Skip to main content
Erschienen in: Malaria Journal 1/2017

Open Access 01.12.2017 | Case report

An intricate case of multidrug resistant Plasmodium falciparum isolate imported from Cambodia

verfasst von: Raffaele Dell’Acqua, Claudia Fabrizio, Francesco Di Gennaro, Sergio Lo Caputo, Annalisa Saracino, Michela Menegon, Mariangela L’Episcopia, Carlo Severini, Laura Monno, Francesco Castelli, Gioacchino Angarano

Erschienen in: Malaria Journal | Ausgabe 1/2017

download
DOWNLOAD
print
DRUCKEN
insite
SUCHEN

Abstract

Background

Imported cases of multidrug resistant Plasmodium falciparum and treatment failure with artemisinin-based regimens, although rare, have been described also in Western countries and their management is often challenging. This is also due to an inadequate knowledge and implementation of health prevention measures.

Case report

A complex case of imported malaria caused by Plasmodium vivax/P. falciparum isolates in a patient who was not taking chemoprophylaxis while he was travelling in Cambodia is reported in this article. After failures of artemisinin-based and both oral and intravenous quinine-based regimens, a multidrug resistant P. falciparum was detected. The patient was successfully treated with atovaquone–proguanil.

Conclusions

This experience highlights the importance of a careful management that should be based not only on the most up-to-date guidelines, but also on the awareness of a rapidly evolving scenario.
Abkürzungen
MDR
multidrug resistant
Hb
haemoglobin
PLTs
platelets
CRP
C-reactive protein
SNPs
single nucleotide polymorphisms
ISS
Istituto Superiore di Sanità

Background

Imported cases of multidrug resistant (MDR) Plasmodium falciparum and treatment failure with artemisinin-based regimens, although rare, have been described also in Western countries and their management is often challenging [1, 2]. Even if uncommon, the possibility of imported infections by drug-resistant Plasmodium spp. should be considered, especially in travellers returning from highly endemic regions [3], where the most recent first-line artemisinin-based regimens are losing their effectiveness, also due to selective drug pressure [4, 5]. Moreover, the increasing accessibility to remote geographic areas of the world by do-it-yourself travellers not always keeps the pace with an adequate knowledge and implementation of health prevention measures. The following case illustrates these issues.

