Amelioration of cardio-renal injury with aging in dahl salt-sensitive rats by H₂-enriched electrolyzed water

Four-week-old male Dahl SS rats (n = 90) were housed in a temperature- and humidity-controlled room with 12-h light/dark cycles and provided a normal diet (0.5% NaCl). Three types of drinking water were prepared: filtered water (FW); water with a high content of dissolved H₂ created by water electrolysis (EW); and dehydrogenated EW (DW). At the age of 5 weeks, the rats were divided into three groups of 30 subjects each for ad libitum drinking of the respective water types. Fresh water samples were produced twice a day, and delivered by a metallic straw from a closed bottle. EW was generated using a TRIM ION TI-9000 system (Nihon Trim, Osaka, Japan) [3, 10]. The properties of the EW are shown in Table 1.

During the course of the study, daily measurements were made of the volume of drinking water consumed. BP was measured every other week in the morning using the tail-cuff method. Urinary and blood samples were collected at 16, 24 and 48 weeks, and were measured using an auto-analyzer [20].

Whole kidneys and hearts were collected for histological examination and blood samples were collected from the aorta. Three experimental endpoints were employed: 16 weeks, 24 weeks, and 48 weeks; 10 rats per group were sacrificed at each time point. The rats were anesthetized using 1% pentobarbital (0.20 mg/kg) administered intraperitoneally. All procedures were performed in accordance with the institutional guidelines for the care and use of laboratory animals, and all protocols were approved by the Animal Committee at Tohoku University School of Medicine.

Kidney and heart samples were subjected to histological examinations after staining, using the Elastica-Masson method for determining renal injury and cardiac fibrosis, with the following parameters assessed: glomerular adhesions, glomerular sclerosis index (GSI), renal fibrosis, cardiac fibrosis, and cardiomyocyte diameter using Image J software (National Institute of Health (NIH), Bethesda, MD, USA) as reported elsewhere [3]. Immunohistochemical analysis was performed using monoclonal antibodies against ED-1 (Serotec, Oxford, UK), malondialdehyde (MDA) (JaICA, Shizuoka, Japan), nuclear factor erythroid 2-related factor (Nrf2) (Abcam, Cambridge, UK), and nitrotyrosine (NT) (Temecula, CA, USA). Slides were incubated overnight at 4°C with the primary antibodies, followed by analyses of ED-1 and NT [20]. For assessing MDA staining, five areas of the kidney or heart were randomly selected and the percentage of MDA-positive areas in each was measured by Image J software. For Nrf2 quantitation, the number of positive cells in heart tissue was counted in five randomly selected images.

Total RNA was isolated from whole kidney using the guanidine–isothiocyanate based-reagent Isogen (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions.

We performed real-time polymerase chain reaction analysis using probe sets from the Bio-Rad CFX96 system (Bio-Rad Laboratories Inc., Hercules, CA, USA). Gene-specific primers for Nrf2 (NM_031789.1; forward: GAGACGGCCATGACTGAT, reverse: GTGAGGGGATCGATGAGTAA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, NM_017008.3; forward: GGCACAGTCAAGGCTGAGAATG, reverse: ATGGTGGTGAAGACGCCAGTA) were used for amplification of specific cDNAs with the iScript one step RT-PCR kit from Bio-Rad. The relative expression levels of each messenger RNA (mRNA) were normalized to GAPDH mRNA levels.

For western blot analysis (10 μg protein per lane), frozen renal and cardiac tissues were homogenized and denatured by boiling in LDS sample buffer and sample reducing agents. Gels were then transferred to a PVDF membrane (Immobilon-P, Millipore Corporation, Billerica, MA, USA) using a semi-dry Transblot apparatus (Bio-Rad Laboratories Inc.). Membranes were blocked, probed with the specified antibodies, and then incubated with horseradish peroxidase-conjugated secondary antibodies prior to chemiluminescence detection (Pierce, Rockford, IL, USA). Band intensities were quantified by densitometry using Image J software. The antibodies used were: anti-Nrf2 (Abcam), anti-SOD2 rabbit polyclonal (ab13533) (Abcam), anti-gp91^phox(C-15) (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), and anti-p40^phox (N-20) (Santa Cruz Biotechnology Inc.).

NADPH oxidase-dependent O₂⁻ production by intact renal and cardiac tissue was measured using lucigenin-enhanced chemiluminescence. Briefly, 10 μl of the homogenate was transferred into glass scintillation vials containing 5 μmol/L lucigenin in Krebs-HEPES buffer (180 μl). The chemiluminescence value was recorded at 60 s intervals for 10 min and endpoint values were measured using a GENios pro luminescence reader (Tecan Co. Ltd., Kawasaki, Japan).

We performed transthoracic echocardiography with an echocardiographic system equipped with a 12-Mhz phased-array transducer (Aplio, Toshiba Medical Systems Corp., Otawara, Japan). Rats were anesthetized with 1% pentobarbital (0.20 mg/kg, IP) and left ventricular end-diastolic diameter (LVEDD), fractional shortening (FS), and left ventricle posterior wall thickness in diastole (LVPWTd) were measured using M-mode tracings.

