Skip to main content
Erschienen in: BMC Infectious Diseases 1/2017

Open Access 01.12.2017 | Research article

Anti-hepatitis B virus (HBV) response of imiquimod based toll like receptor 7 ligand in hbv-positive human hepatocelluar carcinoma cell line

verfasst von: Dipanwita Das, Isha Sengupta, Neelakshi Sarkar, Ananya Pal, Debraj Saha, Manikankana Bandopadhyay, Chandrima Das, Jimmy Narayan, Shivaram Prasad Singh, Sekhar Chakrabarti, Runu Chakravarty

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2017

Abstract

Background

Toll like receptors (TLRs) play an important role in innate immunity and various studies suggest that TLRs play a crucial role in pathogenesis of hepatitis B virus (HBV) infection. The present study aims in looking into the status of crucial host and viral gene expression on inciting TLR7.

Methods

The transcription of TLR7 pathway signaling molecules and HBV DNA viral load were quantified by Real Time-PCR after stimulation of TLR7 with its imiquimod based ligand, R837. Cell cycle analysis was performed using flow-cytometry. Expression of TLR7 and chief cell cycle regulator governing G1/S transition, p53 was also seen in liver biopsysss samples of CHB patients. HBV induced alteration in histone modifications in HepG2 cells and its restoration on TLR7 activation was determined using western blot.

Results

The TLR7 expression remains downregulated in HepG2.2.15 cells and in liver biopsy samples from CHB patients. Interestingly HBV DNA viral load showed an inverse relationship with the TLR7 expression in the biopsy samples. We also evaluated the anti-viral activity of R837, an agonist of TLR7. It was observed that there was a suppression of HBV replication and viral protein production upon TLR7 stimulation. R837 triggers the anti-viral action probably through the Jun N-terminal Kinase (JNK) pathway. We also observed a downregulation of histone H3K9Me3 repression mark upon R837 treatment in HBV replicating HepG2.2.15 cells, mimicking that of un-infected HepG2 cells. Additionally, the G1/S cell cycle arrest introduced by HBV in HepG2.2.15 cells was released upon ligand treatment.

Conclusion

The study thus holds a close insight into the changes in hepatocyte micro-environment on TLR7 stimulation in HBV infection.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12879-017-2189-z) contains supplementary material, which is available to authorized users.
Abkürzungen
CHB
Chronic HBV infection
ERK
Extracellular-signal-regulated kinases
HBV
Hepatitis B virus
HCC
Hepatocellular carcinoma
HCV
Hepatitis C virus
HIV
Human immunodeficiency virus
IFN
Interferon
IL-6
Interleukin-6
IRAKs
Interleukin (IL)-1-R–associated kinases
JNK
Jun n-terminal kinase
MAPK
Mitogen activating protein kinase
MyD88
Myeloid differentiation primary-response protein 88
NF- КB
Nuclear factor kappa-light-chain-enhancer of activated B cells
NLR
Nucleotide oligomerization domain (NOD)-like receptor
PI3K/AKT
Phosphatidylinositol-3 kinase/protein kinase B
PRR
Pattern recognition receptor
RLR
RIG-I-like receptor
SCID
Severe combined immunodeficiency disease
TLR
Toll like receptor
TNF
Tumor necrosis Factor
TRAF6
Tumor necrosis factor receptor (TNFR)-associated factor 6
WHV
Woodchuck hepatitis virus

Background

Hepatitis B virus (HBV) infection is the leading cause of liver cirrhosis and hepatocellular carcinoma (HCC); however the outcome of the infection varies widely among infected individuals [1]. Although various therapies including alpha interferon and nucleoside/-tide analogues are in use for treating HBV infection, a constant effort is being made to develop more potential and cost effective drugs.
Innate immunity, the first line of defense, plays a vital role in limiting the spread of pathogen after the initial infection and triggers an effective adaptive immune response. It has been seen that viral particles and its components are sensed by pattern recognition receptors (PRR), which include the RIG-I-like receptors (RLRs), nucleotide oligomerization domain (NOD)-like receptors (NLRs) and the toll-like receptors (TLRs). They subsequently activate an effective signaling pathway, which is responsible for the production of antiviral cytokines. Though a clear role of adaptive immune response has been seen in HBV clearance; the role of innate immunity in HBV infection still remains enigmatic [2]. Earlier, it was assumed that HBV was unable to induce an innate immune response by acting as a ‘stealth virus’, which skillfully evades the first line of defense and strategically block important candidates in its signaling pathway [3]. Therefore, HBV remains undetected by the host immune surveillance and infects the hepatocytes until the adaptive immunity is triggered weeks later. However, on the contrary, HepaRG cells as well as SCID mice harboring humanized liver, shows an up-regulation of IFN (Interferon) response upon HBV infection [4, 5]. Different TLR agonists have been clinically assessed for treatment of chronic viral infections like HBV, Hepatitis C virus (HCV) and Human Immunodeficiency Virus (HIV) [6]. Previous studies have shown that TLR3, TLR4, TLR5, TLR7, and TLR9 ligands/agonists when administered intravenously in HBV transgenic mice, inhibits HBV replication [7]. In addition, a recent study showed that activation of TLR2 is instrumental in suppression of HBV replication in hepatoma cell lines and woodchuck models [8].
Single stranded viral RNAs and synthetic compounds like imidazoquinoline, loxoribine serve as agonists for TLR7, which mainly operates through the Myeloid Differentiation primary-response protein88 (MyD88) dependent pathway. The subsequent messengers in the signaling pathway activate different transcription factors including Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-КB), Jun N-terminal Kinase (JNK) etc. that turns on the expression of downstream targets and inflammatory cytokine secreting genes. In the present study we have tried to look into the antiviral role of TLR7 in hepatocyte microenvironment during HBV infection. TLR7 exhibits viral clearance by modulating several key host factors. Cell cycle analysis was carried out to check the fate of HBV induced G1/S arrest on TLR7 activation. We also investigated the epigenetic alteration as a sequel to HBV infection and monitored a partial reversal upon TLR7 agonist treatment implicating an alteration of gene expression.

Method

Study subjects

A total of 19 liver biopsy samples were collected from patients at Kalinga Gastroenterology Foundation (Cuttack, Orissa, India) of which, 12 individuals had chronic HBV infection. 7 biopsy samples were taken from patients with steatosis but had no history of HBV, HCV or HIV infections and they were taken as disease controls. Signed informed consent was obtained from patients and the study was approved by the institutional ethical committee. The diagnosis of patients with CHB was conformed according to the AASLD guidelines 2009.

Cell culture

The maintenance and plating of hepatoblastoma cell lines HepG2 and HepG2.2.15 was done as described previously [9].

