materials and methods

Sampling and histology

Spleen and liver tissue, bile fluid, and fecal swabs were collected from 19 layer chickens (nos. PT1 – PT19) within 12 h after their death; age range 30–90 weeks, from different poultry farms situated in Pattoki Punjab, Pakistan (31°1 N 73°51E). These samples were collected with the help of a veterinarian after necropsy, and the carcasses were examined for clinical symptoms related to HSS; enlarged liver and spleen, serosanguinous fluid in the abdominal cavity and hemorrhagic foci in liver tissue. Liver and spleen tissues were fixed in 10% formalin for histological studies, embedded in paraffin and stained with hematoxylin and eosin (H&E) [15]. Bile fluid and fecal swab samples were collected in sterilized 1.5 ml microfuge tubes, transported to the lab on ice and stored at − 80 °C for future analysis. Fecal suspension samples positive for aHEV RNA were kindly provided by Dr. X. J. Meng (Center for Molecular Medicine and Infectious Diseases, Virginia Tech, VA, USA).

Viral RNA isolation, detection, and gene amplification

Total RNA was isolated from bile and fecal suspensions using Trizol (Invitrogen) and the MegNA Pure 24 system (Roche), following manufacturers’ instructions. A total volume of 200 μl of either bile fluid or fecal suspension was used for total RNA extraction.
Primers for this study (Table 1) were designed from the conserved regions in the aHEV genome- identified by multiple sequence alignment (MEGA 6) [16] of complete aHEV genomes (AM943647, AY535004, AM943646, KF511797) available from GenBank. The detection of aHEV RNA in bile fluid and fecal suspension samples was carried out according to the procedure reported by Kwon et al. [17]. The partial helicase (Hel) and capsid gene sequences were amplified using primer sets RPHF/RPHR and RPO2F/RPO2R, respectively. The following thermal profile was used to amplify these fragments; initial denaturation at 95 °C for 2 min followed by 40 cycles denaturation at 95 °C for 30 s, annealing at 50 °C for 30 s and extension at 72 °C for 1 min. Fragments from the ORF1, ORF2 and ORF3 junction region, a partial MeT and an ORF2 fragment were amplified with primer sets APO31S/APO31A, aHCGF/F1R and F9F/aHCGR, respectively using the following conditions; initial denaturation at 95 °C followed by 40 cycles of denaturation at 95 °C for 45 s, annealing at 55 °C for 45 s and extension at 72 °C for 3 min. The PCR products were observed on 0.8, 1, and 2% agarose gels according to their size.
Table 1
Primers used in this study
Fragment
Primer ID
Sequence (5′-3′)
GC%
Nucleotide Positiona
Fragment size (bp)
Reference
MeT
aHCGF
GCATGACCCCATGCCAGGGTAAG
61
1–23
849
This study
F1R
CGGCATGGGGCAGGGCTGGGT
76
849–829
Hel
RPHF
TGGCGCACYGTWTCYCACCG
60
2791–2810
186
[16]
RPHR
CCTCRTGGACCGTWATCGACCC
59
2956–2977
ORF2
RPO2F
GGTATGGTTGATTTTGCCATAAAG
38
5433–5456
280
[16]
RPO2R
GCTGCNCGNARCAGTGTCGA
55
5694–5713
ORF2
F9F
AATGGTAGCTCCGTGGTTTGGTATGC
50
6273–6298
385
This study
aHCGR
ACTATGCCCGAGATGGGAGG
60
6658–6639
ORF123 junction & complete
ORF3
APO31S
ACCATCCAGCTTGTGGCGG
63
4480–4499
902
This study
APO31A
CACAAACCATGAGCATGCCGGACG
58
5382–5359
anucleotide positions using reference sequence AM943646

