C10ORF10/DEPP, a transcriptional target of FOXO3, regulates ROS-sensitivity in human neuroblastoma

DEPP was identified as a FOXO3-induced gene by Affymetrix gene-chip expression profiling analysis in cells which stably express a 4-hydroxy-tamoxifen-inducible (4OHT), PKB-phosphorylation-independent FOXO3(A3)ERtm transgene. After activation of FOXO3 by treatment with 100 nM 4OHT for 3 hours, DEPP expression was induced in the neuroblastoma cell lines SH-EP/FOXO3 and NB15/FOXO3 171 and 87 fold compared to untreated controls and in the leukemia cell line CEM/FOXO3 50 fold (Figure 1a). To verify the observed DEPP regulation by the transcription factor FOXO3, DEPP mRNA expression was further examined by quantitative RT-PCR in the neuroblastoma cell lines NB1/FOXO3, NB3/FOXO3, NB15/FOXO3 and SH-EP/FOXO3. Activation of the ectopic FOXO3(A3)ERtm via treatment with 4OHT led to significant induction of DEPP mRNA expression up to 300 fold in SH-EP/FOXO3 and NB1/FOXO3 cells (Figure 1b). To study the regulation of DEPP via FOXO3 at protein level, immunoblot analyses were performed. Activation of FOXO3 by 4OHT treatment resulted in a time-dependent increase of DEPP protein expression (Figure 1c). As DEPP is described to be an insulin-responsive gene[1] we performed quantitative RT-PCR analysis to investigate the effects of insulin- and growth factor signaling on DEPP expression. For this purpose, SH-EP/FOXO3 and SH-EP/FOXO3-DBD cells[11] were cultured under low serum conditions in presence or absence of insulin. The SH-EP/FOXO3-DBD cell line contains a FOXO3 DNA-binding domain (DBD) that suppresses FOXO3-induced transcription. Growth factor withdrawal (media supplemented with 0.5% FCS) led to significantly increased DEPP mRNA expression in SH-EP cells, whereas treatment with insulin for 6 hours efficiently reduced DEPP-induction by low serum. Expression of the dominant-negative FOXO3-DBD protein in SH-EP/FOXO3-DBD cells strongly attenuated DEPP regulation by growth factor withdrawal, suggesting that FOXO transcription factors are essential for DEPP-induction during serum starvation (Figure 1d). Growth factor withdrawal also induces DEPP protein expression in SH-EP cells as shown by immunoblot analysis (Figure 1e). Taken together, these results demonstrate that DEPP is a transcriptional target of FOXO3 and regulated downstream of insulin-signaling in neuroblastoma cells.

To study whether DEPP is a direct target of FOXO3 in neuroblastoma cells, quantitative RT-PCR analysis of SH-EP/FOXO3 cells treated with 75 nM 4OHT and with 10 μg/ml of the protein biosynthesis inhibitor cycloheximide (CHX) for 2 hours was performed. Treatment with CHX did not prevent the induction of DEPP after FOXO3 activation, which implies that induction of DEPP by FOXO3 does not depend on de novo synthesis of additional proteins, but is due to direct transcriptional regulation (Figure 2a). To further test this hypothesis, a DEPP promoter reporter luciferase assay was performed in SH-EP/FOXO3 cells using a 1116 bp genomic fragment of the promoter cloned upstream of firefly luciferase. The DEPP promoter contains three putative binding sites for FOXO3 (Figure 2b), which were mutated for this experiment. The first binding site for FOXO3 is located at -537 (B1), the second at -179 (B2), and the third at -151 (B3) relative to the start of the DEPP mRNA[26].