Lamivudine treatment

Lamivir (Lamivudine tablets-150 mg) were provided by Cipla. The tablets were suspended in sterile water and then filtered using 0.2-μm filters. Cells were treated with 10, 20, 50 and 100 μM (final concentration) of Lamivudine every day for 72 h as shown previously [10], after which cells were harvested for further analysis.

Analysis of HBV viral properties

The synthetic ligand used for TLR7 was Imiquimod-R837 provided by Invivogen. Cell culture supernatant was collected from HepG2.2.15 cells after treatment with 4, 6 and 8 μg/ml of R837 for 72 h. Total DNA was extracted using Qiagen Blood mini-kit (Hilden, Germany). HBV viral load in culture supernatant was quantified by real-time TaqMan PCR assay using NIBSC standards as described earlier [11]. HBeAg and HBsAg levels were analyzed by using commercial ELISA kits (Diasorin, S.P.A., Saluggia, Italy).

Chemical inhibitors

For pathway screening, HepG2.2.15 cells were stimulated with 8 μg/ml of R837 (Invivogen, San Diego, CA, USA) singly or in conjunction with various inhibitors. 10 μM NF-КB pathway inhibitor PDTC, 25 μg/mL of SP600125 (MAPK/JNK pathway inhibitor), 2μMof LY294002 (inhibitor of PI3K) and 10 μM SB203580 (MAPK/p38 pathway inhibitor) were used. They were purchased from Sigma–Aldrich (St. Louis, MO, USA). These inhibitors have specific targets and block the exact pathways that they are chosen for [12].

RT-PCR analysis

For the RNA expression from HepG2 and HepG2.2.15 cells, 1x106 cells were plated in 6-well plate for the different experiments. For the mRNA expression of TLR7, different cell cycle regulators and the different TLR7 signaling molecules from HepG2/HepG2.2.15 cells, total RNA was treated with DNase and was reverse transcribed with random hexamers using Revert Aid first-strand cDNA synthesis kit (MBI Fermentas). Real time PCR was performed in ABI 7200 SDS (Applied Biosystems, Foster City, CA, USA) using Power SYBR Green (Applied Biosystems). The target mRNA was relatively quantified and was normalized to the internal control (GAPDH). The PCR cycle number (CT) at which the exponential growth in the fluorescence from the dye (SYBR Green) passes a certain threshold was used to calculate the relative gene expression. 2-ΔΔCT was calculated to represent the relative quantification of the gene, where ΔC T (C T-target geneC T-GAPDH). ΔΔCT = ΔC T (Experiment) - ΔC T(Control). List of primers used are listed in Table 1.

Western blot analysis

For western blotting, cells were harvested and lysed with Laemelli buffer containing 120 mMTris-HCl (pH-6.8), 20% Glycerol and 4% SDS. Almost equal amounts of protein were then run in a SDS PAGE and transferred on Nitrocellulose membrane (Millipore). Following incubation with primary antibody (overnight at 4 °C) and HRP conjugated secondary antibody (3 h at room temperature), the blots were developed using chemiluminescent substrate (Millipore). Densitometry measurements of bands were used for quantification of each marker by integrating each peak in Image J software. List of primary antibodies are listed in Table 2.
Table 1
List of primer sequences used for RT-PCR analysis
Gene
FORWARD PRIMER
REVERSE PRIMER
IRAK 1
5'-ACCGCAGATTATCATCAACC-3'
5'-AGACTTACAGCCATACTTCACT-3'
IRAK 4
5'-GCTGTATGTAGGGTGGAAAC-3’
5'-TGCTGACAACTGGAAGGTAG-3'
TRAF6
5'-GCCCAGGCTGTTCATAGTTT-3'
5'-CAAGGGAGGTGGCTGTCATA-3'
p53
5’-CCCAAGCAATGGATGATTTGA-3’
5’-GGCATTCTGGGAGCTTCATCT-3’
CYCLIN D1
5’-AGCTCCTGTGCTGCGAAGTGGAAAC-3’
5’-AGTGTTCAATGAAATCGTGCGGGGT-3’
CYCLIN E
5’-CAGCACTTTCT TG AGCAACACCCTC-3’
5’-TCTCTAT GTCGCACCACTGATACCC-3’
CYCLIN B1
5’-AAGAGCTTTAAACTTTGGTCTGGG-3’
5’-CTTTGTAAGTCCTTGATTTACCATG-3’
CYCLIN A
5’GCATGTCACCGTTCCTCCTT-3’
5’CAGGGCATCTTCACGCTCTAT-3’
JNK
5'- GTACTTGTATGAAACCACCTTTCT -3'
5'- AGCATCTCTTTCTGAATCTATGAAG -3'
PI3KCA
5'- AAGGGTGCTAAAGAGGAACAC -3’
5'-CATGAGGTACTGGCCAAAGAT -3'
PI3KCB
5'- CTCCAAATGTTGCGCTTGATG -3'
5'- ACAACTTCAATGAGGCCAGAG -3'
PI3KCG
5’- CACCGAGACAGGAAACCTATTT -3’
5’- TAGCACAAATGGCACTCTCTC -3’
NF-КB
5’-CGCATCCAGACCAACAACA-3’
5’- TGCCAGAGTTTCGGTTCAC-3’
p38
5’- TCTGCTTACCCTTCACCTTTG -3’
5’- CACATCCTCACTCTGCTAGAAAT -3’
c-jun
5’-CAAAGTTTGGATTGCATCAATG-3’
5’- TAACATTATAAATGGTCACAGCACATG-3’
c-myc
5’-CTTCTCTCCGTCCTCGGATTCT-3’
5’-GAAGGTGATCCAGACTCTGACCTT-3’
Sap-1
5’-GCTTTTGCCACCACACCACCCATTTCG-3’
5’-GCCCAGACAGAGTGAATGGCCCATGAC-3’
Elk-1
5’-ACCTGAAATCGGAAGAGCTTAAT-3’
5’-AACTTCCAACTCTTCCTTGGG-3’
TNF-α
5’-ATGGGCTACAGGCTTGTCACT-3’
5’-CTCTTGGCAGCCTTCCTGATT-3’
IFN-β
5’-GTCTCCTCCAAATTGCTCTC-3’
5’-ACAGGAGCTTCTGACACTGA-3’
IFN-α
5’-TGGCTGTGAAGAAATACTTCCG-3’
5’-TGTTTTCATGTTGGACCAGATG-3’
IL-6
5’-ATGTAGCCGCCCCACACAGA-3’
5’-CATCCATCTTTTTCAGCCAT-3’
IL-1β
5’-ACAGATGAAGTGCTCCTTCCA-3’
5’-GTCGGAGATTCGTAGCTGGAT-3’
GAPDH
5'-AAGGCTGTGGGCAAGG-3'
5'-TGGAGGAGTGGGTGTCG-3'
Table 2
List of Antibodies used
ANTIBODY
CAT. NO.
COMPANY
Anti-GAPDH
ab9485
ABCAM
Anti-H3
ab10799
ABCAM
Anti-H3K36Me3
ab9050
ABCAM
Anti-H3K4Me3
39159
ACTIVE MOTIF
Anti-H3K9Me3
39161
ACTIVE MOTIF
Anti-H3K27Me3
39155
ACTIVE MOTIF
Anti-H3K18Ac
39587
ACTIVE MOTIF
Anti-H3K9Ac
 