Sequencing and phylogenetic analysis

Bile and fecal specimens testing positive for HEV RNA by RT-PCR were sequenced bi-directionally by Sanger sequencing using the BigDye Terminator v3.1 Cycling Sequencing kit (Applied Biosystems). The sequences were analyzed using DNASTAR (Lasergene). A BLAST search was done on the obtained sequences [18]. Percent identity (PI) and phylogenetic analyses was done with MEGA 6 and sequence alignments were done using ClustalX2.1 in comparison with other aHEV (Orthohepevirus B) (Table 2) and Orthohepevirus A sequences (Table 3) [16, 19]. The RNA Stem-loop structure (SLS) prediction was done on the Mfold web server using a folding temperature fixed at 37 °C [20].
Table 2
Percent similarity of Pak aHEV strains with other Orthohepevirus B (avian) sequences based on partial ORF1 (MeT, Hel), ORF2 and complete ORF3 nucleotide sequences
Orthohepevirus B sequences
Genotype/ country (GenBank accession no.)
% nucleotide similarity
MeT
Hel
ORF2
ORF3
Pak aHEV (PT12B)
 Gt1/Australia (AM943647)
90a
83
84
95
 Gt1/Korea (JN597006)
88
84
83
94
 Gt2/USA (AY535004)
88
84
85
94
 Gt3/ Hungary (AM943646)
87
85
84
94
 Gt3/China (GU954430)
87
84
84
94
 Gt4/ Taiwan (KF511797)
87
80
83
93
 Pak aHEV (PT16B)
98
100
99
100
Pak aHEV (PT16B)
 Gt1/Australia (AM943647)
91
83
84
95
 Gt1/Korea (JN597006)
89
84
83
94
 Gt2/USA (AY535004)
89
84
84
94
 Gt3/ Hungary (AM943646)
88
85
83
94
 Gt3/China (GU954430)
88
84
84
94
 Gt4/ Taiwan (KF511797)
88
80
83
93
 Pak aHEV (PT12B)
98
100
99
100
aBolded numbers show the highest sequence identity to the Pak aHEV sequences. Korea, Republic of Korea
Table 3
Percent similarities of Pak aHEV sequences with Orthohepevirus A sequences based on partial ORF1 (MeT, Hel), ORF2 and complete ORF3 nucleotide sequences
mHEV strains
Genotype/ country (GenBank accession no.)
% nucleotide similarity
MeT
Hel
ORF2
ORF3
Pak aHEV (PT12B)
 Gt1/China (D11092)
57
66a
46
42
 Gt1/Pakistan (M80581)
55
66
49
42
 Gt1/Burma (M73218)
58
64
48
42
 Gt3/USA (AF082843)
56
61
48
41
 Gt3/China (FJ527832)
55
61
46
42
 Gt4/China (AJ272108)
55
60
47
45
 Gt4/Korea (FJ763142)
58
61
47
43
 Gt2/Mexico (M74506)
59
65
47
42
Pak aHEV (PT16B)
 Gt1/China (D11092)
56
66
47
42
 Gt1/Pakistan (M80581)
55
66
50
42
 Gt1/Burma (M73218)
57
64
48
42
 Gt3/USA (AF082843)
55
61
48
41
 Gt3/China (FJ527832)
55
61
46
42
 Gt4/China (AJ272108)
55
60
47
45
 Gt4/Korea (FJ763142)
58
61
47
43
 Gt2/Mexico (M74506)
58
65
47
42
aBolded numbers show the highest sequence identity to the Pak aHEV sequences. Korea, Republic of Korea

Protein hydropathy analysis

The ProtScale tool [21] on the ExPASy server (https://​web.​expasy.​org/​protscale/​) was used to analyze the hydropathic character of the ORF3 peptide using the Kyte and Doolittle scale [22].

Results

Out of a total of 19 layer chickens, aHEV RNA was detected in 2 bile samples (PT12B and PT16B). None of the fecal samples were positive for aHEV RNA. The aHEV RNA-positive bile samples came from 71 week old layer chickens with clinical symptoms related to HSS from the same poultry farm. Sequence information was obtained from these two aHEV RNA positive bile samples from five sub-genomic regions. Regions 40–447 nt (reference AM943646) and 2771–2956 nt cover part of the MeT and Hel domains in ORF1, respectively. The remaining three regions were concatenated together, and cover junction region between ORF1, ORF2 and the complete ORF3 sequence (4545–5475 nt) plus two additional fragments from ORF2 (5479–5829 nt and 6273–6658 nt). These aHEV sequences were submitted to GenBank (accession numbers: MG692742, MG692743, MG692744, MH018052, MH018053, MH094852, MH094853, MH243320 and MH243321).