Activation of ectopic FOXO3(A3)ERtm increased luciferase activity approximately 9 fold (over untreated control). Single mutations of each of the three FOXO3-binding sites markedly reduced luciferase activity, indicating that each site is necessary for efficient DEPP induction. Mutation of B1 reduced the FOXO3 response to 28% of untreated cells, whereas the mutated B2 site even further attenuated the activity to 22%. Mutation of B3 exerted the strongest effect and lowered FOXO3-responsiveness of the DEPP promoter to 15% of wildtype control. This was even less than combined mutation of B1 and B2. Combined mutation of all three FOXO3-binding sites (B1 + B2 + B3 MUT) reduced luciferase activity to control level (Figure 2b). To further strengthen these findings we performed chromatin immunoprecipitation (ChIP) analysis on the FOXO3-binding sites of the DEPP promoter (Figure 2c). These experiments demonstrated that FOXO3 binds to B1 + B2 and, with highest efficiency, to the B3 consensus sequence, which is consistent with the results obtained by the luciferase promoter reporter assay in Figure 2c. The consensus sequences B1 and B2 are in close proximity, so one RT-PCR primer pair for B1 + 2 was generated.

These data demonstrate that FOXO3 activates all three consensus elements in the DEPP promoter and that all three FOXO3 binding sites are important for DEPP regulation by FOXO3 in neuroblastoma cells.

FOXO3 activation has been shown to induce apoptosis in neuroblastoma cells[5]. To study a possible effect of DEPP on FOXO3-mediated apoptosis, the DEPP expression was knocked down by lentiviral expression of DEPP-specific shRNA as shown in Figure 3a. Three individual clones of SH-EP/FOXO3-shDEPP (Figure 3a, left panel) and bulk-selected NB15/FOXO3-shDEPP (Figure 3a, right panel) were analyzed by immunoblot and quantitative RT-PCR analysis. Propidium iodide-(PI) FACS-analysis showed significantly reduced FOXO3-mediated apoptosis in shRNA-expressing neuroblastoma cell lines (Figure 3b).

We recently demonstrated that FOXO3-induced apoptosis is associated with and mediated by a biphasic accumulation of ROS[11]. Thus we analyzed ROS steady state levels in DEPP-knockdown cells and controls at the specific time points by live-cell imaging. Knockdown of DEPP almost completely prevented both, the primary (4 hours and 12 hours) and secondary (16 and 48 hours) ROS increase during FOXO3-activation in SH-EP/FOXO3 and NB15/FOXO3 cells, respectively (Figure 3c). In a previous study we observed that the oxidoreductase p66/SHC1 is strongly phosphorylated at Ser36 during FOXO3-induced ROS accumulation[11]. We therefore performed immunoblot analysis of p66/SHC1 and pSer36-p66/SHC1 protein in SH-EP/FOXO3-shCtr and SH-EP/FOXO3-shDEPP cells (three individual clones), which demonstrated that p66/SHC1 was not phosphorylated after FOXO3 activation in DEPP-knockdown cells (Figure 3d). This is consistent with the pronounced effect of DEPP-knockdown on FOXO3-induced ROS accumulation demonstrated by live-cell fluorescence imaging analyses (Figure 3c).

We have previously shown that BCL2L11/Bim induction[11] and BIRC5/Survivin repression[10] are essential for FOXO3-induced ROS accumulation and cell death. Knockdown of DEPP neither prevented Bim induction nor Survivin repression (data not shown), suggesting that knockdown of DEPP does not interfere with the initiation phase of ROS production but might affect cellular ROS detoxification.

To directly study the effect of DEPP expression on ROS production we generated stable cell lines that conditionally express DEPP (SH-EP/tetDEPP) or EYFP-tagged DEPP (SH-EP/tetEYFP-DEPP) in a tetracycline-regulated manner (Figure 4a). DEPP overexpression on its own slightly increased cellular ROS levels (Figure 4b) but did not elevate cellular ROS to the level of FOXO3-induced ROS (Figure 4c). Furthermore, DEPP overexpression alone did not increase phosphorylation of p66/SHC1 (Figure 4d). This increase of cellular ROS by conditional DEPP expression was not sufficient to induce spontaneous apoptotic cell death as demonstrated by PI-FACS analysis of SH-EP/tetDEPP and SH-EP/tetEYFP-DEPP cells treated with doxycycline (doxy) for up to 72 hours (Additional file1: Figure S1). This suggests that elevated DEPP expression does not constitute a death signal per se, but rather changes the ability of neuroblastoma cells to detoxify ROS and is therefore necessary, but not sufficient, for FOXO3-induced cell death.