MILLIPORE,07-352
Anti-NFКBp65
14-6731-81
e-BIOSCIENCE
Anti-p53
SC-126
SANTA CRUZ BIOTECHNOLOGY
Anti-Mouse IgG-HRP
W402B
PROMEGA
Anti-Rabbit IgG-HRP
A1949
SIGMA
Anti-Rabbit Alexa Fluor
A11034
INVITROGEN

Confocal imaging to detect NF-КB nuclear translocation

HepG2.2.15 cells were grown on coverslips and treated with R837 as stated earlier. The cells were washed thrice with Phosphate buffered saline (PBS) and then fixed with 4% Paraformaldehyde (Sigma) in PBS for 10 min at room temperature (RT). Cells were washed thrice with PBS and permeabilized with 1% Triton X-100 in PBS for 10 min at RT, washed with PBS thrice followed by blocking with 3% BSA in PBS for 1 h at RT. Cells were incubated with Anti-NFКB (eBioscience) for 1 h at RT, washed thrice with PBST (PBS + 0.05% Tween20) and then incubated with secondary antibody (Alexa-Fluor anti-rabbit 488, Invitrogen) for 1 h in dark at RT, followed by three washes with PBST. Coverslips were mounted with mounting media containing DAPI (Sigma Aldrich). Fluorescence for Alexa and DAPI was visualized with Nikon Ti-E confocal microscope with A1RMP scanner head equipped with Nikon imaging software (NIS).

Cell cycle analysis

For cell cycle analysis, the cells were harvested and thoroughly re-suspended in Phosphate Buffered Saline (PBS). The cells were then fixed by adding double volume of chilled 70% ethanol (Merck) drop wise, with continuous vortexing. After incubating the mixture overnight at −20 °C, it was spinned and the cells were resuspended in 500 μl of PBS. The cells were then incubated with RNaseA (0.2 mg/ml) for 30 min followed by Propidium Iodide (50 μg/ml) (Sigma) at 37 °C for 1 h. Flow cytometric data acquisition was performed on BD FACS Calibur platform.

MTT assay

Cell proliferation was measured by MTT assay (Cell Titer 96® AQueous One Solution Cell Proliferation Assay, Promega, USA) as described previously [9]. The cells were uniformly seeded in each well of 96-well plates and grown in RPMI 1640 supplemented with 10% FBS. After 24 h, the media was removed and replaced with fresh media and treated with R837. The plates were incubated at 37 °C in a humidified atmosphere of 5% CO2 for 72 h. At indicated time-points, relative cell numbers were determined by incubating cells with MTT3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide. The absorbance at 490 nm is directly proportional to the number of viable cells. All experiments were performed in triplicates.

Results

Reduced TLR7 expression during HBV infection

Our previous studies have showed that TLR7 mRNA expression is highly compromised in HBV replicating HepG2.2.15 cells when compared to the HepG2 cells [9]. It is believed that HBV represses the innate immune response during a natural infection. Thus, it was expected that TLR7 expression would be re-established on viral elimination. We therefore, wanted to check the TLR7 expression of HepG2.2.15 cells on administration of a common nucleoside analogue (Lamivudine). It was seen that TLR7 expression showed a gradual increase on treatment of HepG2.2.15 cells with Lamivudine in a dose dependent manner (20 μM, 50 μM and 100 μM). The doses of lamivudine were used previously where HBV mutants were subjected to drug susceptibility assay in vitro [10]. HepG2 cells taken as control, did not show changes in TLR7 expression on Lamivudine treatment (Fig. 1a i and ii). We also showed a significant suppression of HBV DNA viral load on Lamivudine treatment (Fig. 1b). This broadly indicated that HBV viral load was inversely proportional to the TLR7 expression. Small-scale preliminary study also showed that TLR7 expression was downregulated in liver biopsy specimens from chronic HBV patients (LB_7-18) (n = 12) compared to control steatosis individuals (LB_1-6) (n = 6) (Fig. 1c). The viral and clinical parameters of the patients are also listed (Fig. 1d). Interestingly, while analyzing the TLR7 expression in liver biopsy specimens, it was seen that the HBV viral loads in the biopsies showed an inverse relationship with the TLR7 expression status. Liver biopsy samples LB_8, LB_13, LB_15, LB_16, LB_18 exhibiting high viral loads had lower TLR7 levels. We thus wanted to investigate whether inciting TLR7 with its specific ligand could help in reduction of viral components.

Suppression of HBV replication upon TLR7 activation in HepG2.2.15 cells

R837 activates a MyD88-dependent TLR7 pathway and leads to the induction of different transcription factors, including NF-КB. To confirm the stimulation of TLR7 with its ligand imidazoquinoline (R837), the expression of chief down-stream molecules belonging to the TLR7 pathway were checked post treatment. Stimulation led to increased expression of the different pathway regulators (NF-КB, p38, JNK). However, PI3K expression did not show a significant change on TLR7 stimulation (Fig. 2a). Chief antiviral cytokines (IFN-α, IFN-β, TNF-α and IL-6) which are associated with HBV clearance were also upregulated on TLR7 stimulation (Fig. S1A). Stimulation of TLR7, promoted proteolytic degradation of the inhibitor I-КB and allowed nuclear translocation of Nuclear Factor-КB p65 subunit from the cytoplasm of the cells (Fig. 2b). Interestingly, the protein expression of NF-КB is greatly compromised in HepG2.2.15 cells compared to HepG2 cells (Fig. 2c), the levels of which are substantially restored upon TLR7 activation (Fig. 2d). In an attempt to address the effect of TLR7 activation in HBV replication, HepG2.2.15 cells were treated with 4, 6 and 8 μg/ml of R837 for 72 h and there was a significant decrease in HBV DNA viral load (Fig. 3a) and viral protein (HBsAg and HBeAg) concentration (Fig. 3b) in a dose dependent manner in the culture supernatant upon treatment with ligand.