Pathologic examination

The gross pathological examination revealed enlargement and discoloration of the livers in both birds with hemorrhage and hemorrhagic foci in PT12 (Fig. 1a) and serosanguinous fluid in the abdominal cavity in PT16 (Fig. 1d). Liver histology showed severing necrotizing hepatitis with prominent infiltration of lymphocytes (Fig. 1b & e). There was also a depletion of lymphocytes in the spleens along with aggregates of lymphocytes, particularly in the periarteriolar sheath (PAS) areas (Fig. 1c & f).

Sequencing and phylogenetic analysis

Sequence analysis indicated that both aHEV sequences shared the following nucleotide sequence identities (NSI) in the partial MeT (87–91%), Hel (83–85%), ORF2 (83–85%) and complete ORF3 (93–95%) when compared with homologous aHEV (Gt1–4) genome sequences, and both Pakistani sequences shared 98–100% sequence identity with each other. The Pakistani aHEV sequences showed high NSI when compared to the known aHEV genotypes with PT12B exhibiting the highest similarities to MeT (90%, Gt1), Hel (85%, Gt3), ORF2 (85%, Gt2) and ORF3 (95%, Gt1), and for PT16B the highest similarities were MeT (91%, Gt1), Hel (85%, Gt3), ORF2 (84%, Gt1 and 3) and ORF3 (95%, Gt1) (Table 2). Interestingly, amino acid sequence analysis using the complete ORF3 sequence showed that both Pak aHEV shared sequence identities of 89–92% with Gt1–4 avian HEV sequences. Both sequences shared overall NSIs for the partial MeT (55–59%), Hel (60–66%), ORF2 (46–60%) and complete ORF3 (41–45%) with homologous genome regions from Orthohepevirus A Gt1–4 (Table 3). The amino acid sequence identity between the Pak aHEV complete ORF3 sequences and corresponding Orthohepevirus A Gt1–4 sequences was 20–22%.
Analysis of phylogenetic trees using avian HEV sequences from the partial MeT, Hel, concatenated ORF2 and complete ORF3 nucleotide sequences, indicated that the Pakistani sequences cluster together, but do not cluster with any of the aHEV GT1–4 sequences, and the aHEV Gt1–4 sequences clustered into genotypic specific clades (Figs. 2 and 3). Figure 4 shows a bootstrap analysis for the fully concatenated Pakistani sequences. The figure shows that the Pakistani sequences form a monophyletic clade with high bootstrap support.
Multiple sequence alignment of the ORF1/ORF3 intergenic junction region (IJR), 4600–4633 nt (reference AM943646), indicated sequence conservation UGAACAA4603AUAACA of the ORF1 stop codon (Italic) and the cis-reactive element (CRE) (in bold). The second conserved region G4616AUGCAGCCUGCGCGUCG4633, is involved in formation of a putative stem-loop structure. The bold bases indicate the bases involved in stem formation in Pak aHEV sequences, while Italic bases are conserved in all aHEV sequences (Fig. 5).

Complete ORF3 amino acid sequence analysis

Overall three hydrophobic domains (HD) were predicted in Pak aHEV ORF3 protein, two of which were located in N-terminal half, HD1 aa 3–10 and HD2 aa 16–38, and the third (HD3) almost in the middle of the protein, aa 43–50 (Fig. 6). The C-terminus contained a proline-rich domain (PRD), PREPSAPP (PXXPXXPP) (aa 64–74), with a single PSAP motif (aa 67–70). A conserved serine residue, adjacent to proline, located at position aa57 may be a potential phosphorylation site in the protein [23]. The N-terminal half was found to have 27.5% conserved cysteine residues across all aHEV sequences including the Pak aHEV sequences. In ORF3 the Pak aHEV sequences contained unique amino acid changes S15 T, A31T, Q35H, and G46D in the N-terminal half compared to other avian genotypes, (Fig. 6a).