As DEPP knockdown efficiently reduced FOXO3-induced ROS accumulation and DEPP overexpression by its own increased steady state cellular ROS we next searched for a possible explanation of this effect. Under normal conditions low amounts of hydrogen peroxide (H₂O₂) are mainly detoxified in the peroxisomes by the enzyme CAT/catalase[13]. Catalase was also described as a direct transcriptional target of FOXO transcription factors in various cell types[16, 17]. Protein sequence analysis suggests that DEPP contains a peroxisomal-targeting-signal-2 (PTS2) in its N-terminus that allows binding to the PEX7 receptor[27] and might mediate the import of DEPP into peroxisomes[3]. As peroxisomes play an essential role in ROS control especially in cells of neuronal origin[28] we analyzed peroxisomal function by measuring catalase enzyme activity. Catalase activity was significantly reduced in SH-EP/tetDEPP and SH-EP/tetEYFP-DEPP cells after 24 hours of DEPP overexpression compared to SH-EP/tetEGFP cells (Figure 5a). On the other hand, knockdown of DEPP in SH-EP/FOXO3-shCtr cells resulted in significantly increased catalase enzyme activity after 4OHT treatment (Figure 5b). Both, in DEPP-overexpressing and DEPP-knockdown cells, the amount of catalase protein level did not change significantly (Figure 5a,b). We only observed slightly increased catalase expression (1.45 fold compared to untreated controls) after 24 hours of FOXO3 activation in SH-EP/FOXO3-shCtr cells and no regulation in the SH-EP/FOXO3-shDEPP cell clones (Figure 5b). Next, we analyzed protein expression of PPARG, which is described to increase peroxisomal proliferation[29] and to directly regulate catalase enzyme expression and activity[24, 30]. We found protein levels of PPARG strongly upregulated in SH-EP/FOXO3-shDEPP cells compared to SH-EP/FOXO3-shCtr cells (Figure 5c), which is in line with the increased catalase enzyme activity in these cells (Figure 5b). These data suggest that cellular DEPP lowers the ability of neuroblastoma cells to cope with cellular ROS as reflected by reduced PPARG protein levels and catalase enzyme activity.

To further test this hypothesis, we treated SH-EP/tetEGFP, SH-EP/tetDEPP, SH-EP/tetEYFP-DEPP, SH-EP/FOXO3-shDEPP and NB15/FOXO3-shDEPP cells with H₂O₂ and measured cell death by flow cytometric analysis of PI-stained nuclei. As shown in Figure 5d SH-EP/tetDEPP and SH-EP/tetEYFP-DEPP cells (upper panel) show higher H₂O₂-induced apoptosis, whereas SH-EP/FOXO3-shDEPP (middle panel) and NB15/FOXO3-shDEPP cells (lower panel) are significantly more resistant to H₂O₂ treatment than controls. Etoposide treatment of SH-EP cells activates FOXO3, leads to ROS accumulation[11] and significantly increases the expression of endogenous DEPP even under conditions of growth factor withdrawal (Figure 6a). We therefore tested the effect of the DNA-damaging agent etoposide on cells that overexpress DEPP in a tetracycline-regulated manner. As shown in Figure 6b, DEPP-overexpression led to a significant increase (P < 0.05) in etoposide-induced apoptosis. Taken together these results demonstrate that DEPP reduces the cellular ROS detoxification capacity, which in turn increases the sensitivity to H₂O₂-and etoposide-induced apoptosis in neuroblastoma cells.