TLR7 agonist suppresses HBV replication through JNK pathway

A look at the signaling cascade involving TLR7 is depicted in Fig. 4a. In order to identify the pathway through which TLR7 executes its anti-viral effect, we targeted and inhibited some key molecules essential in each of these pathways (JNK, p38, PI3K and NF-КB) in presence of R837. HBV DNA load was maximal when the JNK pathway was blocked with SP600125 even when TLR7 was stimulated as compared to the other blockers PDTC, LY294002 and SB203580 which blocked NF-КB, PI3K and p38 pathway respectively (Fig. 4b). These blockers have specific targets and retards definite signaling pathways. Our findings thus suggest that JNK pathway blocker SP600125 impedes the antiviral action of R837. Increased viral protein expression (HBsAg and HBeAg) on using SP600125 substantiates the observation, that TLR7 agonist shows its antiviral action through the JNK pathway (Fig 4C). The host cytokine profile (chiefly associated with HBV clearance) was monitored in presence of protein blockers in combination with R837 in order to identify the cytokines responsible for viral suppression. The expression of antiviral cytokines including IFN-β, TNF-α, IL-1β, IL-6 and IL-10 was substantially repressed on blocking JNK pathway with its inhibitor. However, the expression of the cytokines IFN-α and IFN-γ showed no significant downregulation (Additional file 1: Fig. S1b). Thus, the cytokines IFN-β, TNF-α, IL-1β, IL-6 and IL-10 probably play a crucial role in HBV suppression on TLR7 activation. R837 modulates the key components of signal transduction pathway of host cells and implicate a broad-spectrum function of this agonist in its ability to modulate multiple cellular functions.

TLR7 stimulation exerts an alteration in host epigenetic signatures in HepG2.2.15 cells

We have monitored that TLR7 activation affects the transcription of multiple downstream targets including NF-КB, p38 and JNK. All these proteins are important hubs of signal transduction pathway and can execute pleiotropic effects. We have observed antiviral response of TLR7 is majorly triggered through the JNK pathway. We thus wanted to monitor the alteration of expression of several JNK downstream targets following TLR7 activation. Interestingly, JNK responsive gene c-Jun showed prominent increase in transcription unlike SAP-1 whose expression is in a JNK independent manner. Other JNK responsive genes like c-Myc and Elk-1 [13] showed marginal changes (Fig. 4d), indicating that the antiviral response although majorly steered through JNK pathway, is mostly gene specific.
Since TLR7 activation upregulates the expression of different downstream regulators, we wanted to understand its role, affecting the transcription of chromatin template. In order to assess that, the global alteration of selective histone modification including H3K4Me3, H3K9Me3 and H3K9Ac, was quantified in HepG2.2.15 cells following R837 treatment (Fig. 5a). While the activation signatures (H3K4Me3, H3K36Me3 and H3K9Ac) did not show a significant change, alteration in H3K9Me3 repression mark was noteworthy which indicates a de-repression scenario where active transcription was re-established. A comparison of these epigenetic signatures between HepG2 and HepG2.2.15 cells was further carried out and H3K9Me3 level, unlike other marks, showed an increased expression in the latter cell line (Fig. 5b). Thus, upon HBV infection host transcription would preferably halt which is evident from the epigenetic change. This repression is again rescued upon TLR7 activation implicating that R837 has an ability to affect the cellular microenvironment thereby re-establishing transcription activation status. Thus the HBV induced alteration of host epigenetic status implicates a novel role of this ligand in regulating cellular transcription profile of host cell.

TLR7 activation results in the release of G1/S cell cycle arrest in HepG2.2.15 cells

The alteration of epigenetic signature in HepG2.2.15 cells as a sequel to R837 treatment implicates a broad-spectrum effect in host cell milieu. We further investigated whether TLR7 activation might influence the host cell cycle stages. It has been shown previously that HBV transformed cell line HepG2.2.15 undergoes a G1/S arrest. This arrest is induced by the virus and results in slow proliferation of the cells [14]. Since TLR7 activation reduces the HBV DNA viral load, we wanted to find out, whether this would affect the status of G1/S arrest within the cells. It was observed that reduction of HBV infection induced a release in the G1/S arrest (Fig. 6a). The percentage of cells in the different phases of cell cycle was determined in HepG2.2.15 cells before and after the treatment with R837 (Fig. 6b). The proportion of cells in G1 phase was maximal compared to S and G2/M phases in HepG2.2.15 cells. A distinct G1/S arrest in the cell cycle of the HepG2.2.15 cells was observed. To assess the antiviral action of R837, we checked the proportion of cells in different phases of the cell cycle on TLR7 activation. The quantity of cells in the G1 phase showed significant reduction, when the cells were treated with R837. The cells apparently entered the S phase after a G1 escape. Thus, a distinct release in the cell cycle arrest in HepG2.2.15 cells was observed after treatment. To investigate the mechanism of G1 phase arrest induced by HBV and subsequent release in arrest after TLR7 activation, the expression of cell cycle regulators was studied. It was expected that the dynamics of transition of different phases of cell cycle would corroborate with expression of cell cycle genes. p53 is the key regulator in the transition from G1 to S phase and is upregulated in virus infected cells [15]. In this connection it was observed that mRNA expression of p53 remains upregulated in liver biopsy samples of chronic HBV patients (n = 8) as compared to steatosis patients, serving as disease control (n = 7) (Fig. 6c). Further, treated cells showed a reduced mRNA and protein expression of p53 compared to the untreated HepG2.2.15 cells (Fig. 6d, 5B). Cyclin D1 is also required for G1/S cell cycle transition and remains upregulated in HepG2.2.15 cells compared to HepG2 cells (16). TLR7 activation led to a downregulated expression of Cyclin D1 transcript indicating the role of TLR7 in viral reduction. Cyclin E, another crucial regulator of G1/S transition, remains downregulated in infected cells [16]. It was seen that mRNA expression of Cyclin E was significantly upregulated in treated cells (Fig. 6d) implicating a p53- independent cell cycle regulatory pathway upon TLR7 activation. Since the proportion of cells in G2/M transition was not affected after treatment, it was expected that the regulators too would not show significant modulation. Our findings showed, that the cell cycle regulators CyclinB1 and A, which play crucial role in G2/M and late S into late G2 phase transition respectively, had no significant changes in treated and untreated HepG2.2.15 cells (Fig. 6d). Further, MTT assay showed that treatment of HepG2.2.15 cells with R837 at different time points had no significant cytotoxic affects and on the contrary promoted cell growth (Fig. 6e). MTT assay clearly showed that there was no significant cell death due to R837 treatment.