Discussion

In the present study, we isolated and identified two novel aHEV (Pak aHEV) strains from the bile fluid of two 71 week old layer chickens with clinical symptoms related to HSS [24]. The fecal samples from the chickens were negative for viral RNA, which may be due to collection of samples more than 8 weeks post-infection. The lack of detection of fecal virus shedding 8 weeks post-infection has been reported previously [7]. These cases seemed to be sporadic as there was no evidence of an outbreak in the area.
The Pak aHEV isolates analysis shared 98–100% nucleotide identity with each other across the sequenced regions. The NSI of partial ORF1, ORF2 and complete ORF3 with other aHEV sequences was 82–93%, which is comparable to the complete, or the nearly complete genome sequencing data of Moon et al. [25]. Similarly, NSI of 20–22% for Pak aHEV ORF3 sequences with Orthohepevirus A sequences are similar to results reported by Huang et al. [6]. The phylogenetic analysis, based on partial ORF1, ORF2 and complete ORF3, showed that the Pak aHEV sequences formed a monophyletic clade suggesting that Pak aHEV sequences belong to a previously unknown aHEV genotype [24]. Characterization of the ORF1/ORF3 intergenic region indicated two important conserved features in Pak aHEV sequences. First, the CRE sequence is thought to act as a promoter for the subgenomic bicistronic (ORF2, ORF3) RNA [26]. In contrast to little egret HEV [8], the CRE sequence of Pak aHEV strains did not include the ORF1 stop codon, which was found three nucleotides upstream in this study. Second, the SLS sequence is situated five nucleotides downstream of the CRE. There are five base changes in Pak aHEV compared with the other aHEV genotypes; however, the stem loop structure is maintained in the Pak aHEV SLS (Fig. 5a) [27, 28].
The importance of the OFR3 encoded protein as a multifunctional protein has been described in previous studies [29]. In addition, a recent study elucidated its function as a viroporin, a virus-encoded ion channel to facilitate release of infectious virions from the host cell [30]. In this context, two hydrophobic domains are found in the N-terminal half of the Pak aHEV ORF3 protein and a third is found in the middle of the protein. Hydrophobic domains have been identified in the N-terminus of other Orthohepevirus isolates [31]. The C-terminus of Pak aHEV strains contained a single proline-rich domain (PRD) as found among other Orthohepevirus isolates [7, 28]. Moreover, a single PSAP motif was found within the PRD, which has been implicated in viral egress through interaction with host tumor suppressor gene 101 (TSG101) protein and viroporin formation [7, 30]. The conserved serine residue in the PSAP motif found among Orthohepevirus isolates is also found in the Pak aHEV sequences, which may be a potential phosphorylation site for MAP kinase [32]. The N-terminal half of Pak aHEV ORF3 is hydrophobic, with a high proportion of cysteine residues (27.5%), which may reinforce ORF3 protein folding in the extracellular environment through disulfide bond formation when HEV virions egress the host cell, and act as metal binding motifs inside the host cell [22, 32, 33]. Pak aHEV ORF3 sequences contain unique amino acid changes S15 T, A31T, Q35H and G46D compared to other aHEV genotypes.
Limitations of our study include the fact that only two specimens could be sequenced. In addition there was not enough material to obtain a complete genome sequence from either specimen. For this reason we cannot prove these sequences belong to a novel genotype, even though they do not cluster in any known genotype, and the lack of complete genome sequences prevents us from proving these are unique strains.
To our knowledge, this study is the first report describing a novel avian HEV from Pakistan and possibly South Asia, providing further information for aHEV genetic diversity, genotype mapping, global distribution and epidemiology. Additionally, determining the prevalence of aHEV in broiler breeder and layer chickens in Pakistan may help further to characterize this strain and yield information about its impact on the health of the chicken population in Pakistan. This report is based on partial genome sequences; hence, further characterization based on complete genome sequences is needed to determine whether the Pakistani sequences may belong to a new aHEV genotype.