Case presentation

A 27-years old male Italian patient, carrying thalassemia trait, returned on November 22nd, 2015 from a 4-week long pleasure trip to Cambodia, without taking any malaria chemoprophylaxis. This trip also included a 5-days trekking throughout the Pursat region. The day before his return, he had a rapid onset of fever up to 39 °C preceded by chills, cough and diarrhoea. Due to the persistence of fever despite therapy with ciprofloxacin and paracetamol, he was admitted to the Clinic of Infectious Diseases, Policlinico Hospital, Bari, on November 25th. Upon admission he had dehydration, mild leucocytosis (white blood cells 11.36 × 109/L), haemoglobin (Hb) 13.3 g/dL, platelets (PLTs) 62 × 109/L, C-reactive protein (CRP) 64.8 mg/L. On suspicion of malaria, peripheral blood smears and molecular biology testing (multiplex Real-Time PCR, Fast-Track Diagnostic) were performed, proving to be positive for P. falciparum and Plasmodium vivax, with a parasitaemia below 2%. A 3-day dihydroartemisinin–piperaquine regimen was initiated, with rapid defervescence and good clinical progress. After the end of treatment, blood smears resulted negative and the patient was discharged with prescription of 30 mg/day of primaquine for 14 days for radical cure.
On December 1th he was readmitted due to the reappearance of fever in the previous 2 days. Primaquine treatment had not been initiated due to delayed supply of the drug which is not readily available in Italy. Laboratory data showed anaemia (Hb 7.3 g/dL, requiring blood transfusion even in the absence of symptoms), thrombocytopaenia (PLTs 84 × 109/L) and CRP elevation (40 mg/L). Peripheral blood smears were again positive for P. falciparum trophozoites; P. vivax gametocytes were also detected, as an expected biologic evolution without pathologic significance. This finding is consistent with missed start of primaquine. Therefore, a second-line therapy with oral quinine and doxycycline was started. A prompt clinical improvement was observed after 24 h; a 7-day course of therapy was completed leading to negative blood smears. Primaquine administration was withheld until the resolution of P. falciparum recrudescence and it was started on December 23rd shortly before hospital discharge. Indeed the patient was dismissed on December 24th with indication to complete a full 14-days course with weekly monitoring of complete blood count.
However, on January 18th the patient presented with fever and diarrhoea. After a few days of symptomatic home treatment with temporary benefit, he was readmitted showing thrombocytopaenia (PLTs 110 × 109/L), anaemia (Hb 9.2 g/dL) and CRP elevation (40.3 mg/L). Plasmodium falciparum trophozoites were detected on blood smears and therapy was initiated with intravenous quinine (loading dose of 20 mg/kg, followed by maintenance dose of 10 mg/kg q8h for 7 days) at first and, subsequently, with atovaquone/proguanil, thus obtaining the definitive clearance of the parasite and healing.
The resistance of the Plasmodium falciparum isolate infecting this patient to anti-malarial drugs was assessed by the evaluation of single nucleotide polymorphisms (SNPs) of six molecular gene markers (PfK13, Pfcrt, Pfmdr1, Pfdhfr, Pfdhps and PfCytB) linked to resistance to artemisinin derivatives, quinolines, antifolates–cycloguanil and atovaquone.
Total DNA was extracted (PureLink Genomic DNA Kits-Invitrogen) from 200 µL of three patient’s blood specimens collected on November 26th, 2015 (first hospital admission), December 15th, 2015 (second admission) and January 29th, 2016 (third admission). The polymorphism of the P. falciparum K13-propeller gene, from codon 427 to codon 690, was assessed using the primers: ArtinnerF (GCCTTGTTGAAAGAAGCAGAA) and ArtouterR (CGCCATTTTCTCCTCCTGTA) and with PCR conditions described by Taylor et al. [6]. Analysis of Pfcrt and Pfmdr1 genes was performed as previously reported [7, 8]. Different methods were used for the analysis of fragment of Pfdhfr gene spanning codons 51–108, Pfdhps domain (719 bp) and point mutation in PfCytB gene, according to Palmieri et al. [9], Menegon et al. [7] and Korsinczky et al. [10], respectively. All PCR products were sent to Eurofins Genomics Company (Germany) for sequencing, and sequences were compiled and analysed by Accelrys DS Gene software.
Analysis of polymorphisms of P. falciparum isolates showed a pattern of multidrug resistance due to the presence of point mutations associated with quinoline (including amodiaquine), drug resistance in Pfcrt and Pfmdr1, and mutations correlated to sulfadoxine/pyrimethamine resistance in Pfdhps and Pfdhfr genes (Table 1). In particular, in the Pfk13 gene was observed the presence of the mutation C580Y, which is an important determinant of artemisinin resistance in P. falciparum population circulating in Southeast Asia [11, 12]. The absence of mutations at codons 258 and 268 of CytB gene indicated a sensitivity of the P. falciparum isolate to atovaquone and is consistent with the good response of the patient to atovaquone/proguanil administration.
Table 1
Analysis of polymorphisms of the P. falciparum isolates
https://static-content.springer.com/image/art%3A10.1186%2Fs12936-017-1795-y/MediaObjects/12936_2017_1795_Tab1_HTML.gif
Pfcrt and Pfmdr1 genes point mutations are associated with quinoline (including amodiaquine) drug resistance; Pfdhfr and Pfdhps genes mutations are responsible for P. falciparum resistance to antifolate-cycloguanil; Pfk13 gene mutation C580Y is considered an important determinant of artemisinin resistance
Mutant codons from the three different samples are in blue