Discussion

TLRs have a pivotal role in the regulation of innate immune responses and are intricately associated with the host defense mechanism. TLR activation leads to the production of endogenous interferons and antiviral cytokines, which establishes a crosstalk between innate and adaptive immune responses. This triggers the immune effector cells, which plays a vital role in the antiviral immunity. Studies show that modulation of TLR signaling pathways can be effective in controlling infectious diseases, immune-related disorders and cancers [17]. It has been seen previously that the innate immune response remains suppressed on HBV infection [18]. In the current study, we have shown that TLR7 expression is reduced in liver biopsy samples of Chronic Hepatitis B patients compared to steatosis individuals serving as disease controls. Patients with steatosis have been earlier used as disease control for HBV-related innate immune studies [19]. We have also showed that the compromised TLR7 expression in HepG2.2.15 cells was significantly re-established when HBV replication was suppressed by use of a common nucleoside analogue (Lamivudine), thus further proving that HBV suppresses TLR7. Lamivudine is a currently approved licensed anti-HBV drug which results in decrease in the circulating HBV DNA levels [20]. Previous studies have showed that Lamivudine significantly inhibited levels of HBV DNA in HepG2.2.15 cell line [21]. This observation was further confirmed, since there was no significant change in TLR7 expression in HepG2 cells taken as control.
Our previous studies have shown that both TLR7 and miR-155 are down-regulated and positively correlate with each other in HBV infection and ectopic expression of miR-155 can reduce HBV viral load through targeted suppression of C/EBP-β [9]. Thus, possibly, stimulation of TLR7 might as well exhibit an anti-viral effect. Therefore, we aimed to explore the effect of TLR7 stimulation on HBV replication in hepatocyte micro-environment. Our findings show that TLR7 activation leads to suppression of HBV replication and viral protein (HBsAg and HBeAg) production, which is in concordance to a previous study that was conducted in Chimpanzees [22]. This study takes a step forward in identifying the different host factors and the alterations in gene expression on TLR7 activation in virus infected hepatocytes. An earlier report showed that MAPK/ERK and PI3K/AKT pathways were responsible for the suppression of HBV replication through TLR2 stimulation [8], however no such studies were conducted with TLR7. In the current study, we found that the antiviral action of TLR7 takes place through the JNK pathway. JNKs are subgroups of MAP kinases and are activated in response to cytokines, TLRs and antigen receptors like T and B cells [23]. Activated JNKs phosphorylate c-Jun, JunD, ATF and other transcription factors, which is involved in the formation and activation of AP-1 complex. C-jun is a downstream molecule phosphorylated by the JNKs and is a well-characterized oncogene, found in the liver [24]. Results showed that there was an increased expression of c-jun on TLR7 stimulation, indicating the activation of JNK pathway and its possible role in the anti-viral response. Further, it was seen that blocking JNK pathway with SP600125, curbed the expression of different cytokines including IFN-β, TNF-α, IL-1β, IL-6 and IL-10. Chief anti-inflammatory cytokine IL-10 and pro-inflammatory cytokines IL-6 and TNF-α probably play a balanced role in viral elimination. The blockers that have been used for pathway screening have specific roles and act specifically on different substrates. Previously, several cytokines have been shown to have a HBV suppressive effect in infected transgenic mice and cell line models. Several cytokines viz. IL-12, IL-18 and IFNs have been shown to have a suppressive effect in HBV-infected transgenic mice [2527]. Another study had shown that IFN-γ synergistically acts with TNF-α and inhibits expression of HBV RNA levels in immortalized hepatocyte cell line (HBV-MET) [28]. IL-4 has also been shown to be an effective cytokine in viral protein suppression in Hep3B cell line [29]. Although the above-mentioned cytokines may play vital roles in HBV suppression, there may be multiple modes by which HBV is eliminated on TLR7 activation. Further studies are required to elucidate the exact pathway responsible in HBV clearance on triggering TLR7.
Eukaryotic genome is packaged into chromatin, which is subjected to dynamic structural alteration [30]. Post-translational modification (PTM) of core histone tails regulates gene expression spatiotemporally [31]. Site specific histone modifications can be read by effector proteins which delineate a specific cellular fate as highlighted through histone code hypothesis [30]. H3K4Me3 and H3K9Me3 are the transcription activation and repression signatures respectively. H3K9Ac also positively regulates transcription. Thus the global alterations of these epigenetic signatures reflect a major variation in cellular gene expression profile. Dynamic chromatin architecture is perturbed due to viral infection and an alteration of host posttranslational modification; fewer studies have embarked onto changes in host genome. Remarkably, Telbivudine, an anti HBV drug dramatically restores histone H3K4Me3 and H3K27Me3 of HepG2.2.15 cells akin to HepG2 cells [32]. Detailed investigation of host epigenetic changes as a sequel to TLR7 activation showed global repression of H3K9Me3 levels (Fig. 5a). This indicates a transcription de-repression scenario. Indeed we have seen upregulation of JNK responsive transcripts upon R837 treatment (Fig. 6a). This effect is however gene specific in broad perspective. Treatment of R837 to HepG2.2.15 cells reversed the epigenetic markers as well as transcription factor levels similar to HepG2 cells implicating that TLR7 activation possibly leads to viral reduction through suppression of HBV replication. These results further raise a possibility that antiviral response can be manifested by targeting the histone PTMs gene specifically and hence can be used as an epigenetic therapy.
Previous studies show Hepatitis B undergoes slow cell proliferation and induces a G1/S cell cycle arrest in HepG2.2.15 cells [16]. It is worth mentioning that HBx performs a dual activity of anti-proliferation and transactivation in HCC tissues. The study further showed that the effect of HBx on cell viability probably depends on the balance between pro-apoptotic and anti-apoptotic effects of NF-КB on different cell types [33]. Thus, the wild type HBx is responsible for the late G1 arrest, and upon TLR7 activation this arrest is partially released. The viral infection also triggers an upregulated expression of p53, which successfully retards the transition from G1 to S phase and prevents cell growth. The elevated p53 expression in liver biopsy samples of CHB patients re-affirmed the G1/S arrest induced by the virus. Previous studies have shown that serum p53 levels are higher in HBV- related cirrhotic patients compared to chronic HBV ones [34]. Interestingly, apart from alteration of p53 levels, Cyclin D1 and Cyclin E levels were dramatically modulated upon TLR7 activation implicating a role of p53 independent pathway regulating cell cycle. Thus, R837 treatment partially restores the cell cycle stages by removing the G1/S arrest and thus the antiviral response could be reestablished. No significant cell death was observed in the MTT assay. There was a clear indication of cell proliferation and there was increase in cell number at different time points on R837 treatment. The study on role of TLR7 in HBV infection has been shown in HepG2.2.15 cell line, harboring multiple copies of HBV genome, since the supernatant from the cell culture can infect chimpanzees intravenously, showing typical symptoms of human hepatitis, highlighting the efficiency of the model. Further, HepG2.2.15 cells have been used to study the pathogenesis of HBV and in elucidating the role of anti-viral drugs in HBV-related disorders [3539]. Nevertheless, TLR7 levels and its role in HBV pathogenesis should be looked into other relevant systems like PHH cultures or NTCP-driven in vitro infection of different cell lines.

