Background
Angiotensin II (AngII) is an important modulator of the sympathetic nervous system, cardiac function, blood pressure and salt excretion. The main receptor of AngII in the cardiovascular system is the angiotensin II type 1 receptor (AT
1R), which is a G
αq-protein coupled receptor (GqPCR). Binding of AngII to AT
1R results in activation of phospholipase C, release of inositol 1,4,5-triphosphate (IP
3) and Ca
2+ mobilization from intracellular stores. It is well documented that AngII activation of AT
1R can be followed by desensitization [
1,
2]. The question whether AT
1R desensitization has clinical implications remains to be resolved, since the majority of cell signaling studies on AT
1R have been carried out using concentrations of AngII that are at least three orders of magnitude higher than circulating levels [
2‐
6]. Angiotensin receptor blockers and angiotensin converting enzyme (ACE) inhibitors are, along with voltage gated calcium channel (VGCC) blockers, among the most commonly used antihypertensive drugs. These drugs are used alone or in combination [
7]. Several lines of evidence suggest that activation of AT
1R can increase the activity of VGCC [
8‐
10]. Little is however known about the effect of VGCC blockers on the activity of AT
1R. This is a highly relevant question, since VGCC blockers are sometimes given as mono-therapy.
In the current study, we have compared the AT
1R signaling pattern in response to repeated application of physiological and pharmacological concentrations of AngII, using a Ca
2+ sensitive dye as the principal sensor. The effects of physiological concentrations of AngII on the AT
1R signal were then examined in the presence of the VGCC inhibitors nifedipine and verapamil in therapeutically relevant concentrations. Since there is emerging evidence that some G-protein coupled receptors (GPCR) may be calcium sensitive [
11‐
13], we also determined the effect of physiological concentrations of AngII on the AT
1R signal in the presence of inhibitors of transient receptor potential cation channels (TRPC), another pathway for Ca
2+ entry into the cell. The majority of experiments have been performed using a human embryonic kidney cell line 293a (HEK). In order to validate the physiological significance of our findings, key protocols were also performed using rat cardiomyocytes in primary culture.
Methods
Cells
Primary rat ventricular cardiomyocytes (RVCM) were obtained from 3 to 5 day old Sprague Dawley (Scanbur, Sollentuna, Sweden) and cultured on 18 mm diameter coverslips for 5 days previously described [
14] using a modified growth medium. Growth medium was either a 2:1 mixture of DMEM/F-12:PC-1, supplemented with 2.5% FBS and 0.05 pM of AngII or DMEM for primary cell isolation (Gibco), 1:1000 Cardiomyocyte Growth Supplement (Pierce), 10% FBS and 50 pM AngII. Rats were euthanized by rapid decapitation and the heart removed for generation of cardiomyocyte cultures. Quality of culture was determined using a cardiomyocyte characterization kit (Chemicon). Cardiomyocytes were cultured for 5 days prior to experiment and contracting clusters, seen with transmission light, were selected for recording. Expression of cardiomyocyte markers were confirmed using Troponin I (Chemicon) and Desmin (Chemicon) antibody staining according to manufacturer’s protocol. Rat aortic smooth muscle cells (ASMC, catalog number R6110, 3H Biomedical, ScienCell) were cultured according to manufacturer’s instruction. Briefly, cells were thawed and plated on poly-L-lysine coated coverslips in complete smooth muscle cell medium (SMCM, ScienCell) including 2% FBS and supplemented with 0.05 pM of AngII. Cells were cultured for three to 5 days before experiments, cells from initial plating and first passage were used. Cells were confirmed to express anti-α-smooth muscle actin by immunostaining (antibody from Abcam). Human Embryonic Kidney 293a (HEK, catalog number R70507, Thermo Fisher Scientific) cells were plated on 18 mm diameter coverslips 2 days prior to transfection with Exgen500 (Fermentas), experiments were performed 24 h after transfection. Manufacturers protocols were used for transfection using 1 μg DNA per transfection. HEK cells between passage 3 and 20 was used in experiments. RT-PCR was used to confirm RNA expression of Ca
V1.2 (Fig
2a).
All experiments were performed according to Karolinska Institutet regulations concerning care and use of laboratory animals, and were approved by the Stockholm North ethical evaluation board for animal research.