DEPP was described to reside exclusively in the nucleus of HEK293 cells[3], whereas Stepp et al. described DEPP as an unstable protein located in aggresomes in Vero cells[31]. To analyze the localization of DEPP in neuroblastoma cells we performed subcellular fractionation and immunoblot analyses of SH-EP/tetEGFP and SH-EP/tetEYFP-DEPP cells treated with 200 ng/ml doxy for 24 hours. As shown in Figure 7a (left panel) we found DEPP mainly present in the cytoplasmic and not in the nuclear fraction. Catalase, which is located in the peroxisomes and the mitochondria, was also mainly present in the cytoplasmic fraction. In a next step we treated SH-EP/tetEYFP-DEPP cells with 200 ng/ml doxy for 24 hours, isolated the peroxisomes and performed immunoblot analysis of DEPP expression (Figure 7a, right panel). By this subcellular fractionation experiment we clearly demonstrated that a significant proportion of DEPP is located in peroxisomes. To further analyze the localization of DEPP we performed live cell confocal imaging of SH-EP/tetEYFP-DEPP cells treated with 200 ng/ml doxy for 24 hours. Staining of the mitochondria with MitotrackerRed/CMXRos and labeling of peroxisomes by expression of a CellLight^® Peroxisomes-RFP marker protein clearly showed that the DEPP protein co-localizes with both, mitochondria and peroxisomes in neuroblastoma cells (Figure 7b). We detected DEPP in SH-EP/EYFP-DEPP cells exclusively in the mitochondria (Figure 7b, top two lines) or in the peroxisomes (Figure 7b, bottom line) and also simultaneously in both organelles (Figure 7b, third line). Therefore the live cell confocal imaging analyses indicate that the DEPP protein is present in both organelles and may translocate between mitochondria and peroxisomes, which are cooperating and cross-talking[32] and are both critical for the control of cellular ROS[15, 33, 34]. As DEPP lacks a mitochondrial targeting sequence but contains a PTS2-signal at its N-terminus we next studied whether DEPP is targeted to peroxisomes in a PTS2-dependent manner via interaction with the PEX7 receptor[27]. As shown in Figure 7c, DEPP co-immunopurifies with the peroxisomal PEX7 receptor in SH-EP/tetDEPP cells treated with 200 ng/ml doxy for 24 hours. This is in line with the subcellular fractionation assays (Figure 7a) and the live cell imaging experiments (Figure 7b) demonstrating that DEPP is present in peroxisomes.

The neuroblastoma cell lines STA-NB1, STA-NB3 and STA-NB15 were isolated at the St. Anna Children’s Hospital (Vienna, Austria) and are termed NB1, NB3 and NB15, respectively[38]. SH-EP cells were kindly provided by N. Gross, Lausanne, Switzerland[39]. The acute lymphoblastic leukemia cell line CEM/C7H2, a subclone of the CCRF-CEM cell line and all other cell lines were cultured in RPMI 1640 (Lonza, Basel, Switzerland) containing 10% fetal calf serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 2 mM L-glutamine (Gibco BRL, Paisley, GB) at 5% CO₂ and 37°C in saturated humidity. Phoenix^TM packaging cells for helper-free production of amphotropic retroviruses[40] and HEK293T packaging cells for production of lentiviruses were cultured in DMEM (Lonza, Basel, Switzerland). Cell culture was tested routinely for mycoplasma contamination using the VenorRGeM-mycoplasma detection kit (Minerva Biolabs, Germany). All reagents were purchased from Sigma-Aldrich (Vienna, Austria) unless indicated otherwise. For each experiment, mid-log-phase cultures were seeded in fresh medium.