Conclusion

The study thus shows that TLR7 plays a anti-viral role in HBV infection and holds a promising immuno-modulatory therapeutic value against this hepato-tropical viral disease.

Acknowledgements

DD is recipient of Inspire Fellowship. We thank Mr. SrijanHalder and ChinmayMondal for their exceptional technical assistance. We would also like to thank Dr. Prabal Kumar Chakraborty, working with Towa Optics (I) Pvt. Ltd. for his technical assistance in confocal microscopy.

Funding

This work was supported by the Indian Council of Medical Research (ICMR) intramural project. CD acknowledges the financial support from Biomolecular Assembly, Recognition and Dynamics (BARD) project (Grant 12-R&d-SIN-5.04-0103) from Department of Atomic Energy (DAE), Government of India.

Availability of data and materials

All datasets on which the conclusions of the manuscript rely has been represented in the form of figures in the manuscript and supplementary details.

Authors’ contributions

Conceived and designed the experiments: RC NS CD SC DD. Performed the experiments: DD IS NS AP. Analyzed the data: RC DD NS IS CD. Contributed reagents/materials/analysis tools: RC DD NS CD AP DS SC MB JN SPS. Wrote the paper: RC DD CD IS NS AP DS MB.

Competing interests

The authors declare no competing interest.
Not applicable.
Signed informed consent was obtained from patients and the institutional ethical committee of Kalinga Gastrology Foundation approved the study.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Mailliard ME, Gollan JL. Emerging therapeutics for chronic hepatitis B. Annu Rev Med. 2006;57:155–66.CrossRefPubMed Mailliard ME, Gollan JL. Emerging therapeutics for chronic hepatitis B. Annu Rev Med. 2006;57:155–66.CrossRefPubMed
2.
Zurück zum Zitat Bertoletti A, Gehring AJ. The immune response during hepatitis B virus infection. J Gen Virol. 2006;87(Pt 6):1439–49.CrossRefPubMed Bertoletti A, Gehring AJ. The immune response during hepatitis B virus infection. J Gen Virol. 2006;87(Pt 6):1439–49.CrossRefPubMed
4.
Zurück zum Zitat Lucifora J, Durantel D, Testoni B, Hantz O, Levrero M, Zoulim F. Control of hepatitis B virus replication by innate response of HepaRG cells. Hepatology. 2010;51(1):63–72.CrossRefPubMed Lucifora J, Durantel D, Testoni B, Hantz O, Levrero M, Zoulim F. Control of hepatitis B virus replication by innate response of HepaRG cells. Hepatology. 2010;51(1):63–72.CrossRefPubMed
5.
Zurück zum Zitat Lutgehetmann M, Bornscheuer T, Volz T, Allweiss L, Bockmann JH, Pollok JM, Lohse AW, Petersen J, Dandri M. Hepatitis B virus limits response of human hepatocytes to interferon-alpha in chimeric mice. Gastroenterology. 2011;140(7):2074–83. 2083 e2071-2072.CrossRefPubMed Lutgehetmann M, Bornscheuer T, Volz T, Allweiss L, Bockmann JH, Pollok JM, Lohse AW, Petersen J, Dandri M. Hepatitis B virus limits response of human hepatocytes to interferon-alpha in chimeric mice. Gastroenterology. 2011;140(7):2074–83. 2083 e2071-2072.CrossRefPubMed
6.
Zurück zum Zitat Zhang X, Kraft A, Broering R, Schlaak JF, Dittmer U, Lu M. Preclinical development of TLR ligands as drugs for the treatment of chronic viral infections. Expert Opin Drug Discovery. 2012;7(7):597–611.CrossRef Zhang X, Kraft A, Broering R, Schlaak JF, Dittmer U, Lu M. Preclinical development of TLR ligands as drugs for the treatment of chronic viral infections. Expert Opin Drug Discovery. 2012;7(7):597–611.CrossRef
7.
Zurück zum Zitat Isogawa M, Robek MD, Furuichi Y, Chisari FV. Toll-like receptor signaling inhibits hepatitis B virus replication in vivo. J Virol. 2005;79(11):7269–72.CrossRefPubMedPubMedCentral Isogawa M, Robek MD, Furuichi Y, Chisari FV. Toll-like receptor signaling inhibits hepatitis B virus replication in vivo. J Virol. 2005;79(11):7269–72.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Zhang X, Ma Z, Liu H, Liu J, Meng Z, Broering R, Yang D, Schlaak JF, Roggendorf M, Lu M. Role of Toll-like receptor 2 in the immune response against hepadnaviral infection. J Hepatol. 2012;57(3):522–8.CrossRefPubMed Zhang X, Ma Z, Liu H, Liu J, Meng Z, Broering R, Yang D, Schlaak JF, Roggendorf M, Lu M. Role of Toll-like receptor 2 in the immune response against hepadnaviral infection. J Hepatol. 2012;57(3):522–8.CrossRefPubMed
9.
Zurück zum Zitat Sarkar N, Panigrahi R, Pal A, Biswas A, Singh SP, Kar SK, Bandopadhyay M, Das D, Saha D, Kanda T, et al. Expression of microRNA-155 correlates positively with the expression of Toll-like receptor 7 and modulates hepatitis B virus via C/EBP-beta in hepatocytes. J Viral Hepat. 2015;22(10):817–27.CrossRefPubMed Sarkar N, Panigrahi R, Pal A, Biswas A, Singh SP, Kar SK, Bandopadhyay M, Das D, Saha D, Kanda T, et al. Expression of microRNA-155 correlates positively with the expression of Toll-like receptor 7 and modulates hepatitis B virus via C/EBP-beta in hepatocytes. J Viral Hepat. 2015;22(10):817–27.CrossRefPubMed
10.
Zurück zum Zitat Kwon SY, Park YK, Ahn SH, Cho ES, Choe WH, Lee CH, Kim BK, Ko SY, Choi HS, Park ES, et al. Identification and characterization of clevudine-resistant mutants of hepatitis B virus isolated from chronic hepatitis B patients. J Virol. 2010;84(9):4494–503.CrossRefPubMedPubMedCentral Kwon SY, Park YK, Ahn SH, Cho ES, Choe WH, Lee CH, Kim BK, Ko SY, Choi HS, Park ES, et al. Identification and characterization of clevudine-resistant mutants of hepatitis B virus isolated from chronic hepatitis B patients. J Virol. 2010;84(9):4494–503.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Chandra PK, Banerjee A, Datta S, Chakravarty R. G1862T mutation among hepatitis B virus-infected individuals: association with viral genotypes and disease outcome in Kolkata, Eastern India. Intervirology. 2007;50(3):173–80.CrossRefPubMed Chandra PK, Banerjee A, Datta S, Chakravarty R. G1862T mutation among hepatitis B virus-infected individuals: association with viral genotypes and disease outcome in Kolkata, Eastern India. Intervirology. 2007;50(3):173–80.CrossRefPubMed