Reagents and constructs
All chemicals and drugs were obtained from Sigma-Aldrich, if not otherwise stated. Bradykinin was purchased from Abcam. 3,5-bis(trifluoromethyl)pyrazole (BTP2) a TRPC channel blocker was obtained from Santa Cruz. Rat angiotensin II type 1 receptor, AT
1R, with Venus fused at C-terminus was used for Ca
2+ experiments [
15]. The HA-tagged AT1R was made by insertion of PvuI restriction site through mutagenesis in the first extracellular loop between Pro331 and Phe332. Agilent QuikChangeII Site-Directed Mutagenesis kit together with the following primers were used: sense 5′ – GGTGATTGCCGAACGATCGGGGCCAGCGGTAC and antisense 5′ GTACCGCTGGCCCCGATCGTTCGGCAATCACC. The product was digested with PvuI (Thermo Scientific), and RS
YPYDVPDYARS (Hemaglutinin flanked by PvuI sites) was inserted through ligation (Phusion Hot Start II, ThermoFisher). Structure of the construct was verified by using BigDye® Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). pGβ-2A-YFP-Gγ2-IRES-GαqmTq [
16] was kindly provided by the lab of Th. W. J. Gadella and used for Gαq-Gβγ FRET (Förster Resonance Energy Transfer) measurements.
Membrane recruitment
Control and cells exposed to AngII were fixed using 2% paraformaldehyde for 10 min and stained using 1:1000 dilution of Alexa-594 fluorescence conjugated hemagglutinin (HA) antibody (Invitrogen). Cells were imaged using a Zeiss LSM780 in two channels for Venus and Alexa-594 fluorescence. Mean membrane and cytosol fluorescence intensities were calculated. Membrane fraction is reported as normalized to control ratio between mean membrane to cytosolic intensities.
PCR
Approximately 107 HEK cells were used for RNA extraction using manufacturer’s protocols (RNeasy Plus, Qiagen). cDNA was obtained using iScript cDNA kit (BioRad) following manufacturers protocols. Primers for CaV1.1, CaV1.2 and CaV1.4 were designed and used for PCR amplification (Phusion High-Fidelity DNA polymerase, Thermo Scientific). PCR amplification was run using the manufacturer’s protocols with the following program changes: 40 cycles with 10s extension time. Annealing temperature was 56 °C for CaV1.4, 58 °C for CaV1.1 and CaV1.2. The product was run on a 2% Agarose gel (1:10,000 GelRed, Biotium) and imaged on a Li-Cor Oddyssey system. The following primer pairs were used at 0.5 μM:
CaV11_4689F CAAGAGGAGTATTATGGCTATCGG,
CaV11_5252R GGTCAGCAGTCCCTTCAGCA,
CaV12_6568F CTGCGACATGACCATAGAGG,
CaV12_7188R CAGCGAGGCTCGTACAGA,
CaV14_5045F CAAAGCCACGATGGTCTCCC and.
CaV14_5545R TTTCGCCCACGATGATAGG (Cybergene).
[Ca2+]i measurements
Intracellular Ca2+ concentration ([Ca2+]i) measurements carried out in HEK cells were performed using the fluorescent Ca2+ indicator Fura Red (Invitrogen). Cells were loaded with Fura Red using a buffer consisting of 5 μM Fura Red and 1 μl of 20% Pluronic F-127 (Invitrogen) diluted in KREBs (110 mM NaCl, 4 mM KCl, 1 mM NaH2PO4xH2O, 25 mM NaHCO3, 1.5 mM CaCl2x2H2O, 1.25 mM MgCl2x6H20, 10 mM Glucose and 20 mM HEPES, pH 7.40, sterile filtered). Cells grown on #1.5 18 mm diameter coverslips (Warner Instruments) were rinsed with KREBs buffer and loaded for 45 min with the loading buffer at 37 °C with 5% CO2. After 45 min cells were washed again with KREBs prior to being mounted in a perfusion chamber (Chamlide). Through the use of heated optical table and in-line perfusion feed heater the cells were kept at 37 °C throughout experiments. Loading protocol was evaluated by testing different loading times, both at room temperature and in incubator. The minimal dye concentration usable was identified through Ca2+ calibration of serial dilution of dye.
CaV1.2 inhibitors, nifedipine and verapamil, were both mixed fresh for each experimental day. Solutions were kept in fridge and protected from light. We chose to use a high concentration of nifedipine, 100 μM, to compensate for loss of active drugs during the longer experiments. Degradation was unavoidable within each experiment with cells and solutions kept at 37 °C. UV and 488 nm laser excitation also contributed to some drug degradation throughout experiments.