The vectors pLIB-FOXO3(A3)-ER-iresNeo, pQ-tetCMV-SV40-Neo and pQ-tetCMV-EGFP-SV40-Neo have been described previously[5, 41, 42]. For conditional gene expression, the coding region of DEPP was amplified from human cDNA with primers containing appropriate restriction enzyme sites. The fragment was inserted into the MfeI and XhoI sites of the tet-regulated expression plasmid pQ-tetCMV-SV40-Neo generating the plasmid pQ-tetCMV-DEPP-SV40-Neo and into the MfeI and XhoI sites of the EYFP-containing plasmid pQ-tetCMV-EYFP-SV40-Neo (pQ-tetCMV-EYFP-DEPP-SV40-Neo). The lentiviral vectors coding for human DEPP-specific shRNA and the control vector pLKO.1 were obtained from Sigma-Aldrich (Vienna, Austria). pLIB-mycTag-FOXO3-DBD-iresPuro was constructed by inserting the FOXO3-DBD fragment from pSG5-MycTag-FOXO3-DBD[43] into the EcoR1 and Sal1 sites of the pLIB-MCS2-iresPuro plasmid[41].

6 × 10⁵ Phoenix™ packaging cells were transfected with 2 μg of retroviral vectors and 1 μg of a plasmid coding for VSV-G protein using Lipofectamine2000 (Invitrogen, Carlsbad, USA). For production of lentiviruses 6.5 × 10⁵ HEK293T cells were transfected with 1.6 μg pLKO.1-shDEPP plasmids coding DEPP-specific shRNAs (Sigma-Aldrich, Vienna, Austria) and the packaging plasmid pCMV 8.91 (kindly provided by D. Trono, EPFL, Lausanne). After 48 hours the virus-containing supernatants were filtered through 0.22 μm syringe filters (Sartorius, Goettingen, Germany) and incubated with the target cells for at least 6 hours. SH-EP/FOXO3 and NB15/FOXO3 cells were infected to generate SH-EP/FOXO3-Ctr, SH-EP/FOXO3-shDEPP (clone-10, -12 and -13), NB15/FOXO3-Ctr and NB15/FOXO3-shDEPP (bulk-selected) cells. pQ-tetCMV-DEPP-SV40-Neo, pQ-tetCMV-EYFP-DEPP-SV40-Neo, and pQ-tetCMV-EGFP-SV40-Neo supernatants were used to generate SH-EP/tetDEPP, SH-EP/tetEYFP-DEPP and SH-EP/tetEGFP cells for doxycycline-inducible DEPP and EGFP expression using the “tet-on” system [41]. pLIB-mycTag-FOXO3-DBD-iresPuro supernatants were used to infect SH-EP cells (SH-EP/FOXO3-DBD) [11].

Generation of the Affymetrix microarray data set was performed at the Expression Profiling Unit of the Medical University Innsbruck according to the manufacturer’s protocols. The procedure and protocols have been described elsewhere[44]. The data analysis was performed in R (version). Raw data has been pre-processed using the GCRMA method[45]. Raw and pre-processed data has been deposited at the Gene Expression Omnibus (GEO accession number GSE53046).

A luciferase reporter plasmid containing the DEPP promoter (-1116 bp relative to the transcription start site) was purchased from Switchgear Genomics (Menlo Park, USA). The three putative FOXO3 binding sites in the DEPP promoter[26] (named B1, B2 and B3) were mutated by sited directed mutagenesis PCR using circular mutagenesis. The first site is located at -537 to -530 (B1), the second at -179 to -172 (B2), and the third at -151 to -143 (B3) relative to the transcription start (Primers for mutagenesis PCR: B1-fwd: GCTTTCGGAGGATTTGTTTGTCGAC TTGTTCACCAGATAT, B1-rev: ATATCTGGTGAACAAGTCGACAA ACAAATCCTCCGAAAGC, B2-fwd: CTGCCCTGCAGCGTAACTTTT CCCCAGCCTCCTAC, B2-rev: GTAGGAGGCTGGGGAAAAGTTAC GCTGCAGGGCAG, B3-fwd: CAGGCAGAAAACACC CTCCAAGCTGG, B3-rev: CCAGCTTGGAGGGTGTTTTC TGCCTG/ T_a = 58°C, 18 PCR-cycles). Promoter reporter plasmids with mutated FOXO-binding sites B1, B2, B3, B1 + B2 and B1 + B2 + B3 were used for luciferase activity analysis.