12.
Zurück zum Zitat Zhou H, Huang X, Cui H, Luo X, Tang Y, Chen S, Wu L, Shen N. miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells. Blood. 2010;116(26):5885–94.CrossRefPubMed Zhou H, Huang X, Cui H, Luo X, Tang Y, Chen S, Wu L, Shen N. miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells. Blood. 2010;116(26):5885–94.CrossRefPubMed
13.
Zurück zum Zitat Bogoyevitch MA, Kobe B. Uses for JNK: the many and varied substrates of the c-Jun N-terminal kinases. Microbiol Mol Biol Rev. 2006;70(4):1061–95.CrossRefPubMedPubMedCentral Bogoyevitch MA, Kobe B. Uses for JNK: the many and varied substrates of the c-Jun N-terminal kinases. Microbiol Mol Biol Rev. 2006;70(4):1061–95.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Ozer A, Khaoustov VI, Mearns M, Lewis DE, Genta RM, Darlington GJ, Yoffe B. Effect of hepatocyte proliferation and cellular DNA synthesis on hepatitis B virus replication. Gastroenterology. 1996;110(5):1519–28.CrossRefPubMed Ozer A, Khaoustov VI, Mearns M, Lewis DE, Genta RM, Darlington GJ, Yoffe B. Effect of hepatocyte proliferation and cellular DNA synthesis on hepatitis B virus replication. Gastroenterology. 1996;110(5):1519–28.CrossRefPubMed
15.
Zurück zum Zitat Bartek J, Lukas J. Pathways governing G1/S transition and their response to DNA damage. FEBS Lett. 2001;490(3):117–22.CrossRefPubMed Bartek J, Lukas J. Pathways governing G1/S transition and their response to DNA damage. FEBS Lett. 2001;490(3):117–22.CrossRefPubMed
16.
Zurück zum Zitat Wang T, Zhao R, Wu Y, Kong D, Zhang L, Wu D, Li C, Zhang C, Yu Z, Jin X. Hepatitis B virus induces G1 phase arrest by regulating cell cycle genes in HepG2.2.15 cells. Virol J. 2011;8:231.CrossRefPubMedPubMedCentral Wang T, Zhao R, Wu Y, Kong D, Zhang L, Wu D, Li C, Zhang C, Yu Z, Jin X. Hepatitis B virus induces G1 phase arrest by regulating cell cycle genes in HepG2.2.15 cells. Virol J. 2011;8:231.CrossRefPubMedPubMedCentral
17.
18.
Zurück zum Zitat Wu J, Meng Z, Jiang M, Pei R, Trippler M, Broering R, Bucchi A, Sowa JP, Dittmer U, Yang D, et al. Hepatitis B virus suppresses toll-like receptor-mediated innate immune responses in murine parenchymal and nonparenchymal liver cells. Hepatology. 2009;49(4):1132–40.CrossRefPubMed Wu J, Meng Z, Jiang M, Pei R, Trippler M, Broering R, Bucchi A, Sowa JP, Dittmer U, Yang D, et al. Hepatitis B virus suppresses toll-like receptor-mediated innate immune responses in murine parenchymal and nonparenchymal liver cells. Hepatology. 2009;49(4):1132–40.CrossRefPubMed
19.
Zurück zum Zitat Visvanathan K, Skinner NA, Thompson AJ, Riordan SM, Sozzi V, Edwards R, Rodgers S, Kurtovic J, Chang J, Lewin S, et al. Regulation of Toll-like receptor-2 expression in chronic hepatitis B by the precore protein. Hepatology. 2007;45(1):102–10.CrossRefPubMed Visvanathan K, Skinner NA, Thompson AJ, Riordan SM, Sozzi V, Edwards R, Rodgers S, Kurtovic J, Chang J, Lewin S, et al. Regulation of Toll-like receptor-2 expression in chronic hepatitis B by the precore protein. Hepatology. 2007;45(1):102–10.CrossRefPubMed
20.
21.
Zurück zum Zitat Cao H, Tao P. Anti-hepatitis B virus effects of lamivudine and other five drugs in vitro. Zhonghua Yi Xue Za Zhi. 2001;81(16):1004–7.PubMed Cao H, Tao P. Anti-hepatitis B virus effects of lamivudine and other five drugs in vitro. Zhonghua Yi Xue Za Zhi. 2001;81(16):1004–7.PubMed
22.
Zurück zum Zitat Lanford RE, Guerra B, Chavez D, Giavedoni L, Hodara VL, Brasky KM, Fosdick A, Frey CR, Zheng J, Wolfgang G et al.: GS-9620, an oral agonist of Toll-like receptor-7, induces prolonged suppression of hepatitis B virus in chronically infected chimpanzees. Gastroenterology 2013, 144(7):1508–1517, 1517 e1501-1510. Lanford RE, Guerra B, Chavez D, Giavedoni L, Hodara VL, Brasky KM, Fosdick A, Frey CR, Zheng J, Wolfgang G et al.: GS-9620, an oral agonist of Toll-like receptor-7, induces prolonged suppression of hepatitis B virus in chronically infected chimpanzees. Gastroenterology 2013, 144(7):1508–1517, 1517 e1501-1510.
23.
Zurück zum Zitat Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007;19(2):142–9.CrossRefPubMed Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007;19(2):142–9.CrossRefPubMed
25.
Zurück zum Zitat Cavanaugh VJ, Guidotti LG, Chisari FV. Interleukin-12 inhibits hepatitis B virus replication in transgenic mice. J Virol. 1997;71(4):3236–43.PubMedPubMedCentral Cavanaugh VJ, Guidotti LG, Chisari FV. Interleukin-12 inhibits hepatitis B virus replication in transgenic mice. J Virol. 1997;71(4):3236–43.PubMedPubMedCentral
26.