Discussion

This report shows the serious consequences, both in terms of clinical impact and health-related expenses, of a rare and extended resistance pattern of P. falciparum strain. Indeed, the management of this patient was complex; firstly, because he experienced three subsequent admissions, resulting in a prolonged hospitalization. Furthermore, once malaria recrudescence was confirmed, pharmacological treatment was cumbersome in terms of drug supply, costs, safety profile and consequent need of strict monitoring. An additional issue was represented by molecular analysis, which required the expertise of the Italian National Institute of Health (ISS) since these assays are not routinely available. Lastly, patient’s anxiety regarding the course of the disease should also be taken into account.
A double recrudescence of P. falciparum in the same patient is a rare event to observe. Moreover, the chance of a recrudescence after a second-line treatment of oral quinine plus doxycycline is very low [13]. Reasons for failure with this regimen may include a decrease in the sensitivity or an inadequate exposure to the drug caused by unusual pharmacokinetics in an individual, scarce adherence to the prescribed regimen or poor quality of anti-malarial drugs [14]. In this case, therefore, the concurrence of both pathogen- and host-related factors could have been responsible for the second recrudescence.
Based on the multidrug resistance pattern of P. falciparum, a complicated clinical course could have been expected. However, with the exception of a single blood transfusion, the patient did not require any extraordinary therapeutic measure. Thalassaemia trait probably played a relevant role in attenuating the severity of the disease, whereas the clinical impact of dual infection was unclear, based on the heterogeneous results of several studies regarding the mutual interactions between the two Plasmodium species and the role of immunity [15].
As Cambodia is known to be the cradle of anti-malarial drug resistance, patients returning from this area should be considered at risk for failure of artemisinin-based regimens [16]. Therefore, according to our experience, even the most up-to-date guidelines should be handled with care in this rapidly evolving scenario and to this regard, the atovaquone/proguanil combination may be considered as a valuable therapeutic option in some special cases [17].
In a context of increasing international travel and trades in which exotic regions are easier to reach, the relevance of a proper prophylaxis should be highlighted in order to obtain individual protection. Moreover, in this framework, an increased awareness about the possibility to manage such difficult cases also in non-endemic settings should become a matter of utmost importance.

Authors’ contributions

RDA, CF, CS and SLC drafted the manuscript. FDG and AS collected clinical and laboratory data. MM, MLE and CS performed the molecular tests. LM, FC and GA revised the paper critically. All authors read and approved the final manuscript.

Acknowledgements

None.