[Ca2+] calibration was done by the following protocol, first a 3 min long washout of the KREBs buffer using a 0 [Ca2+] containing buffer (110 mM NaCl, 4 mM KCl, 1 mM NaH2PO4xH2O, 25 mM NaHCO3, 1.25 mM MgCl2x6H20, 250 μM EGTA, 10 mM glucose and 20 mM HEPES, pH 7.40, sterile filtered) followed by 1 μM ionomycin in 0 [Ca2+] buffer for 4 min. Calibration ended with 7 min of 1.5 mM [Ca2+] KREBs buffer perfusion.
The strongest AT
1R-expressing cells were excluded from the analysis. Cells not responding to the first stimuli were also excluded. Cells were individually selected and the mean Ca
2+ dye intensity was calculated and calibrated using the data from the end of each experiment. The mean intensity ratio, R, between the 488 nm excitation image and the 405 nm excitation image for each cell was calculated for each timepoint. R
min and R
max are the minimum and maximum intensity ratios obtained during calibration. Calibrated [Ca
2+]
i, was calculated with k
d provided by Invitrogen as:
$$ {\left[{Ca}^{2+}\right]}_i={k}_d\frac{R-{R}_{min}}{R_{max}- R} $$
Ca2+ measurements of RVCM were performed using the fluorescent Ca2+ indicator Oregon Green BAPTA-1 (Invitrogen) with the same protocol as described for Fura Red. Oregon Green BAPTA1 was chosen as its weaker binding affinity compared to Fura Red made it insensitive to background Ca2+ sparklets in RVCM. Calibration was not possible for the RVCM Ca2+ experiments, thus the non-calibrated Ca2+ response for each cell was obtained by the mean intensity within each selected cell.
Nifedipine effects on bradykinin activation of bradykinin B2 receptors were evaluated through comparing signaling strength with or without pretreatment of 100 μM nifedipine on 100 nM bradykinin (Abcam) treatment. Experiments were performed on Oregon Green Bapta 1 loaded HEK cells. Cells were loaded in the same manner as for Fura Red but with 5 μM Oregon Green BAPTA-1. All other parameters were kept identical as for the 1 nM AngII experiments described above. Each experiment was calibrated as per the protocol described above.
Peak amplitudes were in all experiments calculated as peak above baseline. Baseline was defined as the mean intensity of a stable part of the trace prior to the peak. This calculation reflects the cytosolic increase in concentration rather than the absolute concentration.
Gαq dissociation
HEK cells expressing AT1R and Gαq-Gβγ FRET sensor were exposed to 1 nM AngII with or without 3 min pretreatment of 100 μM nifedipine. FRET was measured using a Zeiss LSM 510 LIVE microscope with a 40×/1.2 water immersion objective and excitation of 405 nm. YFP signal was corrected for mTurquoise bleedthrough and used as FRET intensity. Transfecting HEK cells with GαqmTq allowed for determination of donor bleed through into FRET channel. Bleed through coefficient, b, was calculated as ImTq/IFRET. In experiments, FRET channel intensities were then corrected as: FRETcorrected = IFRET – b*ImTq. FRET ratios were finally calculated as ImTurquoise / IFRETcorrected. Increase in FRET ratio corresponds with increased Gq-protein dissociation.
Statistical analysis
Statistical analysis was performed using Matlab, one way Anova analysis and subsequent multiple comparison tests based on studentized range distribution. Quantified data is shown as mean value +/− SEM.
Discussion
Blockers of the AT1 receptor and calcium channel CaV1.2 belong to the most commonly used drugs for treatment of hypertension and cardiovascular disease. Knowledge about AT1R signaling is to a large extent based on studies performed with AngII concentrations that exceed physiological and pathophysiological concentrations by several orders of magnitude. There are few studies, if any, that have examined whether CaV1.2 may control the strength of the AT1R signal. Here we show that the desensitization of AT1R observed following pharmacological concentrations of AngII, does not occur with concentrations of AngII in the physiological range and that acute exposure to therapeutical concentrations of CaV1.2 inhibitors amplify AT1R signaling.