Zurück zum Zitat Kimura K, Kakimi K, Wieland S, Guidotti LG, Chisari FV. Interleukin-18 inhibits hepatitis B virus replication in the livers of transgenic mice. J Virol. 2002;76(21):10702–7.CrossRefPubMedPubMedCentral Kimura K, Kakimi K, Wieland S, Guidotti LG, Chisari FV. Interleukin-18 inhibits hepatitis B virus replication in the livers of transgenic mice. J Virol. 2002;76(21):10702–7.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Wieland SF, Guidotti LG, Chisari FV. Intrahepatic induction of alpha/beta interferon eliminates viral RNA-containing capsids in hepatitis B virus transgenic mice. J Virol. 2000;74(9):4165–73.CrossRefPubMedPubMedCentral Wieland SF, Guidotti LG, Chisari FV. Intrahepatic induction of alpha/beta interferon eliminates viral RNA-containing capsids in hepatitis B virus transgenic mice. J Virol. 2000;74(9):4165–73.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Pasquetto V, Wieland SF, Uprichard SL, Tripodi M, Chisari FV. Cytokine-sensitive replication of hepatitis B virus in immortalized mouse hepatocyte cultures. J Virol. 2002;76(11):5646–53.CrossRefPubMedPubMedCentral Pasquetto V, Wieland SF, Uprichard SL, Tripodi M, Chisari FV. Cytokine-sensitive replication of hepatitis B virus in immortalized mouse hepatocyte cultures. J Virol. 2002;76(11):5646–53.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Lin SJ, Shu PY, Chang C, Ng AK, Hu CP. IL-4 suppresses the expression and the replication of hepatitis B virus in the hepatocellular carcinoma cell line Hep3B. J Immunol. 2003;171(9):4708–16.CrossRefPubMed Lin SJ, Shu PY, Chang C, Ng AK, Hu CP. IL-4 suppresses the expression and the replication of hepatitis B virus in the hepatocellular carcinoma cell line Hep3B. J Immunol. 2003;171(9):4708–16.CrossRefPubMed
32.
Zurück zum Zitat Tian Y, Ni D, Yang W, Zhang Y, Zhao K, Song J, Mao Q, Tian Z, van Velkinburgh JC, Yang D, et al. Telbivudine treatment corrects HBV-induced epigenetic alterations in liver cells of patients with chronic hepatitis B. Carcinogenesis. 2014;35(1):53–61.CrossRefPubMed Tian Y, Ni D, Yang W, Zhang Y, Zhao K, Song J, Mao Q, Tian Z, van Velkinburgh JC, Yang D, et al. Telbivudine treatment corrects HBV-induced epigenetic alterations in liver cells of patients with chronic hepatitis B. Carcinogenesis. 2014;35(1):53–61.CrossRefPubMed
33.
Zurück zum Zitat Sirma H, Giannini C, Poussin K, Paterlini P, Kremsdorf D, Brechot C. Hepatitis B virus X mutants, present in hepatocellular carcinoma tissue abrogate both the antiproliferative and transactivation effects of HBx. Oncogene. 1999;18(34):4848–59.CrossRefPubMed Sirma H, Giannini C, Poussin K, Paterlini P, Kremsdorf D, Brechot C. Hepatitis B virus X mutants, present in hepatocellular carcinoma tissue abrogate both the antiproliferative and transactivation effects of HBx. Oncogene. 1999;18(34):4848–59.CrossRefPubMed
34.
Zurück zum Zitat Shahnazari P, Sayehmiri K, Minuchehr Z, Parhizkar A, Poustchi H, Montazeri G, Mohamadkhani A. The Increased Level of Serum p53 in Hepatitis B-Associated Liver Cirrhosis. Iran J Med Sci. 2014;39(5):446–51.PubMedPubMedCentral Shahnazari P, Sayehmiri K, Minuchehr Z, Parhizkar A, Poustchi H, Montazeri G, Mohamadkhani A. The Increased Level of Serum p53 in Hepatitis B-Associated Liver Cirrhosis. Iran J Med Sci. 2014;39(5):446–51.PubMedPubMedCentral
35.
Zurück zum Zitat Sells MA, Zelent AZ, Shvartsman M, Acs G. Replicative intermediates of hepatitis B virus in HepG2 cells that produce infectious virions. J Virol. 1988;62(8):2836–44.PubMedPubMedCentral Sells MA, Zelent AZ, Shvartsman M, Acs G. Replicative intermediates of hepatitis B virus in HepG2 cells that produce infectious virions. J Virol. 1988;62(8):2836–44.PubMedPubMedCentral
36.
Zurück zum Zitat Su J, Jiang L, Wu J, Wu Y, Liu Z: Anti-tumor and anti-virus activity of polysaccharides extracted from Sipunculus nudus(SNP) on Hepg2.2.15. Int J Biol Macromol 2016. Su J, Jiang L, Wu J, Wu Y, Liu Z: Anti-tumor and anti-virus activity of polysaccharides extracted from Sipunculus nudus(SNP) on Hepg2.2.15. Int J Biol Macromol 2016.
37.
Zurück zum Zitat Li B, Guo QL, Tian Y, Liu SJ, Wang Q, Chen L, Dong JX: New Anti-HBV C-Boivinopyranosyl Flavones from Alternanthera philoxeroides. Molecules 2016, 21(3). Li B, Guo QL, Tian Y, Liu SJ, Wang Q, Chen L, Dong JX: New Anti-HBV C-Boivinopyranosyl Flavones from Alternanthera philoxeroides. Molecules 2016, 21(3).
38.
Zurück zum Zitat Cheng Z, Zhi X, Sun G, Guo W, Huang Y, Sun W, Tian X, Zhao F, Hu K. Sodium selenite suppresses hepatitis B virus transcription and replication in human hepatoma cell lines. J Med Virol. 2016;88(4):653–63.CrossRefPubMed Cheng Z, Zhi X, Sun G, Guo W, Huang Y, Sun W, Tian X, Zhao F, Hu K. Sodium selenite suppresses hepatitis B virus transcription and replication in human hepatoma cell lines. J Med Virol. 2016;88(4):653–63.CrossRefPubMed
39.
Zurück zum Zitat Cheng Z, Sun G, Guo W, Huang Y, Sun W, Zhao F, Hu K. Inhibition of hepatitis B virus replication by quercetin in human hepatoma cell lines. Virol Sin. 2015;30(4):261–8.CrossRefPubMed Cheng Z, Sun G, Guo W, Huang Y, Sun W, Zhao F, Hu K. Inhibition of hepatitis B virus replication by quercetin in human hepatoma cell lines. Virol Sin. 2015;30(4):261–8.CrossRefPubMed
Metadaten
Titel
Anti-hepatitis B virus (HBV) response of imiquimod based toll like receptor 7 ligand in hbv-positive human hepatocelluar carcinoma cell line
verfasst von
Dipanwita Das
Isha Sengupta
Neelakshi Sarkar
Ananya Pal
Debraj Saha
Manikankana Bandopadhyay
Chandrima Das
Jimmy Narayan
Shivaram Prasad Singh
Sekhar Chakrabarti
Runu Chakravarty
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2017
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-017-2189-z

Weitere Artikel der Ausgabe 1/2017

BMC Infectious Diseases 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.