Background
Duck enteritis virus (DEV) is the causative pathogen of duck viral enteritis disease, causing considerable economic losses in the duck industry due to high mortality and low egg production [
1,
2]. In addition, DEV can cause variable morbidity and mortality in geese, swans and other wild waterfowl and poses a severe threat to waterfowl groups [
3‐
5]. DEV is classified into the family
Herpesviridae, subfamily
Alphaherpesvirinae, genus
Mardivirus and
anatid herpesvirus I [
6]. Its genome is a linear double-stranded DNA molecule that is composed of a unique long region (UL) and a unique short region (US) flanked by a short internal repeat sequence (IRS) and a short terminal repeat sequence (TRS) [
7‐
10].
Autophagy is an essential self-digestion process that degrades protein and waste in cells to maintain cellular metabolic balance and homeostasis [
11,
12]. Growing evidence has shown that viral infection can induce cellular autophagy. For example, some viruses, such as Newcastle disease virus (NDV) [
13], classical swine fever virus (CSFV) [
14], porcine circovirus type 2 (PCV2) [
15], porcine reproductive and respiratory syndrome virus (PRRSV) [
16], dengue virus, foot-and-mouth disease virus (FMDV) and varicella-zoster virus (VZV) [
17], can induce cell autophagy to enhance their replication. However, autophagy can suppress viral replication and eliminate viral infection [
18,
19]. For example, cellular autophagy can inhibit replication of vesicular stomatitis virus (VSV) by regulating the P13K/AKT signaling pathway [
20]. Recent research has reported that DEV induces autophagy to enhance its replication in duck embryo fibroblast (DEF) cells [
21]. Nevertheless, the regulatory relationship of autophagy remains poorly understand.
MicroRNAs (miRNAs) are important small (18–24 nt), noncoding, endogenous RNAs that can negatively regulate gene expression by binding fully or partially to the 3′-untranslated region (3′-UTR) [
22,
23]. Accumulating evidence has demonstrated that miRNAs participate in a wide range of biological processes, including cellular proliferation, differentiation, signal transduction, metabolism apoptosis and cellular autophagy [
24‐
27], and play important roles in regulating virus-host interactions [
28‐
30]. Our previous high-throughput sequencing results revealed that 13 cellular miRNAs (mir-125-2-3p, mir-124a-3p, mir-215-5p, mir-29b-3p, etc) were significantly upregulated and 25 miRNAs (mir-1a-3p, mir-133a-5p, miR-30a-5p, miR-16c-5p, etc) were significantly downregulated after CHv infection [
31]. Therefore, we speculate that these miRNAs may play crucial roles in DEV infection.
In this study, we first confirmed that miR-30a-5p directly targeted the 3′-UTR of the Beclin-1 mRNA. Further study showed that overexpression of miR-30a-5p inhibited DEV replication by downregulating Beclin-1-mediated autophagy in DEF cells. miR-30a-5p inhibitor triggered DEV replication, suggesting that miR-30a-5p palys important roles in the regulation of DEV-induced autophagy and viral proliferation. These data provide a basis for further understanding miRNAs’ regulatory roles in cellular autophagy and should contribute to the development of anti-DEV drugs.
Methods
Virus, cells, miRNA mimic and antibodies
The DEV CHv (Chinese virulent strain) (accession No. JQ647509) and mouse anti-UL41 serum were provided by the Avian Diseases Research Center, College of Veterinary Medicine, Sichuan Agricultural University. Duck embryo fibroblast (DEF) cultures were prepared from 10-day-old duck embryos for the propagation of CHv. The study was approved by the Animal Ethics Committee of Sichuan Agricultural University (approval No. XF2016–17). Cell monolayers were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Grand Island, NY USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA) at 37 °C in a 5% CO2 atmosphere. The miR-30a-5p mimic, mimic negative-control (mimic-NC), miR-30a-5p inhibitor and inhibitor-NC were synthesized by Ribobio (Guangzhou, China) and transfected into cells at a final concentration of 100 nM.