AT
1R is the primary receptor mediating the biological functions of AngII and is abundantly expressed in the cardiovascular and renal systems. AT
1R signals through release of Ca
2+ from the intracellular stores via activation of phospholipase C, IP
3 and the IP
3 receptor [
2]. Both IP
3 production and Ca
2+ mobilization are common read-outs of AT
1R signaling [
2,
6,
35,
36]. By performing real-time recordings of [Ca
2+]
i, the dynamics of AT
1R signaling can be monitored continuously in live cell systems, whilst most IP
3 protocols rely on extraction of IP
3 at individual time-points. A concern when using Ca
2+ sensitive dyes is the possibility of toxic effects of the dye and of phototoxicity during prolonged recordings
. Our protocols were optimized to ensure minimal toxic effects of loading, minimized pixel dwell time and laser power. End point calibrations were performed to ensure that separate measurements are comparable across different systems.
The majority of previous studies on AT
1R signaling have used AngII concentrations that are several orders of magnitude higher than the circulating and/or tissue levels of AngII [
19,
21,
37]. Circulating levels of AngII in healthy humans have been reported to be in the order of 20 pM [
4,
5], Patients with heart failure often have several-fold increased levels of AngII [
38]. The primary cardiomyocyte cells used in this study were derived from rats. The circulating levels of AngII in rats have been reported to be approximately ten times higher than in humans [
19,
37]. Local levels of AngII in tissue can be even higher, depending on local production and metabolism, reaching up to 3-5 nM in rat renal interstitial fluid [
19‐
21].
Homologous desensitization of GPCRs is a well-known phenomenon, and numerous studies of desensitization have been carried out on AT
1R [
1,
2]. Most of these studies have been performed with concentrations of AngII in the range of 10-100 nM. In our study desensitization was only observed after exposure to the high concentration of AngII, while repeated exposure to 1 nM AngII did not result in desensitization. This lack of desensitization to low concentrations of AngII might explain why moderately increased endogenous AngII levels can have a deleterious long-term effect on cardiovascular and renal function.
Voltage-gated calcium channels serve an important role for the control of [Ca
2+]
i homeostasis in almost all mammalian cells and play a particularly dynamic role in excitable cells. The L-type VGCC 2, Ca
V1.2, is a common target for anti-hypertensive treatment. It was previously reported from several groups that AngII may modify the activity of the Ca
V1.2 [
8‐
10,
39]. The results are not unambiguous, but the majority of studies have shown that AngII increases the Ca
V1.2 activity. Here we showed that pre-incubation of both HEK cells and cardiomyocytes with inhibitors of Ca
V1.2 activity results in a robust amplification of AngII triggered [Ca
2+]
i signal. Notably, this amplifying effect of the Ca
V1.2 inhibitors was observed with concentrations that are comparable to those used to treat hypertension [
25,
26,
33,
34]. The amplification of the AngII signal that we observed in both nifedipine and verapamil treated cells may not be specific for Ca
V1.2, since it was also found following inhibition of the TRPC channels, which represent another ubiquitous Ca
2+ influx pathway. We hypothesize that the AT
1R complex is sensitive to changes in intracellular Ca
2+ concentration, and that increased Ca
2+ influx might have a desensitizing effect on the AT
1R complex. In support of this hypothesis, it has been shown by other groups that signaling from another G-protein coupled receptor, the dopamine D2 receptors, is controlled by intracellular Ca
2+ concentration [
11,
12]. A recent study showed that increased calcium influx through either L-type voltage gated calcium channels or from intracellular stores result in D2 receptor desensitization [
13]. The sensitivity of AT
1R (current study) and D2 receptors [
13] to Ca
2+ influx was not shared by the bradykinin receptor, and is thus not a common phenomenon for all GPCRs. The molecular mechanism by which calcium influx modulates the strength of AT
1R signaling remains elusive. We found no evidence for a recruitment of receptors to the plasma membrane or altered G
q-protein activity.
Conclusions
In conclusion, this study provides novel and clinically relevant information about how inhibition of CaV1.2 upregulate AT
1R signaling. Notably these effects were observed with physiological and therapeutically relevant concentration of AngII, nifedipine, verapamil. Calcium channel blockers are commonly used to treat hypertension, either in combination with other drugs such as inhibitors of AT
1R or ACE, or as mono-therapy. When calcium channels blockers are used as mono-therapy, the possibility for stimulation of AT
1R signaling should be taken into account. Notably, a recent meta-analysis, based on more than 40 studies, has shown that combination therapy that targets both the angiotensin system and the voltage gated calcium channels, will provide a better blood pressure control than mono-therapy that acts at one of these targets [
40].
Acknowledgements
The authors wish to thank Allen M. Samarel for valuable advice on the cardiomyocyte culture protocol, and W. J. Gadella for kindly providing the pGβ-2A-YFP-Gγ2-IRES-GαqmTq construct.