Characterization of subgroup J avian Leukosis virus isolated from Chinese indigenous chickens

In an indigenous chicken farm, chickens suffering from hepatosplenomegaly, yellowish-white tumors on the visceral surface, and presenting a drastic decline in egg production were suspected to be infected with ALV. Necropsies were performed on the diseased birds soon after death. Part of the tissues with altered local pathology were fixed with 4% formalin for pathological section.

Thirty chickens were randomly selected and plasma samples were collected in sterile 2-mL tubes containing 1% sodium heparin. After centrifugation at 2000 rpm for 3 min, each plasma sample was inoculated into DF-1 cells originating from embryonic fibroblast cells of C/E type chickens resistant to subgroup E endogenous ALV. The cultures were maintained for 9 days in Dulbecco’s modified Eagle’s medium supplemented with 2% fetal bovine serum at 37 °C in a 5% CO2 incubator. Next, each supernatant sample was subjected to ELISA using an ALV antigen test kit (IDEXX, USA) to detect the ALV group-specific antigen p27. Meanwhile, the cultured cells were fixed by using an aldehyde fixative and then were detected by immunofluorescence antibody assays for ALV-J, ALV-A/B, reticuloendotheliosis (REV), and Marek’s disease virus (MDV) infection by using ALV-A/B specific polyclonal antibody, ALV-J specific monoclonal antibody JE9, REV specific monoclonal antibody 11B118, and MDV specific monoclonal antibodies BA4 and H19, respectively. Then FITC-labeled anti-mouse IgG secondary antibody was used to detect primary antibody binding, after that the cells were observed by using a fluorescence microscope.

A pair of primers (ALV-F: GATGAGGCGAGCCCTCTCTTTG; ALV-R: TGTGGTGGGAGGTAAAATGGCGT) used to target the entire sequence of env was designed to specifically amplify a highly conserved region present in all ALV subgroups. PCR was performed as described by Meng et al. [19] with the DNA of p27-positive DF-1 cells. PCR products were separated by 1.0% agarose gel electrophoresis, purified by using the Omega Gel Extraction kit (Omega, USA),and were then cloned into the PMD18-T vector. The resulting construct was then used to transform Escherichia coli DH5α cells (TaKaRa, Japan). The positive clones were then sequenced by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China).

The homologies of the nucleic acid and amino acid sequences were compared between gp85 from each ALV-J strains and the reference sequences. To assess the trends in molecular evolution of the ALV-J strains, gp85 from different ALV reference strains were included for phylogenetic analysis (Table 1). Phylogenetic analysis was accomplished by muscle alignment and the neighbor-joining and maximum parsimony methods with 500 bootstrap replicates using software MEGA 5.1.

Necropsies were performed on the diseased birds soon after death. Hepatosplenomegaly and yellowish-white tumors on the visceral surface were the apparent symptoms (Fig. 1a). Histolopathological analysis of the liver revealed infiltration of eosinophilic myeloid cells around the hepatocytes (Fig. 1b).

Ten strains of ALV-J, named as JS16JH01–JS16JH10 were isolated from an indigenous chicken farm in China. The ALV p27 antigen was detected in the supernatants of the DF-1 and CEF cultures inoculated with the plasma of isolated strains. The results showed that 10 samples inoculated with plasma samples were positive for ALV p27 antigen, whereas the samples of the control group were negative, and it indicated that the chickens were infected with exogenous ALV. Immunofluorescence antibody assays revealed that the infected cells were only labeled with ALV-J specific monoclonal antibody JE9; no reaction with ALV-A/B specific polyclonal antibodies, REV specific and MDV specific monoclonal antibodies (Fig. 2) was shown.

Target fragments of approximately 2200 bp were amplified from the DF1 cells infected with ALV-J using the common primers (Genbank accession no. MG700533-MG700542). Then gp85 sequences were obtained, and were compared with the sequences of reference strains of different subgroups. The results showed that the gene homology with ALV-J ranged from 89.7–94.8%, but no more than 51.8% compared with the other subgroups. What is more, their gp85 genes were quite varied, with identities of 92–98% with themselves at the nuclear acid level. Furthermore, phylogenetic analysis revealed that all the 10 strains were on the same branch as the ALV-J reference sequence (Fig. 3).

Further analysis suggested that there were multiple deletions and mutations in the gp85 gene in the isolated strains in comparison with NX0101 and HPRS-103 (Fig. 4). Compared with NX0101, 60 nucleotides were missed in rTM and DR-1. In addition, a missing asparagine and a missing arginine in the 62nd and 119th amino acid positions were observed. Furthermore, A143G, R151P, and P154S, from most of the isolated strains, changed the hydrophilicity of the amino acid in the cells and the advanced structure, as well as the function, of the protein (Table 2).