Conclusions

On the basis of partial MeT, Hel, ORF2 and complete ORF3 sequences the present study reveals that Pak aHEV isolates may represent a novel Pakistani clade and high sequence homology to each other support the supposition they may belong to a monophyletic clade circulating in the region around Pakistan. Pak aHEV ORF3 sequences contain unique amino acid changes S15 T, A31T, Q35H and G46D compared to other aHEV genotypes. The data presented in this study provide further information for aHEV genetic diversity, genotyping, global distribution and epidemiology.

Acknowledgements

We are thankful to X. J. Meng, Center for Molecular Medicine and Infectious Diseases, Virginia Tech VA USA for aHEV positive control samples and our colleagues at Viral Hepatitis Division CDC Atlanta USA, especially Muhammad Zafrullah, Tonya Hayden, Drobeniuc Jan, Choi Younkyung, Kodani Maja, Lilia Ganova-Raeva, Natasha Khudyakov, Alexandra Tejada and Nicholas Wiese, for their support and valuable suggestions.

Disclaimer

The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the Centers for Disease Control and Prevention.
N/A.
N/A.

Competing interests

The authors declare that they have no competing interests.
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H. ICTV virus taxonomy profile: Hepeviridae. J Gen Virol. 2017;98:2645–6.CrossRef Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H. ICTV virus taxonomy profile: Hepeviridae. J Gen Virol. 2017;98:2645–6.CrossRef
2.
Zurück zum Zitat Smith DB, Simmonds P, International committee on taxonomy of viruses Hepeviridae study, Jameel S, Emerson SU, Harrison TJ, Meng XJ, Okamoto H, Van der Poel WH, Purdy MA. Consensus proposals for classification of the family Hepeviridae. J Gen Virol. 2014;95:2223–32.CrossRef Smith DB, Simmonds P, International committee on taxonomy of viruses Hepeviridae study, Jameel S, Emerson SU, Harrison TJ, Meng XJ, Okamoto H, Van der Poel WH, Purdy MA. Consensus proposals for classification of the family Hepeviridae. J Gen Virol. 2014;95:2223–32.CrossRef
3.
Zurück zum Zitat Smith DB, Simmonds P, Jameel S, Emerson SU, Harrison TJ, Meng XJ, Okamoto H, Van der Poel WH, Purdy MA. Consensus proposals for classification of the family Hepeviridae. J Gen Virol. 2015;96:1191–2.CrossRef Smith DB, Simmonds P, Jameel S, Emerson SU, Harrison TJ, Meng XJ, Okamoto H, Van der Poel WH, Purdy MA. Consensus proposals for classification of the family Hepeviridae. J Gen Virol. 2015;96:1191–2.CrossRef
4.
Zurück zum Zitat Haqshenas G, Shivaprasad H, Woolcock P, Read D, Meng XJ. Genetic identification and characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly syndrome in the United States. J Gen Virol. 2001;82:2449–62.CrossRef Haqshenas G, Shivaprasad H, Woolcock P, Read D, Meng XJ. Genetic identification and characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly syndrome in the United States. J Gen Virol. 2001;82:2449–62.CrossRef
5.
Zurück zum Zitat Marek A, Bilic I, Prokofieva I, Hess M. Phylogenetic analysis of avian hepatitis E virus samples from European and Australian chicken flocks supports the existence of a different genus within the Hepeviridae comprising at least three different genotypes. Vet Microbiol. 2010;145:54–61.CrossRef Marek A, Bilic I, Prokofieva I, Hess M. Phylogenetic analysis of avian hepatitis E virus samples from European and Australian chicken flocks supports the existence of a different genus within the Hepeviridae comprising at least three different genotypes. Vet Microbiol. 2010;145:54–61.CrossRef
6.