To quantify DEPP mRNA levels, we designed “real-time” RT-PCR assays, using GAPDH as reference gene. NB1/FOXO3, NB3/FOXO3, NB15/FOXO3 and SH-EP/FOXO3 cells were cultured in the presence of 100 nM 4OHT for the times indicated to activate the FOXO3(A3)ERtm transgene. Total RNA was prepared from 5 × 10⁶ cells using TRIzol^TM Reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA using the Revert H Minus First Strand cDNA Synthesis Kit (Thermo Scientific, Huntsville, USA). Quantitative RT-PCR was performed as described previously[11] using DEPP (forward ACTGTCCCTGCTCATCCATTCTC and reverse AGTCATCCAGGCTAGGAGAGGG) and GAPDH-specific oligonucleotides (forward TGTTCGTCATGGGTGTGAACC and reverse GCAGTGATGGCATGGACTGTG). After normalization on GAPDH expression, regulation was calculated between treated and untreated cells.

Immunoblot analysis and subcellular fractionation were performed as described previously[11]. The membranes were incubated with primary antibodies specific for DEPP, PEX7, GAPDH (Novus, Littleton, USA), Bim, beta-Catenin (BD Biosciences, Heidelberg, Germany), Catalase (Calbiochem, San Diego, USA), p66/SHC1, phosphorylated pSer36-p66/SHC1 (Abcam, Cambridge, UK), PPARG, Lamin, CoxIV (Cell Signaling,Danvers, USA), GFP (Sigma-Aldrich,Vienna,Austria) and alpha-Tubulin (Oncogene Research Products, Boston,USA).

After incubation with anti-mouse, anti-rat or anti-rabbit horseradish-peroxidase-conjugated secondary antibodies the blots were analyzed by enhanced chemiluminescence substrate (GE-Healthcare, Vienna, Austria) according to the manufacturer’s instructions and detected with an AutoChemiSystem (UVP, Cambridge, GB). Quantification of protein expression was done with the ImageJ 1.48 software, according to the ImageJ User Guide (http://​imagej.​nih.​gov/​ij/​index.​html).

The peroxisomal fraction was isolated by using the peroxisome isolation kit (PEROX1; Sigma-Aldrich, Vienna, Austria), according to the instructions of the manufacturer. Briefly, 4 × 10⁸ SH-EP/tetEYFP-DEPP cells were treated with 200 ng/ml doxy for 24 hours, harvested, resuspended in peroxisome extraction buffer and homogenized in a dounce homogenizer. Next, the cells were centrifuged for 10 minutes at 1000 g. The supernatant represents the “input fraction”. After several centrifugation steps according to the manufacturer’s protocol, the pellet was collected in 1x peroxisome extraction buffer. Isolation of the peroxisomes was done on a density gradient. By a centrifugation step for 1.5 hours at 100.000 g the purified peroxisomes were separated from the mitochondria. To measure the purity of the peroxisomal fraction immunoblot analyses with catalase (peroxisomes) and CoxIV antibodies (mitochondria) were performed.

CoIP was performed with a Pierce Crosslink Magnetic IP/Co-IP kit (Pierce, Rockford, USA) according to the instructions of the manufacturer. Briefly, 5 μg of PEX7 antibody (Novus, Littleton, USA) were covalently cross-linked to 25 μl of A/G magnetic beads. The prepared beads as well as beads without cross-linked antibody (IP Ctr) were incubated with extracts from SH-EP/tetDEPP cells treated with 200 ng/ml doxy for 24 hours, washed to remove non-bound material and eluted in a low-pH elution buffer that dissociates bound antigen from the antibody- linked beads. The total protein (TP) and the eluates (IP and IP Ctr) were analyzed via immunoblot.