Quantitative real-time RT-PCR
Stem-loop qRT-PCR and general qRT-PCR methods were used to measure the expression levels of miRNAs and Beclin-1 mRNA, respectively. Total RNA from DEV-infected and uninfected DEF cells was extracted with TRIzol reagent (TIANGEN Biotech, Beijing) and quantified using a spectrophotometer (NanoDrop 2000). RNA (1000 ng) was reverse-transcribed to cDNA, and then 2 μl cDNA was used for real-time PCR amplification according to the kit manufacturer’s (Thermo) instructions. The primers are listed in Table
1. Relative expression levels of miRNA and Beclin-1 mRNA were calculated using the 2
-ΔΔCt method. U6 and β-actin were used as respective endogenous controls.
Table 1
Primers for analysis of gene expression by qRT-PCR
RT-miR-146b-5p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAACGCCTA |
RT-miR-125b-5p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACAAGTT |
RT-miR-30a-5p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGCTTCCA |
RT-miR-27b-3p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGCAGAACT |
RT-miR-16c-5p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTCCAGTA |
RT-miR-130b-3p | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACGCCCTT |
miR-146b-5p (F) | GCCGTGAGAACTGAATTCCATA |
miR-125b-5p (F) | GCCGTCCCTGAGACCCTAA |
miR-30a-5p (F) | GCCGTGTAAACATCCTTGACTG |
miR-27b-3p (F) | GCCGTTCACAGTGGCTAAG |
miR-16c-5p (F) | GCCGTAGCAGCACGTAAATA |
miR-130b-3p (F) | GCCGCAGTGCAATAATGAAA |
UR-primer | CAGTGCGTGTCGTGGAGT |
U6 (F) | CTCGCTTCGGCAGCACA |
U6 (R) | GCGTGTCATCCTTGCGC |
Beclin-1 (F) | AAGAGGTGCCTGGAGATCCT |
Beclin-1 (R) | CGTCCTCCAGCTCCTGAATC |
β-Actin (F) | CCGGGCATCGCTGACA |
β-Actin (R) | GGATTCATCATACTCCTGCTTTGCT |
Vector constructs and luciferase assay
MiR-30a-5p was predicted to target the DEF Beclin-1 3’UTR (nt 136,000-145,890) according to RNAhybrid and PITA software. The Beclin-1 3’UTR (nt 136,085-136,248), including the predicted miR-30a-5p binding site, was synthesized by TsingKe (Chengdu, China) and cloned into a pmirGLO vector (Promega, Madison, WI, USA) with SacI and XhoI sites, resulting in pmirGLO-WT-Beclin-1. Accordingly, the mutant 3’UTR of the Beclin-1 vector was constructed and named pmirGLO-MU-Beclin-1. For the luciferase assay, COS7 cells were seeded in 96-well plates and cotransfected with miR-30a-5p mimic, miR-NC, pmirGLO-WT-Beclin-1 and pmirGLO-MU-Beclin-1 with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). We performed a site-directed DLRA, and luciferase activity was measured at 36 h posttransfection according to the manufacturer’s protocol (Promega, Madison, WI, USA).
Western blot analysis
The synthetic miR-30a-5p mimic, miR-NC, miR-30a-5p inhibitor and inhibitor-NC were transfected into DEF cells with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. Meanwhile, the blank group (without) was set as the control group. Cells were infected with DEV at a multiplicity of infection (MOI) of 1.0 for 36 h. The cells were harvested and washed 3 times with cold PBS. The PBS was decanted and then 150 μl RIPA lysis buffer (Solarbio, China) and 1.0 mM PSMF were added. After 30 min on ice and centrifugation at 12,000 g for 10 min, 25 μl supernatant was mixed with 25 μl 5 × SDS loading buffer and boiled for 10 min. The protein samples were analyzed by 12% SDS polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluorride (PVDF) membranes (Millipore, Billerica, MA) by electroelution. Membranes were blocked with 5% milk-TBS-Tween-20 for 2 h at room temperature and incubated with rabbit anti-LC3 (Proteintech, 14,600–1-AP), rabbit anti-p62/SQSTM1 (Cell Signaling Technology, 5114), mouse anti-β-actin (Proteintech, 60,008–1-Ig), rabbit anti-Beclin-1 (Proteintech, 11,306–1-AP) and anti-CHv (UL41) antibodies overnight at 4 °C. Following incubation with HRP-conjugated goat anti-rabbit or anti-mouse IgG (Biodragon-Immunotech, China) as secondary antibody for 2 h at 37 °C, the immunoreactive bands were detected using an enhanced chemiluminescence kit (Solarbio, China). The amount of proteins was quantified by densitometry and normalized to β-actin, an internal standard.