Competing interests

The authors declare that they have no competing interests.
Written informed consent for the publication of the present case was obtained from the patient.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Gobbi F, Buonfrate D, Menegon M, Lunardi G, Angheben A, Severini C, et al. Failure of dihydroartemisinin–piperaquine treatment of uncomplicated Plasmodium falciparum malaria in a traveller coming from Ethiopia. Malar J. 2016;15:525.CrossRefPubMedPubMedCentral Gobbi F, Buonfrate D, Menegon M, Lunardi G, Angheben A, Severini C, et al. Failure of dihydroartemisinin–piperaquine treatment of uncomplicated Plasmodium falciparum malaria in a traveller coming from Ethiopia. Malar J. 2016;15:525.CrossRefPubMedPubMedCentral
2.
Zurück zum Zitat Sondén K, Wyss K, Jovel I, da Silva AV, Pohanka A, Asghar M, et al. High rate of treatment failures in non-immune travelers treated with artemether–lumefantrine for uncomplicated Plasmodium falciparum malaria in Sweden: retrospective comparative analysis of effectiveness and case series. Clin Infect Dis. 2017;64:199–206.CrossRefPubMed Sondén K, Wyss K, Jovel I, da Silva AV, Pohanka A, Asghar M, et al. High rate of treatment failures in non-immune travelers treated with artemether–lumefantrine for uncomplicated Plasmodium falciparum malaria in Sweden: retrospective comparative analysis of effectiveness and case series. Clin Infect Dis. 2017;64:199–206.CrossRefPubMed
3.
Zurück zum Zitat Ashley EA, Dhorda M, Fairhurst RM, Amaratunga C, Lim P, Suon S, et al. Spread of artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2014;371:411–23.CrossRefPubMedPubMedCentral Ashley EA, Dhorda M, Fairhurst RM, Amaratunga C, Lim P, Suon S, et al. Spread of artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2014;371:411–23.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat WHO. Guidelines for the treatment of malaria. 3rd ed. Geneva: WHO; 2015. ISBN 978-92-4-1549127. WHO. Guidelines for the treatment of malaria. 3rd ed. Geneva: WHO; 2015. ISBN 978-92-4-1549127.
5.
Zurück zum Zitat Saunders DL, Vanachayangkul P, Lon C. Dihydroartemisinin–piperaquine failure in Cambodia. N Engl J Med. 2014;371:484–5.CrossRefPubMed Saunders DL, Vanachayangkul P, Lon C. Dihydroartemisinin–piperaquine failure in Cambodia. N Engl J Med. 2014;371:484–5.CrossRefPubMed
6.
Zurück zum Zitat Taylor SM, Parobek CM, DeConti DK, Kayentao K, Coulibaly SO, Greenwood BM, et al. Absence of putative artemisinin resistance mutations among Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic study. J Infect Dis. 2015;211:680–8.CrossRefPubMed Taylor SM, Parobek CM, DeConti DK, Kayentao K, Coulibaly SO, Greenwood BM, et al. Absence of putative artemisinin resistance mutations among Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic study. J Infect Dis. 2015;211:680–8.CrossRefPubMed
7.
Zurück zum Zitat Menegon M, Pearce RJ, Inojosa WO, Pisani V, Abel PM, Matondo A, et al. Monitoring for multidrug-resistant Plasmodium falciparum isolates and analysis of pyrimethamine resistance evolution in Uige province, Angola. Trop Med Int Health. 2009;14:1251–7.CrossRefPubMed Menegon M, Pearce RJ, Inojosa WO, Pisani V, Abel PM, Matondo A, et al. Monitoring for multidrug-resistant Plasmodium falciparum isolates and analysis of pyrimethamine resistance evolution in Uige province, Angola. Trop Med Int Health. 2009;14:1251–7.CrossRefPubMed
8.
Zurück zum Zitat Duraisingh MT, Jones P, Sambou I, von Seidlein L, Pinder M, Warhurst DC. The tyrosine-86 allele of the pfmdr1 gene of Plasmodium falciparum is associated with increased sensitivity to the anti-malarials mefloquine and artemisinin. Mol Biochem Parasitol. 2000;108:13–23.CrossRefPubMed Duraisingh MT, Jones P, Sambou I, von Seidlein L, Pinder M, Warhurst DC. The tyrosine-86 allele of the pfmdr1 gene of Plasmodium falciparum is associated with increased sensitivity to the anti-malarials mefloquine and artemisinin. Mol Biochem Parasitol. 2000;108:13–23.CrossRefPubMed
9.