ChIP was performed with a Millipore Magna ChIP Kit (Millipore, Darmstadt, Germany) according to the instructions of the manufacturer. Approximately 2 × 10⁷ SH-EP/FOXO3 cells and 20 μl of the protein G beads coupled with 5 μl of anti-FOXO3 antibody (Santa Cruz, Dallas, USA) were used for each preparation. For quantification of FOXO3 binding to the DEPP promoter quantitative real time RT-PCR was performed with primers for the binding sites B1 + B2 (forward AAAACAGCTTGGTGGGCGGG and reverse AACAAGCTTTGGGGCAGGGG) and B3 (forward CTGCTCCTAGGAGAGACACACCCTG and reverse CTGCTACGTTTGCTGTGCTTAGTGC).

Apoptosis was measured by staining the cells with propidium-iodide (PI) and forward/sideward scatter analysis using a CytomicsFC-500 Beckman Coulter. 2 × 10⁵ cells were harvested and incubated in 500 μl hypotonic PI solution containing 0.1% Triton X-100 for 4 to 6 hours at 4°C. Stained nuclei in the sub-G1 marker window were considered to represent apoptotic cells[46].

To determine direct regulation of the DEPP-promoter by FOXO3, promoter plasmids containing the DEPP-promoter (1116 bp) and mutated variants were transiently transfected into SH-EP/FOXO3 cells using the JetPrime^® Reagent (Polyplus, Berkeley, USA) according to the manufacturer’s instructions. Subsequently the cells were cultured in the presence of 100 nM 4OHT for 4 hours to activate the FOXO3 transcription factor. Luciferase activity was measured with a Luciferase Assay System kit (Promega, Fitchburg, USA) according to the manufacturer’s instructions. The reactions were done in duplicates and repeated three times. Luciferase activity was calculated between treated and untreated cells.

For ROS measurements, cells were grown on LabTek Chamber Slides™ (NalgeNunc International, Rochester, USA) coated with 0.1 mg/ml collagen and incubated with reduced MitoTrackerRed CM-H2XROS (Invitrogen, Carlsbad, CA, USA) for 20 minutes according to the manufacturer’s instructions (final concentration 500 nM). Images were collected with an Axiovert200M microscope equipped with filters for EYFP (exitation: BP500/20, emission: BP535/30) and RFP (excitation: BP546/12, emission: LP590) and a 63x-oil objective (Zeiss, Vienna, Austria).

Cells were grown on LabTek Chamber Slides™ (NalgeNunc International, Rochester, USA) coated with 0.1 mg/ml collagen and incubated for 15 minutes with 30 nM MitoTrackerRed CMX-Ros (Invitrogen, Carlsbad, USA) to stain mitochondria. Peroxisomes were labelled with the CellLight^® Peroxisome-RFP vector (Life Technologies, Carlsbad, USA) according to the manufacturer’s instructions. Cells were analyzed by live confocal microscopy using an inverted microscope (Zeiss Observer.Z1; Zeiss, Oberkochen, Germany) in combination with a spinning disc confocal system (UltraVIEW VoX; Perkin Elmer, Waltham, MA, USA). All images were acquired using a 63× oil immersion objective.

Catalase enzyme activity was analyzed with a Catalase Assay Kit (Abcam, Cambridge, UK). Cells were cultured in the presence of 50 nM 4OHT (SH-EP/FOXO3-shDEPP) or 200 ng/ml doxy (SH-EP/tetEGFP, SH-EP/tetDEPP, SH-EP/tetEYFP-DEPP) for the times indicated. 1 × 10⁶ cells were harvested and used for the enzyme assay according to the manufacturer’s instructions. After 30 minutes incubation time the reaction was stopped and the optical density was measured with a Benchmark Microplate Reader (BioRad Laboratories, Munich, Germany). Catalase enzyme activity was calculated between treated and untreated cells.