Flow cytometry assay
DEF cells were seed in a 6-well plate at adensity of 1 × 106 cells per well. Cells were pretreated with control (without), miR-30a-5p mimic, miR-NC, miR-30a-5p inhibitor and inhibitor-NC for 4 h and then infected with DEV (MOI = 1.0) for 36 h. The cells were stained with Annexin V-fluorescein isothiocyanate (V-FITC) (BD Pharmingen, USA) and propidium iodide (PI) (BD Pharmingen, USA) according to the manufacturer’s instructions, and the percentage of apoptotic cells was assayed by flow cytometry (FCM).
Cell viability analysis
miRNA toxicity tests were performed using the MTT assay kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions. In brief, DEF cells were seeded in 96-well culture plates at a density of 1 × 105 cells per well. Cells were pretreated with control, miR-30a-5p mimic, miR-NC, miR-30a-5p inhibitor and inhibitor-NC for 4 h and then cultured in DMEM for 36 h, the cells were incubated in 100 μl fresh culture medium containing MTT (0.5 mg mL− 1) for 4 h at 37 °C. The medium was replaced by 100 μl formazan solubilization solution, and the absorbance was measured at 570 nm using a microplate reader (Bio-Rad).
DEV replication analysis
DEV viral copies were detected using qRT-PCR methods. DEF cells were seed in a 6-well plate at adensity of 1 × 10
6 cells per well. Cells were pretreated with control, miR-30a-5p mimic, miR-NC, miR-30a-5p inhibitor and inhibitor-NC for 4 h and then infected with DEV (MOI = 1.0). The cells were collected at the indicated times and stored at − 80 °C for subsequent experiments. The DEV absolute quantitative curve was created as previously described methods [
32,
33].
DEV titers were estimated by the median tissue culture infective dose (TCID
50). DEF cells were seed in 96-well plates at adensity of 1 × 10
5 cells per well. Cells were pretreated with control, miR-30a-5p mimic, miR-NC, miR-30a-5p inhibitor and inhibitor-NC for 4 h and then infected with DEV collected at the indicated times above. The plates were incubated for 5 days at 37 °C in a 5% CO
2 atmosphere. Cell pathological changes were observed under a light microscope and recorded. Viral titers were measured according to the Reed-Muench method [
34].
Statistical analysis
Each assay was performed in three independent experiments. All experimental results are expressed as the mean ± standard deviation (mean ± SD) and were analyzed by the software GraphPad Prism (version 7.0). The statistical significance was assessed using Student’s t-test. *p < 0.05 and **p < 0.01 indicate significance.
Discussion
There have been several reports about miR-30a-5p target genes and their involvement in pathophysiological processes. For example, miR-30a-5p promotes the replication of porcine circovirus type 2 through enhancing autophagy by targeting 14–3-3 [
15]. MiR-30a-5p downregulation contributes to the chemoresistance of osteosarcoma cells by activating Beclin-1-mediated autophagy [
35]. The expression of miR-30a-5p is significantly downregulated in human colorectal cancer (CRC) tissues and CRC cell lines and may be a potential candidate target for CRC therapy [
36]. Low expression of miR-30a-5p induces the proliferation and invasion of oral cancer by promoting the expression of FAP (
Homo sapiens fibroblast activation protein α), and miR-30a-5p might be a new therapeutic target for oral cancer treatment [
37]. In our previous study, miRNA expression profiles of virus and host were determined and analyzed in virulent DEV-infected DEF cells. The expression level of miRNA-30a-5p was significantly downregulated during the whole process of DEV infection [
31], and similar results were confirmed by stem-loop qRT-PCR in this study (Fig.
1b). We speculate that miR-30a-5p plays an important role in regulating host-virus interactions.