Data are expressed as mean ± standard error of mean, and were analyzed using the independent t-test or two-way repeated-measures ANOVA. Differences between the groups were considered significant at p < 0.05. All analyses were performed using Sigmastat 3.5 software (Systat Software, Chicago, IL, USA).

There were significant elevations in BP and BW in the FW group during the course of the study, which spanned a treatment duration of 48 weeks (Figure 1A, B).

During the course of the study, there were significant time-dependent increases in urinary albumin excretion in the FW group (p < 0.05 vs. 16 weeks) (Table 2). Results of semi-quantitative analysis of histological changes in the kidney are shown in Figure 1C. There were significant increases at 48 weeks compared to 16 and 24 weeks in the following parameters: glomerular sclerosis index (GSI; p < 0.05 vs. 16 and 24 weeks) (Figure 1C-a), glomerular adhesions and crescents (GAC; p < 0.05 vs. 16 and 24 weeks) (Figure 1C-b) and renal fibrosis (IF; p < 0.05 vs. 16 and 24 weeks) (Figure 1C-c).

Echocardiographic observations in the FW group (at 48 weeks) are summarized in Table 3. There were significant increases in LVPWTd (p < 0.05 vs. 16 weeks) with aging. Analyses of the histological changes in the heart are shown in Figure 1D. There were significant increases at 48 weeks compared to 16 and 24 weeks in the following parameters: cardiomyocyte diameter (p < 0.05 vs. 16 and 24 weeks) (Figure 1D-a), cardiac fibrosis (p < 0.05 vs. 16 and 24 weeks) (Figure 1D-b), and number of ED-1 positive cells (p < 0.05 vs. 16 and 24 weeks) (Figure 1D-c).

No differences were found between the three groups in terms of body weight (Figure 1B) and water and food consumption (data not shown) (FW vs. EW and DW). There were significant elevations in BP in the EW and DW groups at the four time points where BP was measured (8, 16, 24, and 48 weeks) in relation to baseline BP (at 4 weeks) (p < 0.05 vs. 4 weeks) (Figure 1A). Significant differences in BP were present at 16, 24, and 48 weeks between the FW and EW groups (p < 0.05 vs. FW) (Figure 1A). No differences were found in organ to body weight ratio analysis at 16, 24, and 48 weeks among the three groups (data not shown).

Kidney function analysis during the course of the study indicated that there were significant increases in urinary albumin excretions in the EW and DW groups (p < 0.05 vs. 16 weeks) (Table 2), although no differences were found in albumin excretion and serum creatinine levels compared to FW. Comparisons between FW and EW using semi-quantitative analysis of histological changes in the kidney are shown in Figure 1 C-D. There were significant increases at 48 weeks compared to 16 and 24 weeks in the following parameters in the EW and DW groups: GSI (Figure 1C-a), glomerular adhesions and crescents (Figure 1C-b), and renal fibrosis (Figure 1C-c). However, the changes at 48 weeks were significantly smaller in the EW group compared to the FW group (p < 0.05, respectively). In addition, there were significant differences in ED-1 positive cells (Figure 1D-c), and NT and MDA staining at 48 weeks, which were significantly less in the EW group compared to the FW group (p < 0.05, respectively). Representative histological findings in kidneys for each of the three groups at 48 weeks are shown in Figure 2A.

Echocardiographic parameter for the EW and DW groups are shown in Table 3. There were significant increases in LVPWTd with aging in both groups (p < 0.05 vs. 16 and 24 weeks). However, LVPWTd of EW was significantly less than that of FW at 48 weeks (p < 0.05, EW vs. FW), indicating ameliorated cardiac remodeling in the EW group.

Analyses of histological changes in the heart are shown in Figure 1D. In all three groups, there were significant increases at 48 weeks compared to 16 and 24 weeks in the following parameters: cardiomyocyte diameter (p < 0.05 vs. 16 and 24 weeks) (Figure 1D-a), cardiac fibrosis (p < 0.05 vs. 16 and 24 weeks) (Figure 1D-b), and number of ED-1 positive cells (p < 0.05 vs. 16 and 24 weeks) (Figure 1D-c). However, the histological changes were significantly smaller in the EW group compared to the FW group (p < 0.05, EW vs. FW) at 48 weeks. In addition, NT and MDA staining at 48 weeks were significantly less in the EW group compared to the FW group (p < 0.05, respectively) (Table 4).

Representative histological findings in the hearts of the animals in the three groups at 48 weeks are shown in Figure 2b.

In the kidney, no differences were found in the expression of Nrf2 and NADPH oxidase activity at 48 weeks (Additional file 1: Table S1). In the heart, although no differences were found in Nrf2 mRNA levels among the groups, immunostaining and western blot analysis showed significantly higher levels in the EW compared to the FW group (p < 0.05) (Table 4). No statistical differences were found in NADPH oxidase activity among groups, although activity in the EW group tended to be lower than in the FW group, and significantly lower expression of the gp91phox subunit in the EW group compared to the FW group (Table 4).