Zurück zum Zitat Palmieri F, Petrosillo N, Paglia MG, Conte A, Goletti D, Pucillo LP, et al. Genetic confirmation of quinine-resistant Plasmodium falciparum malaria followed by postmalaria neurological syndrome in a traveler from Mozambique. J Clin Microbiol. 2004;42:5424–6.CrossRefPubMedPubMedCentral Palmieri F, Petrosillo N, Paglia MG, Conte A, Goletti D, Pucillo LP, et al. Genetic confirmation of quinine-resistant Plasmodium falciparum malaria followed by postmalaria neurological syndrome in a traveler from Mozambique. J Clin Microbiol. 2004;42:5424–6.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Korsinczky M, Chen N, Kotecka B, Saul A, Rieckmann K, Cheng Q. Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site. Antimicrob Agents Chemother. 2000;44:2100–8.CrossRefPubMedPubMedCentral Korsinczky M, Chen N, Kotecka B, Saul A, Rieckmann K, Cheng Q. Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site. Antimicrob Agents Chemother. 2000;44:2100–8.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Miotto O, Almagro-Garcia J, Manske M, Macinnis B, Campino S, Rockett KA, et al. Multiple populations of artemisinin-resistant Plasmodium falciparum in Cambodia. Nat Genet. 2013;45:648–55.CrossRefPubMed Miotto O, Almagro-Garcia J, Manske M, Macinnis B, Campino S, Rockett KA, et al. Multiple populations of artemisinin-resistant Plasmodium falciparum in Cambodia. Nat Genet. 2013;45:648–55.CrossRefPubMed
12.
Zurück zum Zitat Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–5.CrossRefPubMed Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–5.CrossRefPubMed
13.
Zurück zum Zitat Tan K, Magill A, Parise M, Arguin P. Doxycycline for malaria chemoprophylaxis and treatment: report from the CDC expert meeting on malaria chemoprophylaxis. Am J Trop Med Hyg. 2011;84:517–31.CrossRefPubMedPubMedCentral Tan K, Magill A, Parise M, Arguin P. Doxycycline for malaria chemoprophylaxis and treatment: report from the CDC expert meeting on malaria chemoprophylaxis. Am J Trop Med Hyg. 2011;84:517–31.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Gomes M, Vieira J, Couto Á, Couto V, Vieira M, Pereira F, Machado R. Recurrence of Plasmodium falciparum after treatment with quinine and doxycycline in the Amazon basin. Trop Med Int Health. 2016;22:133–8.CrossRefPubMed Gomes M, Vieira J, Couto Á, Couto V, Vieira M, Pereira F, Machado R. Recurrence of Plasmodium falciparum after treatment with quinine and doxycycline in the Amazon basin. Trop Med Int Health. 2016;22:133–8.CrossRefPubMed
15.
Zurück zum Zitat Haghdoost AA, Alexander N. Systematic review and meta-analysis of the interaction between Plasmodium falciparum and Plasmodium vivax in humans. J Vector Borne Dis. 2007;44:33–43.PubMed Haghdoost AA, Alexander N. Systematic review and meta-analysis of the interaction between Plasmodium falciparum and Plasmodium vivax in humans. J Vector Borne Dis. 2007;44:33–43.PubMed
16.
Zurück zum Zitat WHO. World Malaria Report 2015. Geneva: WHO; 2015. ISBN 978-92-4-156515-8. WHO. World Malaria Report 2015. Geneva: WHO; 2015. ISBN 978-92-4-156515-8.
17.
Zurück zum Zitat Saunders DL, Chaorattanakawee S, Gosi P, Lanteri C, Somethy S, Kuntawunginn W, et al. Atovaquone–proguanil remains a potential stopgap therapy for multidrug-resistant Plasmodium falciparum in areas along the Thai-Cambodian border. Antimicrob Agents Chemother. 2016;60:1896–8.CrossRefPubMedCentral Saunders DL, Chaorattanakawee S, Gosi P, Lanteri C, Somethy S, Kuntawunginn W, et al. Atovaquone–proguanil remains a potential stopgap therapy for multidrug-resistant Plasmodium falciparum in areas along the Thai-Cambodian border. Antimicrob Agents Chemother. 2016;60:1896–8.CrossRefPubMedCentral
Metadaten
Titel
An intricate case of multidrug resistant Plasmodium falciparum isolate imported from Cambodia
verfasst von
Raffaele Dell’Acqua
Claudia Fabrizio
Francesco Di Gennaro
Sergio Lo Caputo
Annalisa Saracino
Michela Menegon
Mariangela L’Episcopia
Carlo Severini
Laura Monno
Francesco Castelli
Gioacchino Angarano
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2017
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/s12936-017-1795-y

Weitere Artikel der Ausgabe 1/2017

Malaria Journal 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.