Autophagy is an essential pathway for cellular homeostasis. Many studies have confirmed that some viruses can induce cells manipulate autophagy to promote their survival and replication [
38,
39]. Examples include hepatitis C virus [
40], egg drop syndrome virus (EDSV) [
41], avian reovirus [
42] and influenza A virus [
43]. Rrecent study demonstrated that autophagy induced by DEV infection positively promotes viral replication [
21]. However, the regulating relationship of autophagy in DEV-infected DEF cells is still unclear. In this study, our data showed that the expression of miR-30a-5p was downregulated and that Beclin-1 was upregulated after CHv infection of DEF cells. The Beclin-1 gene is recognized as a critical regulatory gene during autophagosome formation and maturation [
44] and plays important roles in the replication of some viruses. For example, the replication of these three viruses (NDV, CSFV and DEV) was inhibited by siRNA knockdown of Beclin-1 gene level, which is required for autophagy [
13,
14,
21]. Previous studies have demonstrated that miR-30a-5p regulates autophagy activity by targeting Beclin-1 mRNA [
45‐
47]. Therefore, we speculated that there is the negative regulation relationship between Beclin-1 and endogenous miR-30a-5p in DEV-infected DEF cells. To confirm the regulation of miR-30a-5p on Beclin-1, bioinformatics analysis was performed using RNAhybrid software [
31]. The results showed that miR-30a-5p was predicted to target the 3′-UTR region of Beclin-1. DLRA confirmed that overexpression of miR-30a-5p markedly reduced the luciferase level from Beclin-1 (Fig.
2a, b).
Western blot analysis demonstrated that overexpression of miR-30a-5p decreased decreased Beclin-1 protein level and the ratio of of LC3-II/LC3-I, enhanced the p62 protein level, which are related to autophagy. The expression of UL41 protein decreased (Fig.
3a, b). Whereas miR-30a-5p inhibitor attenuated DEV-induced cell autophagy and reversed the effect of miR-30a-5p. Both Beclin-1 and the ratio of LC3-II/LC3-I significantly increased in miR-30a-5p inhibitor group. The p62 protein level decreased and the expression of UL41 protein increased (Fig.
3c, d). The TCID
50 and the viral copy test confirmed that DEV titers were significantly decreased in the miR-30a-5p mimic group compared with control group. Whereas transfection of miR-30a-5p inhibitor promoted DEV replication during the whole process of DEV infection (Fig.
4c and d). Our results were consistent with a previous report on autophagy induced by DEV [
21], suggesting a key role for the miR-30a-5p/autophagy loop in DEV infection. These results strongly suggested that overexpression of miR-30a-5p decreased DEV replication by suppressing Beclin-1-mediated autophagy. Therefore, it is reasonable to conclude that downregulation of miR-30a-5p contributes to DEV replication by upregulating Beclin-1-mediated autophagy.
Apoptosis regulates embryonic development, cell turnover, and the immune response against tumor or virus-infected cells [
48,
49]. Virus-induced cell apoptosis is involved in the pathogenesis of many viral infections [
50,
51]. Our laboratory has discovered that DEV can induce apoptosis in the thymus, spleen and pancreatic lymphocytes of adult ducks and can cause apoptosis in DEFs in vitro [
52,
53], and further confirmed that the mRNA levels and enzymatic activities of caspase-3, caspase-7 and caspase-9 were significantly increased during DEV-induced cell apoptosis [
53]. Recent study has also reported miR-30a-5p can promote doxorubicin-induced osteosarcoma cell apoptosis by increasing the expression of cleaved caspase-3, and further certified that miR-30a-5p promotes chemotherapy-induced osteosarcoma cell apoptosis via repressing Beclin-1-mediated osteosarcoma autophagy [
35]. In our study, flow cytometry demonstrated that overexpression of miR-30a-5p enhanced DEV-induced cell apoptosis (Fig.
4a). Nevertheless, miR-30a-5p inhibitor attenuated DEV-induced cell apoptosis and reversed the effect of miR-30a-5p (Fig.
4a). However, whehter or not the miR-30a-5p increased DEV-induced cell apoptosis by suppressing Beclin-1-mediated autophagy requires further confirmation.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.