Zurück zum Zitat Huang FF, Sun ZF, Emerson SU, Purcell RH, Shivaprasad HL, Pierson FW, Toth TE, Meng XJ. Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV. J Gen Virol. 2004;85:1609–18.CrossRef Huang FF, Sun ZF, Emerson SU, Purcell RH, Shivaprasad HL, Pierson FW, Toth TE, Meng XJ. Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV. J Gen Virol. 2004;85:1609–18.CrossRef
7.
Zurück zum Zitat Kenney SP, Pudupakam RS, Huang YW, Pierson FW, LeRoith T, Meng XJ. The PSAP motif within the ORF3 protein of an avian strain of the hepatitis E virus is not critical for viral infectivity in vivo but plays a role in virus release. J Virol. 2012;86:5637–46.CrossRef Kenney SP, Pudupakam RS, Huang YW, Pierson FW, LeRoith T, Meng XJ. The PSAP motif within the ORF3 protein of an avian strain of the hepatitis E virus is not critical for viral infectivity in vivo but plays a role in virus release. J Virol. 2012;86:5637–46.CrossRef
8.
Zurück zum Zitat Reuter G, Boros A, Mátics R, Kapusinszky B, Delwart E, Pankovics P. A novel avian-like hepatitis E virus in wild aquatic bird, little egret (Egretta garzetta), in Hungary. Infect Genet Evol. 2016;46:74–7.CrossRef Reuter G, Boros A, Mátics R, Kapusinszky B, Delwart E, Pankovics P. A novel avian-like hepatitis E virus in wild aquatic bird, little egret (Egretta garzetta), in Hungary. Infect Genet Evol. 2016;46:74–7.CrossRef
9.
Zurück zum Zitat Zhao Q, Syed SF, Zhou E-M. Antigenic properties of avian hepatitis E virus capsid protein. Vet Microbiol. 2015;180:10–4.CrossRef Zhao Q, Syed SF, Zhou E-M. Antigenic properties of avian hepatitis E virus capsid protein. Vet Microbiol. 2015;180:10–4.CrossRef
10.
Zurück zum Zitat Meng XJ. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol. 2010;140:256–65.CrossRef Meng XJ. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol. 2010;140:256–65.CrossRef
11.
Zurück zum Zitat Yang C, Wang L, Shen H, Zheng Y, Gauger PC, Chen Q, Zhang J, Yoon KJ, Harmon KM, Main RG, Li G. Detection and genomic characterization of new avian-like hepatitis E virus in a sparrow in the United States. Arch Virol. 2018;163:2861–4.CrossRef Yang C, Wang L, Shen H, Zheng Y, Gauger PC, Chen Q, Zhang J, Yoon KJ, Harmon KM, Main RG, Li G. Detection and genomic characterization of new avian-like hepatitis E virus in a sparrow in the United States. Arch Virol. 2018;163:2861–4.CrossRef
12.
Zurück zum Zitat Meng XJ, Shivaprasad H, Payne CJ. Hepatitis E Virus infections. In: Diseases of poultry. 13th ed. Ames: Blackwell Publishing Press; 2008. p. 443–52. Meng XJ, Shivaprasad H, Payne CJ. Hepatitis E Virus infections. In: Diseases of poultry. 13th ed. Ames: Blackwell Publishing Press; 2008. p. 443–52.
13.
Zurück zum Zitat Sun ZF, Larsen CT, Huang FF, Billam P, Pierson FW, Toth TE, Meng XJ. Generation and infectivity titration of an infectious stock of avian hepatitis E virus (HEV) in chickens and crossspecies infection of turkeys with avian HEV. J Clin Microbiol. 2004;42:2658–62.CrossRef Sun ZF, Larsen CT, Huang FF, Billam P, Pierson FW, Toth TE, Meng XJ. Generation and infectivity titration of an infectious stock of avian hepatitis E virus (HEV) in chickens and crossspecies infection of turkeys with avian HEV. J Clin Microbiol. 2004;42:2658–62.CrossRef
14.
Zurück zum Zitat Zhang S, Bilic I, Troxler S, Hess M. Evidence of genotypes 1 and 3 of avian hepatitis E virus in wild birds. Virus Res. 2017;228:75–8.CrossRef Zhang S, Bilic I, Troxler S, Hess M. Evidence of genotypes 1 and 3 of avian hepatitis E virus in wild birds. Virus Res. 2017;228:75–8.CrossRef
15.
Zurück zum Zitat Cardiff RD, Miller CH, Munn RJ. Manual Hematoxylin and Eosin Staining of Mouse Tissue Sections. Cold Spring Harb Protoc. 2014;2014(6):655–8.PubMed Cardiff RD, Miller CH, Munn RJ. Manual Hematoxylin and Eosin Staining of Mouse Tissue Sections. Cold Spring Harb Protoc. 2014;2014(6):655–8.PubMed
16.
Zurück zum Zitat Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9.CrossRef Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–9.CrossRef
17.
Zurück zum Zitat Kwon HM, Sung HW, Meng XJ. Serological prevalence, genetic identification and characterization of the first strains of avian hepatitis E virus from chickens in Korea. Virus Genes. 2012;45:237–45.CrossRef Kwon HM, Sung HW, Meng XJ. Serological prevalence, genetic identification and characterization of the first strains of avian hepatitis E virus from chickens in Korea. Virus Genes. 2012;45:237–45.CrossRef
18.
Zurück zum Zitat Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Schäffer AA. Database indexing for production MegaBLAST searches. Bioinfo. 2008;24:1757–64.CrossRef Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Schäffer AA. Database indexing for production MegaBLAST searches. Bioinfo. 2008;24:1757–64.CrossRef
19.
Zurück zum Zitat Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace MI, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinfo Appl Note. 2007;23:2947–8.CrossRef Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace MI, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. Clustal W and Clustal X version 2.0. Bioinfo Appl Note. 2007;23:2947–8.CrossRef
20.
Zurück zum Zitat Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003;31:3406–15.CrossRef Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003;31:3406–15.CrossRef
21.
Zurück zum Zitat Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A. Protein Identification and Analysis Tools on the ExPASy Server. In: Walker JM, editor. The Proteomics Protocols Handbook. Totowa: Humana Press Inc.; 2005. p. 571–607.CrossRef Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A. Protein Identification and Analysis Tools on the ExPASy Server. In: Walker JM, editor. The Proteomics Protocols Handbook. Totowa: Humana Press Inc.; 2005. p. 571–607.CrossRef
22.
Zurück zum Zitat Kyte J, Doolittle RF. A simple method for displaying the Hydropathic character of a protein. J Mol Biol. 1982;157:105–32.CrossRef Kyte J, Doolittle RF. A simple method for displaying the Hydropathic character of a protein. J Mol Biol. 1982;157:105–32.CrossRef
23.
Zurück zum Zitat Vulliet PR, Hall FL, Mitchell JP, Hardie DG. Identification of a novel proline-directed serine/threonine protein kinase in rat pheochromocytoma. J Biol Chem. 1989;264:16292–8.PubMed Vulliet PR, Hall FL, Mitchell JP, Hardie DG. Identification of a novel proline-directed serine/threonine protein kinase in rat pheochromocytoma. J Biol Chem. 1989;264:16292–8.PubMed
24.
Zurück zum Zitat Yugo DM, Hauck R, Shivaprasad HL, Meng XJ. Hepatitis virus infections in poultry. Avian Dis. 2016;60:576–88.CrossRef Yugo DM, Hauck R, Shivaprasad HL, Meng XJ. Hepatitis virus infections in poultry. Avian Dis. 2016;60:576–88.CrossRef
25.
Zurück zum Zitat Moon HW, Lee BW, Sung HW, Yoon BI, Kwon HM. Identification and characterization of avian hepatitis E virus genotype 2 from chickens with hepatitis-splenomegaly syndrome in Korea. Virus Genes. 2016;52:738–42.CrossRef Moon HW, Lee BW, Sung HW, Yoon BI, Kwon HM. Identification and characterization of avian hepatitis E virus genotype 2 from chickens with hepatitis-splenomegaly syndrome in Korea. Virus Genes. 2016;52:738–42.CrossRef
26.
Zurück zum Zitat Graff J, Nguyen H, Yu C, Elkins WR, Claire MS, Purcell RH, Emerson SU. The open reading frame 3 gene of hepatitis E virus contains a cis-reactive element and encodes a protein required for infection of macaques. J Virol. 2005;79:6680–9.CrossRef Graff J, Nguyen H, Yu C, Elkins WR, Claire MS, Purcell RH, Emerson SU. The open reading frame 3 gene of hepatitis E virus contains a cis-reactive element and encodes a protein required for infection of macaques. J Virol. 2005;79:6680–9.CrossRef
27.
Zurück zum Zitat Cao D, Huang YW, Meng XJ. The nucleotides on the stem-loop RNA structure in the junction region of the hepatitis E virus genome are critical for virus replication. J Virol. 2010;84:13040–4.CrossRef Cao D, Huang YW, Meng XJ. The nucleotides on the stem-loop RNA structure in the junction region of the hepatitis E virus genome are critical for virus replication. J Virol. 2010;84:13040–4.CrossRef
28.
Zurück zum Zitat Huang YW, Opriessnig T, Halbur PG, Meng XJ. Initiation at the third in-frame AUG codon of open reading frame 3 of the hepatitis E virus is essential for viral infectivity in vivo. J Virol. 2007;81:3018–26.CrossRef Huang YW, Opriessnig T, Halbur PG, Meng XJ. Initiation at the third in-frame AUG codon of open reading frame 3 of the hepatitis E virus is essential for viral infectivity in vivo. J Virol. 2007;81:3018–26.CrossRef
29.
Zurück zum Zitat Nan Y, Zhang Y-J. Molecular Biology and Infection of Hepatitis E Virus. Front Microbiol. 2016;7:1419.CrossRef Nan Y, Zhang Y-J. Molecular Biology and Infection of Hepatitis E Virus. Front Microbiol. 2016;7:1419.CrossRef
30.
Zurück zum Zitat Ding Q, Heller B, Capuccino JMV, Song B, Nimgaonkar I, Hrebikova G, Contreras JE, Ploss A. Hepatitis E virus ORF3 is a functional ion channel required for release of infectious particles. PNAS. 2017;114:1147–52.CrossRef Ding Q, Heller B, Capuccino JMV, Song B, Nimgaonkar I, Hrebikova G, Contreras JE, Ploss A. Hepatitis E virus ORF3 is a functional ion channel required for release of infectious particles. PNAS. 2017;114:1147–52.CrossRef
31.
Zurück zum Zitat Holla RP, Ahmad I, Ahmad Z, Jameel S. Molecular virology of hepatitis E virus. Semin Liver Dis. 2013;33:3–14.CrossRef Holla RP, Ahmad I, Ahmad Z, Jameel S. Molecular virology of hepatitis E virus. Semin Liver Dis. 2013;33:3–14.CrossRef
32.
Zurück zum Zitat Zafrullah M, Ozdener MH, Panda SK, Jameel S. The ORF3 protein of hepatitis E virus is a phosphoprotein that associates with the cytoskeleton. J Virol. 1997;71:9045–53.PubMedPubMedCentral Zafrullah M, Ozdener MH, Panda SK, Jameel S. The ORF3 protein of hepatitis E virus is a phosphoprotein that associates with the cytoskeleton. J Virol. 1997;71:9045–53.PubMedPubMedCentral
33.
Zurück zum Zitat Ulkoski D, Scholz C. Synthesis and application of Aurophilic poly (cysteine) and poly (cysteine)-containing copolymers. Polymers. 2017;9:500.CrossRef Ulkoski D, Scholz C. Synthesis and application of Aurophilic poly (cysteine) and poly (cysteine)-containing copolymers. Polymers. 2017;9:500.CrossRef
Metadaten
Titel
A novel avian isolate of hepatitis E virus from Pakistan
verfasst von
Tahir Iqbal
Umer Rashid
Muhammad Idrees
Amber Afroz
Saleem Kamili
Michael A. Purdy
Publikationsdatum
01.12.2019
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2019
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-019-1247-0

Weitere Artikel der Ausgabe 1/2019

Virology Journal 1/2019 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.